Patents.com Logo
Choose Language:
 

Title:  DNA encoding a pituitary-specific thyroid hormone receptor
Patent ID: US5284999
Issue Date:  February 08, 1994
Abstract:

The invention relates to the purification and cloning of a receptor for thyroid hormone. The receptor is designated PSTHR and is related to hormone receptors encoded by the genes erbA.alpha.-1, erbaA.alpha.-2 and erbA.beta.-1. The gene encoding PSTHR, erbA.beta.-2, is partially homologous to the erbA.beta.-1. However, PSTHR differs from the product of erbA.beta.-1 in that its expression is limited to the anterior pituitary gland. The invention additionally concerns the uses for PSTHR in the diagnosis and therapy of human conditions.

 

 






Translations
Inventor(s): 
Chin;  William W.  (Wellesley,  MA,  US) , Email and Contact Information
Hodin;  Richard A.  (Brookline,  MA,  US) , Email and Contact Information
Lazar;  Mitchell A.  (Havertown,  PA,  US) Email and Contact Information
Assignee:  Brigham and Women's Hospital;  (Boston,  MA,  US)
Application No.:  069643
Filing Date:  May 13, 1993
Primary Class:  435/252.3
Other Classes:  435/320.1  435/69.1  536/23.5 
Field of Search:  435/69.1,252.3,320.1 526/23.5
US Patent Document(s):
Foreign Reference(s):
Parent Case Text: This application is a continuation of application Ser. No. 07/504,806, filed Apr. 5, 1990, now abandoned.


Claim(s):

What is claimed is:

1. A recombinant DNA molecule encoding the thyroid hormone receptor PSTHR.

2. The recombinant molecule of claim 1 wherein said molecule is a replicable vector.

3. The recombinant molecule of claim 1 wherein said DNA encoding the thyroid hormone receptor PSTHR comprises the nucleotide sequence as shown in Table I.

4. A host cell containing the vector of claim 2.

5. A purified and isolated DBA molecule encoding PSTHR and comprising the nucleotide sequence as shown in Table I.

6. A purified and isolated DNA molecule encoding PSTHR and which hybridizes under conditions of high stringency to a DNA molecule having the nucleotide sequence shown in Table I.



Description:

FIELDOF THE INVENTION

The invention relates to the isolation and purification of a cellular receptor molecule for thyroid hormone. The invention further relates to the cloning of the gene coding for this receptor. The invention also relates to uses for the purifiedhormone receptor molecule.

BACKGROUND OF THE INVENTION

Thyroid hormone [3,5,3'-triiodothyronine (T.sub.3)] exerts diverse metabolic effects on mammalian cells, primarily through its interaction with nuclear receptor proteins of the cells. The T.sub.3 -receptor complex regulates expression of nearbytarget genes by transcriptional and posttranscriptional mechanisms.

Nuclear receptors for thyroid hormone have been identified as products of the c-erbA protooncogene. (Weinberger, C. et al., Nature 324:641 (1986); Sap, J. et al., Nature 324:635 (1986)). The c-erbA gene is the cellular counterpart of the viraloncogene v-erbA. Sap et al. (Nature 324:635-640 (1986)) reported that the c-erbA protein is a nuclear protein which functions as a receptor for thyroid hormone, whereas the v-erbA product is located in the nucleus but is defective in binding thyroidhormone. In the rat, three c-erbA-related cDNAs have been described and designated r-erbA.alpha.-1, r-erbA.alpha.-2 and r-erbA.beta.-1. The proteins encoded by these genes are classified as alpha or beta forms on the basis of the predicted amino acidsequences and have homologs in man.

The rat r-erbA.alpha.-1and r-erbA.alpha.-2 mRNAs represent alternative splice products of a single rat erbA.alpha. gene. This gene encodes proteins that are identical for the first 370 amino acids from the N-terminus, and then divergecompletely.

The protein encoded by erbA.alpha.-1 binds thyroid hormone, whereas the protein encoded by erbA.alpha.-2 does not. The thyroid hormone binding domain is included within the divergent regions of the two proteins, and this may account for thedifference in binding between the two proteins. (Lazar, M. A. et al., Mol. Endocrinol. 2:893 (1988); Izumo, S. et al., Nature 334:539 (1988); Mitsuhashi, T. et al., Proc. Nat. Acad. Sci. 85:5804 (1988)).

In the rat, expression of the erbA genes appears to be organ-specific. The erbA.alpha.-1 mRNA is most abundant in skeletal muscle and brown fat, whereas erbA.alpha.-2 is most highly expressed in brain and hypothalamus. The related erbA.beta.-1mRNA is highly expressed in kidney and liver. (Koenig, R. J. et al., Proc. Nat. Acad. Sci. 85:5031 (1988)). The protein product of erbA.beta.-1 mRNA binds thyroid hormone with high affinity.

T.sub.3 is an iodine-containing amino acid secreted by the thyroid gland. Thyroid function in turn is regulated by the thyroid-stimulating hormone (TSH) of the anterior pituitary gland, and the rate of TSH secretion by the pituitary is regulatedin part by circulating thyroid hormone levels via feedback inhibition.

Thyroid hormone exerts physiological effects throughout the body. Thyroid hormone increases oxygen consumption in almost all metabolically active tissues, with a concomitant increase in nitrogen excretion. If food intake does not compensate forthe loss of nitrogen, endogenous protein and fat stores are catabolized and weight is lost. The circulating levels of thyroid hormone are important in regulating physiological activity throughout the body, and inappropriately high or low levels ofthyroid hormone are implicated in metabolic disorders.

Hypothyroidism, characterized by low circulating levels of thyroid hormones, is associated with a variety of physiological abnormalities. In children, bone growth is slowed and epiphyseal closure is delayed. In adults, protein catabolismresults in muscle weakness and osteoporosis; there are also secondary effects on carbohydrate and cholesterol metabolism, as well as on the nervous system and the skin.

Hyperthyroidism, characterized by high circulating levels of thyroid hormone, is associated with nervousness, weight loss, heat intolerance, and a high basal metabolic rate. In general, the secretion of TSH from the pituitary gland is depressedin hyperthyroidism because of the negative feedback effect of the high circulating thyroxine and triiodothyronine levels.

In a few patients hyperthyroidism has been associated with pituitary resistance to thyroid hormone. (Spanheimer, R. G. et al., Arch. Intern. Med. 142:1283-1286 (1982)). This condition is characterized by elevated levels of thyroid hormone inassociation with an inappropriately elevated serum TSH level. The pituitary gland plays a unique role in modulating the circulating levels of thyroid hormones through its secretion of TSH.

The ability to regulate TSH production by the pituitary has broad implications for treating conditions and diseases in which the levels of thyroid hormones are important. As TSH production is regulated in part by means of thyroid hormone, themechanism of thyroid hormone binding in the pituitary is of great importance for controlling pituitary TSH production.

SUMMARY OF THE INVENTION

The invention relates to the isolation and purification of a pituitary receptor for thyroid hormone, designated PSTHR (Pituitary Specific-Thyroid Hormone Receptor). The invention further relates to the cloning of the gene encoding this receptor. The invention also relates to the uses of this receptor in the diagnosis and therapy of human conditions and diseases.

BRIEF DESCRIPTION OF THE FIGURE

FIG. 1 shows T.sub.3 binding of r-erbA.beta.-2 protein. Labeled T.sub.3 (0.1 nM) was incubated with unlabeled T.sub.3 at 0 to 100-fold excess.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

I. Cloning of Gene Coding for the Thyroid Hormone Receptor Molecule

The present invention relates to the cloning of the gene designated erbA.beta.-2, which encodes a pituitary-specific receptor for thyroid hormone (PSTHR), and uses for the receptor.

A first step for obtaining a gene sequence which encodes the rat PSTHR comprises obtaining DNA from cells which contain such gene sequences. This DNA is used to prepare a genomic library. Alternatively, CDNA is obtained using cells expressingPSTHR receptors and a CDNA library is prepared. Techniques for preparing such libraries are disclosed by Maniatis, T., et al. (In: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y. (1982)).

