FIELD OF THE INVENTION
The present invention relates generally to the fields of proteomics, liquid chromatography, mass spectrometry, and the screening of chemical and biological compounds. More specifically, the invention relates to newly developed methods forpredicting in vitro and/or in vivo hepatic toxicity based on screening for levels of specific biomarker polypeptides or polynucleotides. Such methods allow the development of therapeutic compounds having increased efficacy and safety, and can be used toprevent injury caused by the administration of hepatotoxic compounds.
BACKGROUND OF THE INVENTION
Idiosyncratic hepatotoxicity occurs in a particular subgroup of the population for which the pathogenesis is unknown. Such toxicity is not predicted by either pre-clinical animal models or pre-marketing clinical trials. While inherently toxiccompounds are readily identified and removed from the development pipeline, idiosyncratic compounds are put on the market, only to wreak havoc on the larger patient population. The effects of idiosyncratic compounds on the general public include varyingdegrees of hepatic injury, which can lead to liver failure, transplantation, and even death. Idiosyncratic hepatotoxicity arises too frequently in the population (2.7%; In Energy and Commerce, 107th Congress, Second Session ed.; FDA: Washington, D.C.,2002, pp. 1), and is therefore a major cause for concern in the pharmaceutical industry (Meadows, M., 2002, FDA Consumer Magazine 36:1).
Currently, hepatic injury due to medications is one of the most common causes of acute liver disease and jaundice (see, e.g., Hepatotoxicity Clinical Research Network). The mortality rate of hepatic idiosyncratic drug reactions is quite high,and over half of the cases of acute liver failure in the United States are due to medications exhibiting idiosyncratic hepatotoxicity. In fact, the risks of drug induced toxicity are a primary concern of the pharmaceutical industry and accentuate theneed for early and reliable predictors of potential adverse events (Frank and Hargreaves. Nature Reviews/Drug Discovery. 2, 566-580 (2003)). It is therefore clear that the current pre-clinical safety assessment systems are inadequate for the completeand comprehensive evaluation of new therapeutic entities. Yet, elucidation of the mechanisms of hepatic drug injury is often difficult.
Drug-induced liver disease is typically unpredictable and rare. Most of the medications that cause acute liver injury in humans do not produce injury in experimental models, and patients exhibiting hepatotoxicity often have multiple risk factorsfor liver disease (see, e.g., Hepatotoxicity Clinical Research Network).
Drug-induced liver injury is also quite variable in clinical expression (see, e.g., Hepatotoxicity Clinical Research Network). Patterns of hepatotoxic injury can mimic most other forms of liver disease, including acute viral hepatitis,autoimmune liver disease, bland cholestasis, mixed cholestatic-hepatic syndromes, acute cholangitis, microvesicular steatosis with lactic acidosis, alcohol-like steatohepatitis, and venoocclusive disease. In addition, drugs that cause hepatotoxicity areoften withdrawn from use, and their mechanisms of injury remain unknown.
The majority of preliminary compound screening in the pharmaceutical industry is currently conducted using in vitro cell based assays (Lin et al., Current Topics in Med. Chem. 3, 1125 (2003)). These assays typically measure cell viability andmetabolism, apoptosis or rely on the measurement of general toxicity indicators that are not applicable to pre-clinical animal studies. Conversely, traditional in vivo biomarker measurements are typically not suitable for use in high throughput cellbased assays (Streiner and Norman., Health Measurement Scales: A practical Guide to Their Development and Use (Oxford University Press, Oxford, 1995); Swanson., Dis. Markers. 18, 47-56 (2002)).
A common set of analytes that could be used both to predict toxicity in vitro and gauge toxic effects in vivo would therefore be of great value. A single set of reagents and standards could be used to evaluate compounds from initial screening,through testing in pre-clinical species, and potentially in clinical trials. Such universal indicators of toxicity should meet several criteria. First, they should correctly identify toxic compounds with diverse mechanisms of action, including variouschemical classes/chemotypes. Second, changes in these biomarkers should be consistent, quantifiable and reflect the degree of toxic insult. Third, assays should be adaptable to high throughput technologies without becoming prohibitively expensive. Fourth, in vivo sample collection should be non or minimally invasive, i.e. urine or blood. Fifth, since there may be a need to analyze archival samples, the biomarker needs to be stable.