To identify and isolate the desired gene sequence, the above-described library is then screened for gene sequences which hybridize to a probe sequence of either the entire rat PSTHR encoding sequence, a sequence complementary to such receptorencoding sequence, or a fragment of either of such sequences. Thus, for example, to isolate a DNA molecule which is capable of encoding a human thyroid hormone receptor, human thyroid hormone receptor expressing cells are used to produce a DNA (or CDNA)library. The members of this library are screened for their ability to hybridize with the above-described rat PSTHR probe sequence using techniques, such as those disclosed by Maniatis, T., et al. (In: Molecular Cloning. A Laboratory Manual, ColdSpring Harbor Laboratories, Cold Spring Harbor, N.Y. (1982)), or by Haymes, B. D., et al. (In: Nucleic Acid Hybridization. A Practical Approach, IRL Press, Washington, D.C. (1985)).

The DNA probe may be labeled with a detectable group. Such detectable group can be any material having a detectable physical or chemical property. Such materials have been well-developed in the field of immunoassays and in general most anylabel useful in such ethods can be applied to the present invention. Particularly useful are enzymatically active groups, such as enzymes (see Clin. Chem. 22:1243 (1976)); enzyme substrates (see British Pat. Spec. 1,548,741)); coenzymes (see U.S. Pat. Nos. 4,230,797 and 4,238,565)); enzyme inhibitors (see U.S. Pat. No. 4,134,792); fluorescers (see Clin. Chem. 25:353 (1979)); chromophores; luminescers (such as chemiluminescers and bioluminescers (see Clin. Chem. 25:512 (1979))); specificallybindable ligands; proximal interacting pairs; and radioisotopes. Such labels and labeling pairs are detected on the basis of their own physical properties (e.g., fluorescers, chromophores and radioisotopes) or their reactive or binding properties (e.g.,enzymes, substrates, coenzymes and inhibitors). For example, a cofactor-labeled probe can be detected by adding the enzyme for which the label is a cofactor and a substrate for the enzyme. For example, one can use an enzyme which acts upon a substrateto generate a product with a measurable physical property. Examples of the latter include, but are not limited to, beta-galactosidase, alkaline phosphatase and peroxidase.

As is generally known to those of ordinary skill, hybridization of the probe to the DNA sequences of the library may be accomplished under a variety of conditions of stringency so as to permit either a stable hybrid to form only between two genesequences which have very similar sequences (high stringency) or to permit such a hybrid to form between two gene sequences having more divergent sequences (low stringency). Conditions of high stringency employ high temperatures (such as50.degree.-65.degree. C.) and high concentrations of agents such as formamide (for example 50% formamide). Conditions of low stringency employ lower temperatures (approximately 42.degree. C.) and lower concentrations of agents such as formamide (forexample 20-40% formamide) ((Lawler, M. et al., Bone Marrow Transpl. 3:473 (1988); Bhattacharya, S. et al., Ind. J. Med. Res. 87:144 (1988); Arif, B. M. et al., Virus Res. 2:85 (1985); Smith, G. E. et al , Virol. 123:393 (1982); Priestly, J. V. etal., Histochem. 89:467 (1988); Rohrmann, G. F. et al., J. Gen. Virol. 62:137 (1982). When employing hybridization conditions of 42.degree. C. and 20% formamide, two gene sequences having approximately 10% homology can form a stable hybrid (Rohrmann,G. F. et al., J. Gen. Virol. 62:137 (1982)).

Once members of the library have been identified which are capable of hybridizing to the probe, it shall be necessary to determine whether they encode the thyroid hormone receptor molecule PSTHR (or a fragment thereof). Such characterization maybe conveniently performed in any of several ways. Preferably, the gene sequence can be introduced into a suitable host cell, expressed, and the expressed receptor tested for its ability to bind to thyroid hormone. A gene sequence which expresses areceptor that is capable of binding to thyroid hormone, encodes a thyroid hormone receptor. Alternatively, the expressed molecule can be tested for its ability to bind to antibod (prepared as described below) that is reactive with the thyroid hormonereceptor.

In the event that the expressed molecule is unable to bind to thyroid hormone, it may be concluded that the isolated sequence encodes only a fragment of the desired gene sequence. Accordingly, the isolated gene sequence is used to identify andisolate any missing fragments of the desired gene sequence (Bender, W. et al., J. Supramolec. Struc. 10(suppl):32 (1979); Chinault, A. C., et al., Gene 5:111 (1979); Clarke, L. et al., Nature 287:504 (1980)). Once any such sequences have beenidentified and isolated, it is possible to construct a single gene sequence which is capable of encoding the entire desired receptor molecule using well known methods of recombinant DNA technology.

Amino acid sequence variants of PSTHR can also be prepared by mutations in the DNA. Such variants include, for example, deletions from, or insertions or substitutions of, residues within the amino acid sequence shown in Table II. Anycombination of deletion, insertion, and substitution may also be made to arrive at the final construct, provided that the final construct possesses the desired activity. Obviously, the mutations that will be made in the DNA encoding the variant must notplace the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure (see EP Patent Application Publication No. 75,444).

At the genetic level, these variants ordinarily are prepared by site-directed mutagenesis of nucleotides in the DNA encoding the hormone receptor molecule, thereby producing DNA encoding the variant, and thereafter expressing the DNA inrecombinant cell culture. The variants typically exhibit the same qualitative biological activity as the naturally occurring analog.

While the site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined. For example, to optimize the performance of a mutation at a given site, random mutagenesis may be conducted at thetarget codon or region and the expressed PSTHR variants screened for the optimal combination of desired activity. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example,site-specific mutagenesis.

Preparation of an PSTHR variant in accordance herewith is preferably achieved by site-specific mutagenesis of DNA that encodes an earlier prepared variant or a nonvariant version of the protein. Site-specific mutagenesis allows the production ofhormone receptor molecule variants through the use of specific oligonucleotide sequences that encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size andsequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 20 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence beingaltered. In general, the technique of site-specific mutagenesis is well known in the art, as exemplified by publications such as Adelman et al., DNA 2:183 (1983), the disclosure of which is incorporated herein by reference.

As will be appreciated, the site-specific mutagenesis technique typically employs a phage vector that exists in both single-stranded and double-stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the M13phage, for example, as disclosed by Messing et al., Third Cleveland Symposium on Macromolecules and Recombinant DNA, Editor A. Walton, Elsevier, Amsterdam (1981), the disclosure of which is incorporated herein by reference. These phage are readilycommercially available and their use is generally well known to those skilled in the art. Alternatively, plasmid vectors that contain a single-stranded phage origin of replication (Veira et al., Meth. Enzymol. 153:3 (1987)) may be employed to obtainsingle-stranded DNA.

In general, site-directed mutagenesis in accordance herewith is performed by first obtaining a single-stranded vector that includes within its sequence a DNA sequence that encodes the relevant protein. An oligonucleotide primer bearing thedesired mutated sequence is prepared, generally synthetically, for example, by the method of Crea et al., Proc. Natl. Acad. Sci. (U.S.A.) 75:5765 (1978). This primer is then annealed with the single-stranded protein-sequence-containing vector, andsubjected to DNA-polymerizing enzymes such as E. coli polymerase I Klenow fragment, to complete the synthesis of the mutation-bearing strand. Thus, a mutated sequence and the second strand bears the desired mutation. This heteroduplex vector is thenused to transform appropriate cells such as JM101 cells and clones are selected that include recombinant vectors bearing the mutated sequence arrangement.

After such a clone is selected, the mutated protein region may be removed and placed in an appropriate vector for protein production, generally an expression vector of the type that may be employed for transformation of an appropriate host.

Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably 1 to 10 residues, and typically are contiguous.

Amino acid sequence insertions include amino and/or carboxyl-terminal fusions of from one residue to polypeptides of essentially unrestricted length, as well as intrasequence insertions of single or multiple amino acid residues. Intrasequenceinsertions (i.e., insertions within the complete hormone receptor molecule sequence) may range generally from about 1 to 10 residues, more preferably 1 to 5 residues. An example of a terminal insertion includes a fusion of a signal sequence, whetherheterologous or homologous to the host cell, to the N-terminus of the hormone receptor molecule to facilitate the secretion of mature hormone receptor molecule from recombinant hosts.