Despite the clinical significance of hepatic idiosyncratic injury, this form of liver injury is a relatively unstudied area of medicine. Therefore, there is a substantial need in the art to identify and characterize biomarkers useful forpredicting in vivo hepatic toxicity. The inventors describe herein the identification of several idiosyncratic hepatotoxicity biomarkers that are capable of predicting the incidence of idiosyncratic hepatotoxicity for a particular compound both in vitroas well as in vivo that meets each of the five criteria described supra.
SUMMARY OF THE INVENTION
In accordance with the present invention, proteomic and immunological techniques were employed to identify biomarker polypeptides (SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837(SEQ ID NO:2), in addition to their respective mouse and rat orthologues, mouse BMS-PTX-265 (SEQ ID NO:61), rat BMS-PTX-265 (SEQ ID NO:62), mouse BMS-PTX-837 (SEQ ID NO:63), and rat BMS-PTX-837 (SEQ ID NO:64), which show increased levels in the mediaobtained from modified hepatocyte cell lines treated with toxic drugs as compared to media obtained from cells treated with non-toxic drugs or vehicle alone. Such biomarker polypeptides are particularly useful for pre- or post-clinical screening, whichcan be used to identify compounds or combinations of compounds that cause hepatic injury and thereby prevent medical complications from hepatotoxicity, e.g., idiosyncratic hepatotoxicity.
Accordingly, the present invention encompasses biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ ID NO:2), in addition to their respective mouseand rat orthologues, mouse BMS-PTX-265 (SEQ ID NO:61), rat BMS-PTX-265 (SEQ ID NO:62), mouse BMS-PTX-837 (SEQ ID NO:63), and rat BMS-PTX-837 (SEQ ID NO:64), that have utility in predicting in vivo hepatotoxicity of a wide range of test substances,including PPAR agonists, anti-inflammatory drugs, neurological drugs, estrogenic and anti-estrogenic drugs, anti-angina drugs, muscle relaxants, and antihistamines, among others. Such biomarker polypeptides can be used in the screening methods of theinvention to predict toxic effects of treatment with one or more drugs, compounds, or other therapeutic agents before, after, or concurrently with clinical testing.
The present invention also encompasses antibodies (e.g., polyclonal or monoclonal antibodies, or fragments thereof) specifically directed against one or more of the biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQID NO:64), including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ ID NO:2), in addition to their respective mouse and rat orthologues, mouse BMS-PTX-265 (SEQ ID NO:61), rat BMS-PTX-265 (SEQ ID NO:62), mouse BMS-PTX-837 (SEQ ID NO:63), and ratBMS-PTX-837 (SEQ ID NO:64). Such antibodies can be used detect and measure the levels of the biomarker polypeptides of the present invention, and can be used in the screening methods of the invention, as described herein. In various aspects of theinvention, the screening methods can be manual or automated, can be used in conjunction with one or more kits, and can test for hepatotoxicity in one patient or a patient population (see below).
The present invention additionally encompasses assays that use biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) to predict prior to treatment if an individual patient will be unable to tolerate one ormore drugs, compounds, or other therapeutic agents (i.e., test substances) due to hepatotoxic effects, e.g., idiosyncratic hepatotoxicity. In one aspect of the invention, cells from a patient's liver or liver for transplantation can be modified tooverexpress one or more cytochrome P450 enzymes, and then assayed (e.g., by immunoassay) to determine the levels of one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), including BMS-PTX-265 (SEQ IDNO:1) and BMS-PTX-837 (SEQ ID NO:2), in addition to their respective mouse and rat orthologues, mouse BMS-PTX-265 (SEQ ID NO:61), rat BMS-PTX-265 (SEQ ID NO:62), mouse BMS-PTX-837 (SEQ ID NO:63), and rat BMS-PTX-837 (SEQ ID NO:64). The cells can betreated with at least one test substance, and extracellular and/or intracellular levels of the biomarker polypeptide(s) in the presence and absence of the test substance(s) can be compared. The observation of high levels of one or more biomarkerpolypeptide(s) in the presence of the substance(s) can be used to predict in vivo hepatoxicity. In various aspects of the invention, the test substance(s) can comprise one or more PPAR agonists, anti-inflammatory drugs, neurological drugs, estrogenic oranti-estrogenic drugs, anti-angina drugs, muscle relaxants, antihistamines, or other drugs, compounds, or therapeutic agents.