The third group of variants are those in which at least one amino acid residue in the hormone receptor molecule, and preferably, only one, has been removed and a different residue inserted in its place.

Most deletions and insertions, and substitutions in particular, are not expected to produce radical changes in the characteristics of the thyroid hormone receptor molecule. However, when it is difficult to predict the exact effect of thesubstitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. For example, a variant typically is made by site-specific mutagenesis of the nativehormone receptor molecule-encoding nucleic acid, expression of the variant nucleic acid in recombinant cell culture, and, optionally, purification from the cell culture, for example, by immunoaffinity adsorption on a polyclonal anti-hormone receptormolecule column (to adsorb the variant by binding it to at least one remaining immune epitope).

The activity of the cell lysate or purified hormone receptor molecule variant is then screened in a suitable screening assay for the desired characteristic. For example, a change in the immunological character of the hormone receptor molecule,such as affinity for a given antibody, is measured by a competitive type immunoassay. Changes in immunomodulation activity are measured by the appropriate assay. Modifications of such protein properties as redox or thermal stabi I i ty, hydrophobicity,susceptibility to proteolytic degradation or the tendency to aggregate with carriers or into multimers are assayed by methods well known to the ordinarily skilled artisan.

As used herein, the term "hormone receptor" includes the PSTHR receptor molecule. The term "hormone receptors" additionally includes the functional derivatives of such molecules. The term "hormone receptors" additionally includes bothglycosylated and unglycosylated forms of any of the above-described molecules.

As used herein, a "functional derivative" of PSTHR is a compound which possesses a biological activity (either functional or structural) that is substantially similar to the biological activity of PSTHR. The term "functional derivatives" isintended to include the "fragments," "variants," "analogs, to or "chemical derivatives" of PSTHR. The term "fragment" is meant to refer to any polypeptide subset of PSTHR. The term "variant" is meant to refer to a molecule substantially similar instructure and function to either the entire PSTHR molecule, or to a fragment thereof. A molecule is said to be "substantially similar" to PSTHR if both molecules have substantially similar structures or if both molecules possess a similar biologicalactivity. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein even if the structure of one of the molecules is not found in the other, or if the sequence of amino acid residues is notidentical.

The term "analog" is meant to refer to a molecule substantially similar in function to either the entire PSTHR molecule or to a fragment thereof.

As used herein, a molecule is said to be a "chemical derivative" of another molecule when it contains additional chemical moieties not normally a part of the molecule. Such moieties may improve the molecule's solubility, absorption, biologicalhalf life, etc. The moieties may alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, etc. Moieties capable of mediating such effects are disclosed in Remington's Pharmaceutical Sciences(1980), the disclosure of which is incorporated herein by reference.

"Toxin-derivatized" molecules constitute a special class of "chemical derivatives." A "toxin-derivatized" molecule is a molecule which contains a toxin moiety. The binding of such a molecule to a cell brings the toxin moiety into close proximitywith the cell and thereby promotes cell death. Any suitable toxin moiety may be employed; however, it is preferable to employ toxins such as, for example, the ricin toxin, the diphtheria toxin, radioisotopic toxins, membrane-channel-forming toxins, etc.Procedures for coupling such moieties to a molecule are well known in the art.

The invention is further directed to methods for screening for hormone agonists or antagonists which bind to the receptor molecule, and to the functional derivatives of such agonists and antagonists. The agonists and antagonists of the presentinvention may be peptides, proteins, or may be non-proteinaceous organic molecules. All of the above-cited molecules comprise the molecules of the present invention.

As used herein, a "hormone agonist" is a molecule which is capable of binding to a hormone receptor and whose binding to such receptor either (1) mimics the ability of any other molecule to bind to the receptor and to thereby mediate aphysiologically significant (i.e. detectable) effect or (2) increases the ability of any other molecule to bind to the receptor and to thereby mediate a physiologically significant effect. An example of a hormone agonist is an organic molecule, or aprotein other than LH, which exhibits luteinizing hormone activity.

As used herein, a "hormone antagonist" is a molecule which is capable of binding to a hormone receptor and whose binding to such receptor prevents or attenuates the ability of any other molecule to bind to the receptor and to thereby mediate aphysiologically significant (i.e. detectable) effect.

Mammalian tissues contain at least three receptors for thyroid hormones, and these receptor proteins are encoded by DNA molecules with related nucleotide sequences. In the rat, virtually all tissues express mRNAs that are related to the c-erbAprotooncogene which encodes a nuclear protein that functions as a receptor for thyroid hormone. The rat erbA.alpha.-1 mRNA is most abundant in skeletal muscle and brown fat, whereas rat erbA.alpha.-2 mRNA is most highly expressed in brain andhypothalamus. Rat erbA.beta.-1 mRNA is highly expressed in kidney and liver.

The receptors described above are located in end-target tissues for thyroid hormones, and the effect of thyroid hormone on these tissues in mediated through binding to the receptors. The circulating levels of thyroid hormones in turn areregulated by the pituitary gland, which produces thyroid stimulating hormone in response to a lowered circulating level of thyroid hormone. Thus, thyroid hormone binding in the pituitary will ultimately affect the level of circulating thyroid hormoneavailable to all target tissues.

The novel thyroid hormone receptor described in this application is the product of a unique mRNA found in the anterior pituitary gland. The receptor, designated PSTHR, has no similarity to r-erbA.beta.-1 or either of the r-erbA.alpha. proteinsat its amino terminus, but is identical to r-erbA.beta.-1 from amino acid 147 to the carboxyl end, including the putative DNA- and ligand-binding regions.

Despite the amino acid similarities, r-erbA.beta.-1 and r-erbA.beta.-2 mRNAs are differentially regulated by T.sub.3 in a pituitary tumor-derived cell line, GH.sub.3 cells. In addition, the r-erbA.beta.-2 mRNA is detected only in the anteriorpituitary gland, whereas r-erbA.beta.-1 mRNA is expressed in kidney and liver.

II. Expression of PSTHR Molecules

DNA or CDNA molecules which encode PSTHR can be operably linked to an expression vector and introduced into a host cell to enable the expression of the receptor molecule by that cell. Two DNA sequences (such as a promoter region sequence and adesired receptor molecule encoding sequence) are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoterregion sequence to direct the transcription of the desired receptor molecule encoding gene sequence, or (3) interfere with the ability of the desired receptor molecule gene sequence to be transcribed by the promoter region sequence.

A DNA sequence encoding a hormone receptor molecule may be recombined with vector DNA in accordance with conventional techniques, including blunt-ended or stagger-ended termini for ligation, restriction receptor molecule digestion to provideappropriate termini, filling in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and ligation with appropriate ligases.

The present invention encompasses the expression of PSTHR in either prokaryotic or eukaryotic cells. Preferred eukaryotic hosts include yeast (especially Saccharomyces), fungi (especially Aspergillus), or mammalian cells (such as, for example,human or primate cells).

Yeast and mammalian cells are preferred hosts of the present invention. The use of such hosts provides substantial advantages in that they can also carry out post-translational peptide modifications including glycosylation. A number ofrecombinant DNA strategies exist which utilize strong promoter sequences and high copy number of plasmids which can be utilized for production of the desired proteins in these hosts.

Yeast recognize leader sequences on cloned mammalian gene products and secrete peptides bearing leader sequences (i.e., prepeptides). Mammalian cells provide post-translational modifications to protein molecules including correct folding orglycosylation at correct sites.

Mammalian cells which may be useful as hosts include cells of fibroblast origin such as VERO or CHO-KL, and their derivatives. For a mammalian host, several possible vector systems are available for the expression of the desired receptormolecule. A wide variety of transcriptional and translational regulatory sequences may be employed, depending upon the nature of the host. The transcriptional and translational regulatory signals may be derived from viral sources, such as adenovirus,bovine papilloma virus, simian virus, or the like, where the regulatory signals are associated with a particular gene which has a high level of expression. Alternatively, promoters from mammalian expression products, such as actin, collagen, myosin,etc., may be employed. Transcriptional initiation regulatory signals may be selected which allow for repression or activation, so that expression of the genes can be modulated. Of interest are regulatory signals which are temperature-sensitive so thatby varying the temperature, expression can be repressed or initiated, or are subject to chemical regulation, e.g., metabolite.

The expression of PSTHR in eukaryotic hosts requires the use of eukaryotic regulatory regions. Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis. Preferred eukaryotic promoters includethe promoter of the mouse metallothionein I gene (Hamer, D., et al., J. Mol. Appl. Gen. 1:273-288 (1982)); the TK promoter of Herpes virus (McKnight, S., Cell 31:355-365 (1982)); the SV40 early promoter (Benoist, C., et al., Nature (London) 290:304-310(1981)); the yeast gAl4 gene promoter (Johnston, S. A., et al., Proc. Natl. Acad. Sci. (U.S.A.) 79:6971-6975 (1982); Silver, P. A., et al., Proc. Natl. Acad. Sci. U.S.A. 81:5951-5955 (1984)).

As is widely known, translation of eukaryotic mRNA is initiated at the codon which encodes the first methionine. For this reason, it is preferable to ensure that the linkage between a eukaryotic promoter and a DNA sequence which encodes thedesired receptor molecule does not contain any intervening codons which are capable of encoding a methionine (i.e., AUG). The presence of such codons results either in the formation of a fusion protein (if the AUG codon is in the same reading frame asthe desired receptor molecule encoding DNA sequence) or a frame-shift mutation (if the AUG codon is not in the same reading frame as the desired receptor molecule encoding sequence).

The expression of PSTHR can also be accomplished in procaryotic cells. Preferred prokaryotic hosts include bacteria such as E. coli, Bacillus, Streptomyces, PseudoNonas, Salmonella, Serratia, etc. The most preferred prokaryotic host is E. coli. Bacterial hosts of particular interest include E. coli K12 strain 294 (ATCC 31446), E. coli X1776 (ATCC 31537), E. coli W3110 (F.sup.-, lambda.sup.-, prototrophic (ATCC 27325)), and other enterobacteria (such as Salmonella typhimurium or Serratiamarcescens), and various Pseudomonas species. The prokaryotic host must be compatible with the replicon and control sequences in the expression plasmid.

To express PSTHR in a prokaryotic cell (such as, for example, E. coli, B. subtilis, Pseudomonas, Streptomyces, etc.), it is necessary to operably link the PSTHR encoding sequence to a functional prokaryotic promoter. Such promoters may be eitherconstitutive or, more preferably, regulatable (i.e., inducible or derepressible). Examples of constitutive promoters include the int promoter of bacteriophage .lambda., and the bla promoter of the .beta.-lactamase gene of pBR322, etc. Examples ofinducible prokaryotic promoters include the major right and left promoters of bacteriophage .lambda. (P.sub.L and P.sub.R), the trp, recA, lacZ, lacI, gal, and tac promoters of E. coli, the .alpha.-amylase (Ulmanen, I., et al., J. Bacterial. 162:176-182 (1985)), the .sigma.-28-specific promoters of B. subtilis (Gilman, M. Z., et al., Gene 32:11-20 (1984)), the promoters of the bacteriophages of Bacillus (Gryczan, T. J., In: The Molecular Biology of the Bacilli, Academic Press, Inc., N.Y. (1982)), and Streptomyces promoters (Ward, J. M., et al., Mol. Gen. Genet. 203:468-478 (1986)). Prokaryotic promoters are reviewed by Glick, B. R., (J. Ind. Microbial. 1:277-282 (1987)); Cenatiempo, Y. (Biochimie 68:505-516 (1986)); and Gottesman,S. (Ann. Rev. Genet. 18:415-442 (1984)).

Proper expression in a prokaryotic cell also requires the presence of a ribosome binding site upstream from the gene-encoding sequence. Such ribosome binding sites are disclosed, for example, by Gold, L., et al. (Ann. Rev. Microbial. 35:365-404 (1981)).

The PSTHR encoding sequence and an operably linked promoter may be introduced into a recipient prokaryotic or eukaryotic cell either as a non-replicating DNA (or RNA) molecule, which may either be a linear molecule or, more preferably, a closedcovalent circular molecule. Since such molecules are incapable of autonomous replication, the expression of the desired receptor molecule may occur through the transient expression of the introduced sequence. Alternatively, permanent expression mayoccur through the integration of the introduced sequence into the host chromosome.

In one embodiment, a vector is employed which is capable of integrating the desired gene sequences into the host cell chromosome. Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducingone or more markers which allow for selection of host cells which contain the expression vector. The marker may complement an auxotrophy in the host (such as leu2, or ura3, which are common yeast auxotrophic markers), biocide resistance, e.g.,antibiotics, or heavy metals, such as copper, or the like. The selectable marker gene can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection.

In a preferred embodiment, the introduced sequence will be incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host. Any of a wide variety of vectors may be employed for this purpose. Factors ofimportance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of thevector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species.

Any of a series of yeast gene expression systems can be utilized. Examples of such expression vectors include the yeast 2-micron circle, the expression plasmids YEP13, YCP and YRP, etc., or their derivatives. Such plasmids are well known in theart (Botstein, D., et al., Miami Wntr. Symp. 19:265-274 (1982); Broach, J. R., In: The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., p. 445-470 (1981); Broach, J. R.,Cell 28:203-204 (1982)).

For a mammalian host, several possible vector systems are available for expression. One class of vectors utilize DNA elements which provide autonomously replicating extra-chromosomal plasmids, derived from animal viruses such as bovine papillomavirus, polyoma virus, adenovirus, or SV40 virus. A second class of vectors relies upon the integration of the desired gene sequences into the host chromosome. Cells which have stably integrated the introduced DNA into their chromosomes may be selectedby also introducing one or more markers which allow selection of host cells which contain the expression vector. The marker may provide for prototropy to an auxotrophic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper or thelike. The selectable marker gene can either be directly linked to the DNA sequences to be expressed, or introduced into the same cell by co-transformation. Additional elements may also be needed for optimal synthesis of mRNA. These elements mayinclude splice signals, as well as transcription promoters, enhancers, and termination signals. The CDNA expression vectors incorporating such elements include those described by Okayama, H., Mol. Cell. Biol. 3:280 (1983), and others.

Preferred prokaryotic vectors include plasmids such as those capable of replication in E. coli such as, for example, pBR322, ColE1, pSC101, pACYC 184, .pi.VX. Such plasmids are, for example, disclosed by Maniatis, T., et al. (In: MolecularCloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1982)). Bacillus plasmids include pC194, pC221, pT127, etc. Such plasmids are disclosed by Gryczan, T. (In: The Molecular Biology of the Bacilli, Academic Press, N.Y. (1982), pp. 307-329). Suitable Streptomyces plasmids include pIJ101 (Kendall, K. J., et al., J. Bacterial. 169:4177-4183 (1987)), and Streptomyces bacteriophages such as .phi.C31 (Chater, K. F., et al., In: Sixth International Symposium onActinomycetales Biology, Akademiai Kaido, Budapest, Hungary (1986), pp. 45-54). Pseudomonas plasmids are reviewed by John, J. F., et al. (Rev. Infect. Dis. 8:693-704 (1986)), and Izaki, K. (Jpn. J. Bacterial. 33:729-742 (1978)).

Once the vector or DNA sequence containing the constructs has been prepared for expression, the DNA constructs may be introduced into an appropriate host. Various techniques may be employed, such as protoplast fusion, calcium phosphateprecipitation, electroporation or other conventional techniques. After the fusion, the cells are grown in media and screened for appropriate activities. Expression of the sequence results in the production of the hormone receptor molecule.

The hormone receptor molecules of the invention may be isolated and purified from the above-described recombinant molecules in accordance with conventional methods, such as extraction, precipitation, chromatography, affinity chromatography,electroCON@phoresis, or the like.