The present invention further encompasses screening assays that measure levels of one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) to determine or predict if a drug, compound, or othertherapeutic agent will have hepatotoxic effects (e.g., idiosyncratic hepatotoxicity) in a patient population. In one aspect of the invention, hepatic cell lines overexpressing one or more cytochrome P450 enzymes can be assayed (e.g., by immunoassay) todetermine the levels of one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ ID NO:2), in addition to their respective mouse and rat orthologues,mouse BMS-PTX-265 (SEQ ID NO:61), rat BMS-PTX-265 (SEQ ID NO:62), mouse BMS-PTX-837 (SEQ ID NO:63), and rat BMS-PTX-837 (SEQ ID NO:64), in the presence and absence of at least one test substance. As examples, the extracellular media, intact cells,and/or cell lysates can be used to measure biomarker polypeptide levels. The observation of elevated levels of one or more biomarker polypeptides in the presence of the test substance(s) can be used to predict the likelihood of in vivo hepatotoxicity. In specific aspects of the invention, the test substances can comprise one or more PPAR agonists, anti-inflammatory drugs, neurological drugs, estrogenic or anti-estrogenic drugs, anti-angina drugs, muscle relaxants, antihistamines, or other drugs,compounds, or therapeutic agents. In an additional aspect, the assays of the invention are automated for high throughput screening.
The present invention likewise encompasses screening assays that measure levels of one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQID NO:2), in addition to their respective mouse and rat orthologues, mouse BMS-PTX-265 (SEQ ID NO:61), rat BMS-PTX-265 (SEQ ID NO:62), mouse BMS-PTX-837 (SEQ ID NO:63), and rat BMS-PTX-837 (SEQ ID NO:64), to monitor a drug, compound, or other therapeuticagent for hepatotoxic effects (e.g., idiosyncratic hepatotoxicity) during treatment of a patient or patient population. In particular aspects, biological samples (e.g., blood, urine, and/or saliva, etc.) can be obtained from one or more patients priorto treatment with a test substance and at designated intervals during treatment. The levels of at least one biomarker polypeptide can be compared in each sample, and the observation of increased biomarker levels that coincide with thecommencement/duration of treatment can be used to predict the likelihood hepatotoxic effects (e.g., idiosyncratic hepatotoxicity). The results of such screening may be used to determine the need to modify or discontinue an existing treatment.
The present invention also encompasses microarrays, e.g., protein, antibody, or cell-based microarrays, which can be used in conjunction with the disclosed screening assays. Such arrays can comprise one or more biomarker polypeptides (e.g., SEQID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ ID NO:2), in addition to their respective mouse and rat orthologues, mouse BMS-PTX-265 (SEQ ID NO:61), rat BMS-PTX-265 (SEQ ID NO:62),mouse BMS-PTX-837 (SEQ ID NO:63), and rat BMS-PTX-837 (SEQ ID NO:64), antibodies that specifically recognize one or more of these polypeptides, or cells producing one or more of these polypeptides. The protein, antibody, and cell-based microarrays canbe used in the manual or automated screening assays of the invention as disclosed herein to test one or more drugs, compounds, or other therapeutic agents. For protein microarrays, polypeptides obtained from hepatic cells (e.g., from extracellular mediaor cell lysates) incubated in the presence and absence of at least one test substance can be affixed to a support, and then contacted with antibodies that specifically bind to one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQID NO:61 to SEQ ID NO:64). For antibody microarrays, one or more anti-biomarker antibodies can be affixed to a support, and then contacted with extracellular media or cell lysates obtained from hepatic cells incubated in the presence and absence of atleast one test substance. For cell-based microarrays, one or more cells can be affixed to a support, and then incubated in the presence and absence of at least one test substance. The microarrays can then be analyzed (e.g., by immunoassay) to determineelevated levels of at least one biomarker polypeptide in the presence of the test substance(s), which can be used to predict in vivo hepatotoxicity. In specific aspects of the invention, the test substances can comprise one or more PPAR agonists,anti-inflammatory drugs, neurological drugs, estrogenic or anti-estrogenic drugs, anti-angina drugs, muscle relaxants, antihistamines, or other drugs, compounds, or therapeutic agents.