III. The Purification of Thyroid Hormone Receptor PSTHR

The thyroid hormone receptor of the present invention, PSTHR, may be purified by routine adaptation of any of a variety of methods. It is preferable to use the method of Rosemblit, N. et al. (Endocrinol. 123:2284-2289 (1988)) which reference isincorporated herein by reference. In accordance with this method, the receptor is isolated by a combination of affinity chromatography, lectin binding and SDS-polyacrylamide gel electrophoresis.

To facilitate recovery, an enriched cellular source of receptor is employed. The preferred source of the thyroid hormone receptor of the invention is the rat pituitary gland, most preferably the anterior pituitary.

To obtain tissue samples, animals are sacrificed, or the desired tissue obtained by surgery. After removal of the receptor-containing tissue from the animal, the tissue is preferably placed in a buffer containing 150 mM NaCl, 20 mM Hepes, pH 7.4("Buffer A"). Tissue is preferably maintained at 40.degree. C. Because the proteins may be extremely sensitive to proteolysis, the buffer employed is preferably adjusted to contain 5 mM N-ethylmaleimide, 10 mM phenylmethylsulfonylfluoride, and 10 mMEDTA to inhibit proteolysis (Kellokumpu, S. et al., Endocrinol. 116:707 (1985), which reference is incorporated herein by reference).

Tissue samples are dispersed in 10 volumes of Buffer A using a tissue disrupter and then homogenized (preferably using a motor-driven Teflon pestle). Dispersed cellular preparations are centrifuged (for example at 20,000.times.g for 30 minutes)and resuspended in 5 volumes of Buffer A supplemented to contain 20% glycerol ("Buffer B") and 1% NP-40 (which agents may stabilize the binding activity of the receptors). The preparations are then subjected to high speed centrifugation (100,000.times.gfor 1 hour). The receptor is found in the supernatant of such centrifugation, and can be stored at -700.degree. C.

In a preferred embodiment, the PSTHR molecule may be further purified by affinity chromatography using purified hormone as a ligand. Preparations of highly purified hormone can be obtained commercially. Hormone from such a preparation may becoupled to a (preferably) immobilized resin such as Affi-Gel 10 (Bio-Rad, Richmond Calif.) or the like, by means well known in the art.

The resin is equilibrated in the above-described buffer (preferably supplemented to contain 0.5% NP-40 and 20% glycerol), and the preparation of receptor molecule is placed in contact with it. After sequentially washing the resin with suitablebuffers (Buffer B containing 0.5% NP-40; Buffer B containing 0.5M NaCl and 0.1% NP-40; Buffer B containing 0.1% deoxycholate; Buffer B containing 0.1% NP-40; and a solution of 0.1% NP-40, 20% glycerol, and 50 mM glycine, pH 3), receptor molecule iseluted using preferably a buffer of 50 mM glycine, pH 3, 0.1% NP-40, 20% glycerol, and 100 mM NaCl.

In order to assay the eluted material for receptor molecule, an aliquot of sample is incubated in the presence of an excess of labeled thyroid hormone. A preferred method for assaying receptor is described by Roche, P. C. et al., Endocrinol. 117:790 (1985), which reference is incorporated herein by reference. After assay, filtration is preferably performed, for example, using the method of Buettner, K. et al., J. Biol. Chem. 259:15078 (1984), which reference is incorporated herein byreference. The pH of sample fractions found to contain receptor molecule is preferably neutralized with Tris.

In order to further purify the PSTHR receptor molecule, wheat germ agglutinin purification of PSTHR may be performed. This may conveniently be accomplished by incubating pooled, receptor-containing, affinity purified fractions in the presence ofwheat-germ agglutinin-agarose (Vector Laboratories, Burlington, Calif.). After permitting adsorption to occur, the gel may be washed to remove impurities. Receptor may then be eluted from the gel (using, for example, 0.32M N-acetylglucosamine in BufferB containing 0.1% NP-40, or other buffer) and assayed in the manner described above.

Further purification of PSTHR may be achieved through the use of either analytical or preparative gel electrophoresis. Any suitable method of electrophoresis may be employed such as those of Kim, I.-C. et al. (J. Biol. Chem. 262:470 (1987)which reference is incorporated herein by reference), or Laemmli, U.K. (Nature 227:680 (1970)). Visualization of the electrophoresed material may be accomplished by silver stain (Wray, W. et al., Anal. Biochem. 118:197 (1981 or other means. Forpreparative gel electrophoresis, the material is preferably concentrated in the manner disclosed by Holloway, P. W. (Anal. Biochem. 53:304 (1973), which reference is incorporated herein by reference) before electrophoresis.

The PSTHR receptor may be further purified by filtration/concentration using, for example, Centricon filter concentrators. The sample may then be further purified by acetone precipitation, followed by gel electrophoresis. The bands obtainedfrom such electrophoresis may be electroeluted, and used to determine the amino acid sequence of the amino ternimus of the protein.

Alternatively, the electroeluted receptor protein may be further precipitated using methanol/chloroform, and digested with an endopeptidase in order to obtain a set of peptide fragments. These fragments can then be sequenced in order toelucidate their amino acid sequence.

Alternatively, the electroeluted receptor molecules may be reprecipitated with acetone, resuspended in buffer (such as Tris, pH 8.5), and cleaved with formic acid/CNBr. The cleavage products can be lyophilized, resolved on a tricine gel, andsequenced.

The identification of a preparation which contains a substantially purified PSTHR permits the amino acid sequence of the receptor molecule to be determined, and further permits the molecule to be produced through the application of recombinantDNA techniques.

Thus, the present invention includes not only substantially purified PSTHR molecules, and methods for use, but also includes the amino acid sequences of these receptor molecules, the genetic sequences coding for these receptor molecules, vehiclescontaining such genetic sequences, hosts transformed therewith, and hormone receptor molecules produced through transformed host expression.

In order to obtain the amino acid sequence of the PSTHR, the molecules in the substantially purified fractions are recovered by any suitable method. Most preferably, such recovery is accomplished by lectin and hormone affinity chromatography asgenerally described by N. Rosemblit et al. (Endocrinology 123:2284 (1988)), followed by concentration of sample using Centricon-30 (Amicon), and resolution by gel electrophoresis. The recovered molecules may then be sequenced, preferably using anautomated sequenator, and the amino acid sequence of the molecule thereby determined. Although any suitable means can be used to determine the sequence of the hormone receptor molecules, it is preferable to determine the sequence using themicrosequencing methods of Rodriguez (J. Chromatog. 350:217 (1985)). Alternatively, the hormone receptor molecule may be purified by electrophoresis and, after electroelution, cleaved by cyanogen bromide or lysyl-C endopeptidase. The fragments maythen be resolved, preferably by HPLC or by tricine gels (H. Shagger et al., Anal. Biochem. 166:368 (1987)) followed by electroblotting and gas-phase microsequencing. The sequence of the complete molecule can then be determined and compared with thatdeduced from the CDNA sequence of PSTHR.

IV. Uses for the Thyroid Hormone Receptor PSTHR

A. Purification of Thyroid Hormone

The PSTHR molecule of the present invention can be used for a variety of biochemical, diagnostic, and therapeutic purposes. A major use of the purified receptor molecule of the invention is in the production and purification of hormone. Thecapacity of the receptor molecule of the present invention to bind to hormone permits their use in the affinity purification of the hormone.

Thus, for example, the thyroid hormone receptor may be employed to assist in the purification of novel thyroid hormone forms.

B. Anti-Receptor Antibody

The PSTHR molecules of the present invention may be used to induce the formation of anti-hormone receptor antibodies. Such antibodies may either be polyclonal or monoclonal antibodies, or antigen binding fragments of such antibodies (such as,for example, F(ab) or F(ab).sub.2 fragments). Of particular significance to the invention are antibodies (and antigen binding fragments of antibodies) which bind to the extracellular domain of a hormone receptor molecule. The most preferredanti-hormone receptor antibodies (and antigen binding fragments thereof) are those which are capable of preventing or inhibiting the binding of the hormone to its hormone receptor.

Suitable polyclonal antibodies can be obtained by immunizing an animal with an immunogenic amount of the receptor molecule (preferably with an adjuvant, such as Freund's adjuvant).

Alternatively, monoclonal antibodies may be prepared, such as by immunizing splenocytes with a particular receptor and then fusing an immunized cell with a myeloma cell (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., In: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-681 (1981)) in order to obtain a hybridoma cell that secretes an anti-receptor monoclonal antibody.

Of special interest to the present invention are antibodies which are produced in humans, or are "humanized" (i.e. non-immunogenic in a human) by recombinant or other technology such that II they will not be antigenic in humans, or will bemaintained in the circulating serum of a recipient for a longer period of time.

Humanized antibodies may be produced, for example by replacing an immunogenic portion of an antibody with a corresponding, but non-immunogenic portion (i.e. chimeric antibodies) (Robinson, R. R. et al., International Patent PublicationPCT/US86/02269; Akira, K. et al., European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison, S. L. et al., European Patent Application 173,494; Neuberger, M. S. et al., PCT Application WO 86/01533; Cabilly, S. etal., European Patent Application 125,023; Better, M. et al., Science 240:1041-1043 (1988); Liu, A. Y. et al., Proc. Natl. Acad. Sci. U.S.A. 84:3439-3443 (1987); Liu, A. Y. et al., J. Imunol. 139:3521-3526 (1987); Sun, L. K. et al., Proc. Natl. Acad. Sci. U.S.A. 84:214-218 (1987); Nishimura, Y. et al., Canc. Res. 47:999-1005 (1987); Wood, C. R. et al., Nature 314:446-449 (1985)); Shaw et al., J. Natl.Cancer Inst. 80:1553-1559 (1988). General reviews of "humanized" chimeric antibodies areprovided by Morrison, S. L. (Science, 229:1202-1207 (1985)) and by Oi, V.T. et al., BioTechnigues 4:214 (1986)).

Suitable "humanized" antibodies can be alternatively produced ad described by Jones, P. T. et al., Nature 321:552-525 (1986); Verhoeyan et al., Science 239:1534 (1988), and Beidler, C. B. et al., J. Immunol. 141:4053-4060 (1988), or by themethods disclosed in U.S. Pat. Nos. 4,816,397 and 4,816,567, which references are incorporated herein by reference.

C. Diagnostic Uses

In addition to their use in the purification of hormone, the PSTHR molecules of the present invention may be used as the basis for assays of hormone activity. Importantly, since such an assay measures a physiologically significant binding event(i.e. that of a hormone to its receptor and undergoing a detectable change (such as phosphorylation, cleavage, chemical modification, etc.)) it is likely to be both more sensitive and more accurate than immunoassays (which detect the physiologicallynon-significant binding of hormone to anti-hormone antibody). Moreover, the thyroid hormone receptor molecules are capable of distinguishing their respective hormones from other hormones with greater specificity than antibodies (which may cross reactwith structurally similar molecules).

Although more sensitive and accurate than antibodies, the receptor molecules of the invention can be used to assay hormone levels in a sample in the same ways in which antibodies are used.

The anti-receptor antibodies of the present invention may also be used for diagnostic purposes such as to measure the expression and function of a patient's hormone receptors. The anti-receptor antibodies can also be used in imaging in order tocharacterize tissue, or to define the presence and site of metastasized receptor-expressing cells.

For diagnostic purposes, the receptors and anti-receptor antibodies can be used in accordance with immunoassay technology. Examples of immunoassays are described by Wide at pages 199-206 of Radioimmune Assay Method, edited by Kirkham and Hunter,E. and S. Livingstone, Edinburgh, 1970.

Thus, in one embodiment, receptor molecules can be detectably labeled and incubated with a sample, and the amount of receptor molecule bound to the sample can be ascertained. In a second embodiment, antibody to the receptor, or to the hormone,can be used in order to create a "pseudo-sandwich immunoassay." In one such assay (a "forward" assay), a sample suspected of containing hormone can be incubated in the presence of an immobilized anti-hormone antibody. Solubilized, detectably labeled,hormone receptor molecules can be added to the reaction mixture, and the amount of hormone determined by measuring the amount of bound receptor.

As will be evident to those of ordinary skill, various alternative assays can also be devised. The assay may be a simple "yes/no" assay to determine whether hormone is present or may be made quantitative by comparing the measure of labeledmolecule with that obtained for a standard sample containing known quantities of hormone.

In another type of assay, which may also be useful with the antigens of the present invention, "simultaneous" and "reverse" assays are used. A simultaneous assay involves a single incubation step as the antibody (or receptor) bound to the solidsupport and labeled receptor (or antibody) are both added to the sample being tested at the same time. After the incubation is completed, the solid support is washed to remove the residue of fluid sample and uncomplexed labeled antibody. The presenceof labeled molecules associated with the solid support is then determined as it would be in a conventional sandwich assay.

In the "reverse" assay, stepwise addition first of a solution of labeled molecule (either receptor or antibody) to the fluid sample followed by the addition of unlabeled molecule (either antibody or receptor) bound to a solid support after asuitable incubation period is utilized. After a second incubation, the solid phase is washed in conventional fashion to free it of the residue of the sample being tested and the solution of unreacted labeled antibody. The determination of labeledantibody associated with a solid support is then determined as in the simultaneous and forward assays.

As explained above, the hormone assays of the present invention require that at least one molecule be labeled with a "reporter molecule." Examples of types of labels which can be used in the present invention include, but are not limited to,enzyme labels, radioisotopic labels, non-radioactive isotopic labels, fluorescent labels, toxin labels, and chemiluminescent labels.

Examples of suitable enzyme labels include malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast-alcohol dehydrogenase, alpha-glycerol phosphate dehydrogenase, triose phosphate isomerase, peroxidase, alkalinephosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, acetylcholine esterase, etc.

Suitable radioisotopic labels are well known in the art.

Examples of suitable non-radioactive isotopic labels include 157.sub.Gd, 55.sub.Mn, 162.sub.Dy, 52.sub.Tr, 56Fe, etc.

Examples of suitable fluorescent labels include an .sup.152 Eu label, a fluorescein label, an isothiocyanate label, a rhodamine label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an o-phthaldehyde label, a fluorescaminelabel, etc.

Examples of suitable toxin labels include diphtheria toxin, ricin, and cholera toxin. Examples of chemiluminescent labels include a luminal label, an isoluminal label, an aromatic acridinium ester label, an imidazole label, an acridinium saltlabel, an oxalate ester label, a luciferin label, a luciferase label, an aequorin label, etc.

Those of ordinary skill in the art will know of other suitable labels which may be employed in accordance with the present invention. The binding of these labels to antibodies or fragments thereof can be accomplished using standard techniquescommonly known to those of ordinary skill in the art. Typical techniques are described by Kennedy, J. H., et al. (Clin. Chim. Acta 70:1-31 (1976)), and Schurs, A. H. W. M., et al. (Clin. Chim. Acta 81:1-40 (1977)). Coupling techniques mentioned inthe latter are the glutaraldehyde method, the periodate method, the dimaleimide method, the m-maleimidobenzyl-N-hydroxy-succinimide ester method, all of which methods are incorporated by reference herein.

In the practice of the present invention, enzyme labels are a preferred embodiment. No single enzyme is ideal for use as a label in every conceivable assay. Instead, one must determine which enzyme is suitable for a particular assay system. Criteria important for the choice of enzymes are turnover number of the pure enzyme (the number of substrate molecules converted to product per enzyme site per unit of time), purity of the enzyme preparation, sensitivity of detection of its product, easeand speed of detection of the enzyme reaction, absence of interfering factors or of enzyme-like activity in the test fluid, stability of the enzyme and its conjugate, availability and cost of the enzyme and its conjugate, and the like. Included amongthe enzymes used as preferred labels in the immunometric assays of the present invention are peroxidase, alkaline phosphatase, beta-galactosidase, urease, glucose oxidase, glycoamylase, mal ate dehydrogenase, and glucose-6-phosphate dehydrogenase. Urease is among the more preferred enzyme labels, particularly because of chromogenic pH indicators which make its activity readily visible to the naked eye.

Quantification of nucleic acid molecules which encode the hormone receptor molecule (or a fragment thereof) can be used to determine the extent and rate of the expression of the hormone receptor in the cells of a patient. To accomplish such anassay, a sample of a patient's cells is treated, via in situ hybridization, or by other suitable means, and analyzed to determine whether the sample contains mRNA molecules capable of hybridizing with the nucleic acid molecule.