The present invention additionally encompasses kits comprising one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ ID NO:2), in additionto their respective mouse and rat orthologues, mouse BMS-PTX-265 (SEQ ID NO:61), rat BMS-PTX-265 (SEQ ID NO:62), mouse BMS-PTX-837 (SEQ ID NO:63), and rat BMS-PTX-837 (SEQ ID NO:64), and anti-biomarker antibodies, which can be used to predict thelikelihood of hepatotoxic effects, such as idiosyncratic hepatotoxicity, of one or more drugs, compounds, or other therapeutic agents. Such kits can be used in clinical or pre-clinical settings, and can include one or more biomarker polypeptides (e.g.,SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) and anti-biomarker antibodies. In specific aspects of the invention, the kits can include one or more microarrays comprising antibodies that specifically bind with these biomarkerpolypeptides. The kits can be employed in conjunction with the manual and automated screening methods of the invention. In various aspects, the kits can include instructions for use, and reagents and materials for measuring levels of the biomarkerpolypeptides e.g., in immunoassays, such as enzyme linked immunosorbent assays (ELISAs); Western blotting; direct or indirect immunofluorescence, immunohistochemistry, and the like.
The present invention further encompasses cell culture systems for the identification of polypeptides, in addition to the specified biomarker polypeptides (SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), whose levels (e.g.,extracellular, intracellular, or cell lysate levels) correlate with hepatic toxicity. In specific aspects of the invention, such systems can comprise hepatic cell lines, which can be incubated in the presence or absence of one or more drugs, compounds,or other therapeutic agents. The biomarker polypeptides identified from these systems can be useful for predicting test substances (or combinations of test substances) that can directly or indirectly cause in vivo hepatic injury, e.g., idiosyncratichepatotoxicity. Test substances for evaluation can include PPAR agonists, anti-inflammatory drugs, neurological drugs, estrogenic and anti-estrogenic drugs, anti-angina drugs, muscle relaxants, antihistamines, and other drugs, compounds, and therapeuticagents.
The present invention encompasses methods of measuring the levels of polypeptides (e.g., extracellular polypeptides in the media) using mass spectrometer data to determine the number of peptide "hits" for each polypeptide, and comparing theresults obtained in the presence and absence of a test substance. In various aspects, the test substance used with these methods comprises a PPAR agonist, anti-inflammatory drug, neurological drug, estrogenic and anti-estrogenic drug, anti-angina drug,muscle relaxant, antihistamines, or other drug, compound, or therapeutic agent.
Also encompassed by the invention are nucleic acids encoding the disclosed biomarker polypeptides (SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64, and SEQ ID NO:61 to SEQ ID NO:64), e.g., as set forth in SEQ ID NO:46 to SEQ IDNO:60, and SEQ ID NO:65 to SEQ ID NO:68, and fragments, variants, and derivatives thereof, as well as screening assays, kits, microarrays, and cell culture systems employing these nucleic acids. In one aspect of the invention, screening assays (e.g.,RT-PCR or in situ assays) that measure levels of one or more biomarker nucleic acids (e.g., SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68) are used to predict or determine if a drug, compound, or other therapeutic agent will have in vivohepatotoxic effects, e.g., idiosyncratic hepatotoxicity. In accordance with such assays, levels of at least one biomarker nucleic acid is determined for hepatocytes that have been modified to overexpress one or more cytochrome P450 enzymes and thenincubated in the presence and absence of one or more test substances. Elevated levels of one or more biomarker nucleic acids in the presence of the test substance(s) can be used to predict the likelihood of in vivo hepatotoxicity, e.g., idiosyncratichepatotoxicity.
The present invention also encompasses a method of predicting hepatotoxicity of a test substance comprising the steps of: a) incubating a hepatocyte in the presence and absence of a test substance; and b) comparing levels of at least onebiomarker polypeptide selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64, in the presence and absence of said test substance; wherein an elevated level of said biomarker polypeptide(s) in the presence ofthe test substance indicates that the substance is predicted to cause hepatotoxicity, and wherein the level of said biomarker polypeptide(s) is measured using single or multi dimensional high performance liquid chromatography coupled to tandem massspectrometry wherein the number of peptide hits from each protein identification are used to determine the abundance of said biomarker polypeptide(s) in the presence and absence of said test substance.
Further objects, features, and advantages of the present invention will be better understood upon a reading of the detailed description of the invention when considered in connection with the accompanying figures or drawings.
BRIEFDESCRIPTION OF THE FIGURES
FIG. 1. Flow chart illustrating the sample preparation and bioanalytical steps involved in generating cell supernatants comprising candidate polypeptide biomarkers. Such polypeptides would be expected to be prognostic of the clinical safetyprofile of the chemical entities tested.