D. Identification of PSTHR Antagonists and Agonsits

The availability of the PSTHR receptor permits its use in the screening, identification and characterization of agonists and antagonists of thyroid hormone.

A hormone agonist may either be a molecule which increases the physiological effect caused by a hormone's interaction with its receptor, or a molecule which is capable of itself mediating any physiological effect which results from theinteraction of thyroid hormone and the PSTHR receptor.

To identify agonists which increase the effect of thyroid hormone, one may assay the capacity of a putative agonist for its ability to enhance the capacity of hormone to bind to PSTHR. Agonists which mimic the activity of a hormone can beidentified by their capacity to bind to the receptor molecule, and to mediate a physiologically significant effect which is a characteristic of the interaction of thyroid hormone and PSTHR. Hormone agonists can be used to treat individuals sufferingfrom an inadequate production of hormone, for example, individuals suffering from hypothyroidism.

The availability of PSTHR molecules al so permits the identification of thyroid hormone antagonists. As discussed above, hormone antagonists prevent or attenuate the ability of a hormone to interact with its receptor and thereby mediate aphysiologically significant (i.e. detectable) effect. Thyroid hormone antagonists can be identified by their ability to prevent or attenuate the binding of thyroid hormone to PSTHR molecules. The hormone antagonists can be used to decrease thephysiological response to PSTHR in an individual. Hormone antagonists may, therefore, be used to treat conditions, such as hyperthyroidism, resulting from the overproduction of a particular hormone.

One class of agonists and antagonists of special concern to the present invention are immunoglobulin agonists or antagonists. The anti-receptor antibodies described above may be tested to determine whether their binding to receptor impairs orprevents the ability of the receptor to bind to hormone molecules. Antibodies having such a capability are hormone antagonists, and may be used, in the same manner as the hormone receptor molecule, to treat individuals suffering from the excessiveproduction of hormone.

Similarly, the anti-receptor antibodies described above may be tested to determine whether their binding to a receptor mimics the binding of a hormone to that receptor. Antibodies having such a capability are hormone agonists, and may be used totreat individuals suffering from a deficiency of hormone production.

Immunoglobulin agonists and antagonists of thyroid hormone can be labeled with toxins and used in the treatment of cancer. Thus, for example, a toxin-derivatized agonist or antagonist of thyroid hormone would be able to bind to the thyroidhormone receptor on malignant cells (or any cells which express the receptor), and thereby provide a means for killing such cells.

E. Identification of PSTHR-Specific Ligands

The thyroid hormone receptor of the invention may be used to screen molecules, or ligands, for their ability to bind to PSTHR, but not to other thyroid hormone receptors. Once identified, such ligands would be of use in effecting biochemicalchanges in the anterior pituitary without also causing changes in other tissues having thyroid hormone receptors.

Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention, unlessspecified.

EXAMPLES

Example 1

Cloning of a gene encoding PSTHR

RNA was prepared from GH.sub.3 cells grown in Dulbeccol's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum by the method of Chirgwin et al. (Biochemistry 18:5294-5299 (1980)).

Two rat GH.sub.3 cell CDNA libraries as described in Lazar, M. A. (Molecular Endocrinology 2:893-901 (1988)) and Lazar et al., (Molecular Endocrinology 2:479-484 (1988)) were initially screened with a fragment from the r-erbA.alpha.-2 CDNA cloneand subsequently with a 5' fragment from a non-full-length r-erbA.beta.-2 CDNA clone. Three positive clones corresponding to the r-erbA.beta.-2 mRNA were obtained.

The cDNA inserts were subcloned into the vector Bluescript (Stratagene) and sequenced by the dideoxy method of Sanger et al. (Proc. Nat. Acad. Sci. U.S.A. 74:5463 (1977)). Restriction fragments from two overlapping cDNAs were fused toconstruct a full-length r-erbA.beta.-2 clone.

The sequence of the full-length cDNA for PSTHR is shown in Table I. An in-frame stop codon is underlined. Amino acid designations begin at the first potential initiator methionine. The deduced amino acid sequence is shown in Table II.

EXAMPLE II

Expression of PSTHR molecules

The r-erbA.beta.-2 cDNA insert was subcloned into the vector Bluescript and transcribed into RNA, which was translated in reticulocyte lysates. A protein of approximately 62 kD was produced, in agreement with that predicted from the nucleotidesequence.

The r-ErbA.beta.-2 protein bound T.sub.3 with an affinity constant of 1.1.+-.0.4 nM (mean.+-.SEM), which is similar to that of the endogenous receptor. Competition experiments with thyroid hormone analogs showed that the affinity of ther-ErbA.beta.-2 protein was greatest for 3,5,3'-triiodothyrocetic acid (triac) followed by T.sub.3, T.sub.4, and rT.sub.3, the same as that of the r-ErbA.beta.-1 protein.

TABLE I __________________________________________________________________________ ##STR1## ##STR2## ##STR3## ##STR4## ##STR5## ##STR6## 70 80 90 100 110 120 GATGTACGCT GTCCCAGTAT ATGCACTGCT CCGGGGAGCA GGGGGCTGGC AAGTGCGTGC 130 140150 160 170 180 ATGGAGCGTG TGTGTATATG TAAAGCAGGA CTGCACCTGG ATACCAAAAT GAACTACTGC 190 200 210 220 230 240 GTGCCAGAGG TACACGAAGT GTGCCCAGCT GCCGGCAGCA ACCGTTACAT GCAGGTCACT 250 260 270 280 290 300 GACTACCTCG CGTATCTGGA AGACAGTCCG GCTTACAGTGGCTGCGATGT CCAAGCTGTG 310 320 330 340 350 360 CCCGGTAGCA GCATATATCT GGAACAGGCC TGGACTCTGA ATCAGCCTTA TACCTGTAGT 370 380 390 400 410 420 TACCCTGGAA ACCTGTTTAA AAGCAAGGAC TCTGACTTGG ACATGGCCCT GAGTCAGTAC 430 440 450 460 470 480 AGCCAGCCTGCACATCTCCC CGAAGAAAAG CCTTTTCCTC AAGTGCGGTC GCCTCCGCAC 490 500 510 520 530 540 TCACACAAAA AAGGGTATAT CCCCAGCTAT CTAGACAAGG ATGAGCTCTG CGTAGTGTGC 550 560 570 580 590 600 GGGGACAAAG CCACGGGGTA CCACTATCGC TGCATCACCT GTGAAGGCTG CAAGGGTTTC 610620 630 640 650 660 TTTAGAAGAA CCATTCAGAA AAGTCTCCAT CCATCTTACT CCTGTAAATA TGAAGGGAAG 670 680 690 700 710 720 TGCATCATAG ACAAAGTCAC CCGTAACCAG TGCCAGGAAT GTCGCTTTAA GAAATGCATC 730 740 750 760 770 780 TATGTTGGCA TGGCAACAGA CCTGGTGCTG GATGACAGCA AGAGGCTAGC CAAGAGGAAG 790 800 810 820 830 840 CTGATAGAAG AGAACCGTGA GAAGAGGCGG CGGGAAGAGC TACAGAAATC CATTGGGCAT 850 860 870 880 890 900 AAGCCAGAGC CCACGGATGA GGAATGGGAG CTCATCAAGA CAGTCACCGA GGCCCACGTG 910 920 930 940 950 960 GCCACCAATG CCCAGGGCAG CCACTGGAAG CAGAAGCGGA AATTTCTGCC TGAAGACATT 970 980 990 1000 1010 1020 GGACAAGCAC CCATTGTGAA CGCCCCGGAA GGTGGCAAGG TTGATCTGGA AGCCTTCAGC 1030 1040 1050 1060 1070 1080 CATTTTACAA AAATCATCAC ACCAGCAATC ACCAGAGTGGTGGATTTCGC CAAAAAGTTG 1090 1100 1110 1120 1130 1140 CCCATGTTTT GTGAGCTGCC CTGTGAAGAC CAGATCATCC TCCTCAAAGG CTGCTGCATG 1150 1160 1170 1180 1190 1200 GAGATCATGT CCCTCCGAGC TGCTGTGCGC TATGACCCAG ACAGCGAGAC TCTAACCTTG 1210 1220 1230 1240 12501260 AATGGGGAAA TGGCAGTGAC ACGGGGCCAG CTGAAAAACG GAGGTCTTGG GGTGGTGTCA 1270 1280 1290 1300 1310 1320 GATGCGATCT TTGACCTGGG CATGTCTCTG TCGTCTTTCA ACCTGGATGA CACGGAGGTT 1330 1340 1350 1360 1370 1380 GCCCTGCTTC AAGCCGTCCT GCTGATGTCT TCAGATCGCCCAGGGCTAGC TTGTGTTGAG 1390 1400 1410 1420 1430 1440 AGAATTGAGA AATACCAAGA CAGTTTCCTG TTGGCCTTTG AACACTATAT CAATTACCGG 1450 1460 1470 1480 1490 1500 AAGCACCATG TGACACACTT TTGGCCCAAA CTCCTGATGA AGGTGACGGA CCTGCGGATG 1510 1520 1530 1540 15501560 ATTGGAGCGT GCCACGCCAG CCGCTTCCTG CACATGAAGG TGGAGTGCCC CACCGAGCTC ##STR7## ##STR8## ##STR9## ##STR10## ##STR11## ##STR12## 1630 1640 1650 1660 1670 1680 TCCTGCAGCA CGACTGGGTG TCGCTGCATT CCACCTGTAG CTCTTTCTGT TGTCGTTTCT 1690 1700 17101720 1730 1740 TCGTTTCTTT GTGTCAAGTG AGCTCATCAG TGGGTCAGCG GGTCATCAGT GGCATAGACT 1750 1760 1770 1780 1790 1800 TGGATGAAGT GGTCCTTTGA ATGTGGGTCT TTGTAACCAT TGCGTTTCGT TCTCCAGTCC 1810 1820 1830 1840 1850 1860 TTAGTGTGAC GGCTTTGAGG GGTTCACAGC AGTGCAGGCC GAGTGGGGGC GATCATCTCA 1870 1880 1890 1900 1910 1920 CCAGCACCAC GTCGTCACCA GCTCCCATCT GTCCCTGGGC AGACTCAAGC AAGCCAAATG 1930 1940 1950 1960 1970 1980 GCATTACAGA AGACTAAAGA AGCCTTAAAA CCGAGACGAC AGTCATCTTG ATCCAATGCG 1990 2000 20102020 2030 2040 ATCCAGTTCT GTTGTTTGTA AGGTGAAGCT GGCAGAGCTC AGGCCACCTC AGGTTGGGCG 2050 2060 2070 2080 2090 2100 TGGCTTTTGG CGCGTGAGGG GAGGAGCCGT TCCAGCTTCA GGAACTCACA GCTACTCAGG 2110 2120 2130 2140 2150 2160 AGCTTACCGC TTCCAGCACC CTTACTCTCC AAGCAGGCTG ACTTGGAATG TGCAGGATAC 2170 2180 2190 2200 2210 2220 CCACACCATA ACAAATCGAC GTTACTTTCC ATGGCCTTCT GTAACCTTGT GATTTACTTC 2230 2240 2250 2260 2270 2280 AAGTTGCGCA AGAGTAGAAC TTGGAGACTT GACTGGTTTG AGGCCACAAG GAAAGTCTCC 2290 2300 23102320 2330 2340 TTTTCAGGAT GCCCATAGAG CTTGGAAATC ATCCATGTTA CAGCATAGTT TCCAAAAATG 2350 2360 2370 2380 2390 2400 GTGTTACCTC AAGCAGGAAG GCACCTTTGC AGCTTAGATA GATTCACAAG CCATTCCCAC 2410 2420 2430 2440 2450 AGAGCTCAAA CCTGTTTACA GAGTGCCGTC CCTCTTCCCG GAATTCCCGG GG __________________________________________________________________________

TABLE II __________________________________________________________________________ 10 20 Met Cys Met Asp Val Arg Cys Pro Ser Ile Cys Thr Ala Pro Gly Ser Arg Gly Leu Ala 30 40 Met Ala Cys Met Glu Arg Val Cys Ile Cys Lys Ala Gly Leu His LeuAsp Thr Lys Met 50 60 Asn Tyr Cys Met Peo Glu Val His Glu Gly Cys Pro Ala Ala Gly Ser Asn Arg Tyr Met 70 80 Gln Val Thr Asp Tyr Leu Ala Tyr Leu Glu Asp Ser Pro Ala Tyr Ser Gly Cys Asp Val 90 100 Gln Ala Val Pro Gly Ser Ser Ile Tyr Leu Glu GlnAla Trp Thr Leu Asn Gln Pro Tyr 110 120 Thr Cys Ser Tyr Pro Gly Asn Leu Phe Lys Ser Lys Asp Ser Asp Leu Asp Met Ala Leu 130 140 Ser Gln Tyr Ser Gln Pro Ala His Leu Pro Glu Glu Lys Pro Phe Pro Gln Val Arg Ser 150 160 Pro Pro His Ser His Lys LysGly Tyr Ile Pro Ser Tyr Leu Asp Lys Asp Glu Leu Cys 170 180 Val Val Cys Gly Asp Lys Ala Thr Gly Tyr His Tyr Arg Cys Ile Thr Cys Glu Gly Cys 190 200 Lys Gly Phe Phe Arg Arg Thr Ile Gln Lys Ser Leu His Pro Ser Tyr Ser Cys Lys Tyr 210 220 Glu GlyLys Cys Ile Ile Asp Lys Val Thr Arg Asn Gln Cys Gln Glu Cys Arg Phe Lys 230 240 Lys Cys Ile Tyr Val Gly Met Ala Thr Asp Leu Val Leu Asp Asp Ser Lys Arg Leu Ala 250 260 Lys Arg Lys Leu Ile Glu Glu Asn Arg Glu Lys Arg Arg Arg Glu Glu Leu Gln Lys Ser 270 280 Ile Gly His Lys Pro Glu Pro Thr Asp Glu Glu Trp Glu Leu Ile Lys Thr Val Thr Glu 290 300 Ala His Val Ala Thr Asn Ala Gln Gly Ser His Trp Lys Gln Lys Arg Lys Phe Leu Pro 310 320 Glu Asp Ile Gly Gln Ala Pro Ile Val Asn Ala Pro Glu Gly Gly LysVal Asp Leu Glu 330 340 Ala Phe Ser His Phe Thr Lys Ile Ile Thr Pro Ala Ile Thr Arg Val Val Asp Phe Ala 350 360 Lys Lys Leu Pro Met Phe Cys Glu Leu Pro Cys Glu Asp Gln Ile Ile Leu Leu Lys Gly 370 380 Cys Cys Met Glu Ile Met Ser Leu Arg Ala AlaVal Arg Tyr Asp Pro Asp Ser Glu Thr 390 400 Leu Thr Leu Asn Gly Glu Met Ala Val Thr Arg Gly Gln Leu Lys Asn Gly Gly Leu Gly 410 420 Val Val Ser Asp Ala IIe Phe Asp Leu Gly Met Ser Leu Ser Ser Phe Asn Leu Asp Asp 430 440 Thr Glu Val Ala Leu LeuGln Ala Val Leu Leu Met Ser Ser Asp Arg Pro Gly Leu Ala 450 460 Cys Val Glu Arg Ile Glu Lys Tyr Gln Asp Ser Phe Leu Leu Ala Phe Glu His Tyr Ile 470 480 Asn Tyr Arg Lys His His Val Thr His Phe Trp Pro Lys Leu Leu Met Lys Val Thr Asp 490 500 LeuArg Met Ile Gly Ala Cys His Ala Ser Arg Phe Leu His Met Lys Val Glu Cys Pro 520 Thr Glu Leu Phe Pro Pro Leu Phe Leu Glu Val Phe Glu Asp __________________________________________________________________________

* * * * *

US Patent:  5284999