FIG. 2. A diagram of the proteomics apparatus used for the initial discovery phase of this research. The biphasic packed capillary served as a means of separating the peptides created by the proteolysis of the polypeptides found in the cellsupernatants. These separated peptides were introduced into the mass spectrometer by electrospray ionization for identification and quantitation analysis.
FIGS. 3A-3B. Peptide hits for BMS-PTX-265 (FIG. 3A) and BMS-PTX-837 (FIG. 3B). The number of peptide hits were averaged and normalized from LC/LC/MS/MS data in triplicate experiments and are expressed as the percent of total hits. The solidbars indicate the compounds known to be toxic, based on clinical and post-marketing data.
FIGS. 4A-4B. The primary amino acid sequences of biomarker polypeptides BMS-PTX-265 (FIG. 4A; SEQ ID NO:1) and BMS-PTX-837 (FIG. 4B; SEQ ID NO:2) as expressed in single letter code. BMS-PTX-265 corresponds to GenBank Identifier No. 112695;BMS-PTX-837 corresponds to GenBank Identifier No. 30583135.
FIGS. 5A-5B. Mean values (+/-SD) of BMS-PTX-265 (FIG. 5A) and BMS-PTX-837 (FIG. 5B) determined from three separate cell culture experiments, as assayed in triplicate. FIG. 5A: Results were derived from densitometric analyses of each proteinband and calculated as a percentage of total signal intensity. FIG. 5B: Results are shown as discrete values. The asterisks indicate those data that showed a statistically significant difference compared to the DMSO vehicle (p<0.05; Troglitazone,Ciglitazone, and Farglitazar). The solid bars indicate the compounds known to be toxic, based on clinical and post-marketing data.
FIGS. 6A-6B. Histograms of the mean densitometry data taken from duplicate western blots of BMS-PTX-265 (FIG. 6A) and the mean colorimetric data taken from duplicate ELISA of BMS-PTX-837 (FIG. 6B). Each is expressed as a function of 20treatments, as itemized in Table 2 (below). The solid bars indicate the compounds known to be toxic, based on clinical and post-marketing data.
FIGS. 7A-7C. The primary amino acid sequences of additional biomarker polypeptides (see also Tables 3 and 4). FIG. 7A: BMS-PTX-447; (GenBank Ident. No. 65922; SEQ ID NO:3); BMS-PTX-749 (GenBank Ident. No. 2460318; SEQ ID NO:4); BMS-PTX-607(GenBank Ident. No. 7212867; SEQ ID NO:5); BMS-PTX-808 (GenBank Ident. No. 4505029; SEQ ID NO:6); BMS-PTX-860 (GenBank Ident. No. 14603147; SEQ ID NO:7); and BMS-PTX-254 (GenBank Ident. No. 4557801; SEQ ID NO:8). FIG. 7B: BMS-PTX-225 (GenBank Ident. No. 15216175; SEQ ID NO:9); BMS-PTX-(39)147 (GenBank Ident. No. 2497297; SEQ ID NO:10); BMS-PTX-459 (GenBank Ident. No. 2136258; SEQ ID NO:11); BMS-PTX-120 (GenBank Ident. No. 4505621; SEQ ID NO:12); BMS-PTX-062 (GenBank Ident. No. 10434265; SEQ IDNO:13); and BMS-PTX-260 (GenBank Ident. No. 20141722; SEQ ID NO:14). FIG. 7C: BMS-PTX-(29)147 (GenBank Ident. No. 119339; SEQ ID NO:15).
FIGS. 8A-8B. Non-limiting examples of primers that can be used for the amplification of biomarker polynucleotide sequences, for example, for RT-PCR analysis. FIG. 8A: BMS-PTX-265 (primers SEQ ID NO:16-SEQ ID NO:17), BMS-PTX-447 (primers SEQ IDNO:18-SEQ ID NO:19), BMS-PTX-749 (primers SEQ ID NO:20-SEQ ID NO:21), BMS-PTX-607 (primers SEQ ID NO:22-SEQ ID NO:23), BMS-PTX-808 (primers SEQ ID NO:24-SEQ ID NO:25), BMS-PTX-860 (primers SEQ ID NO:26-SEQ ID NO:27), BMS-PTX-254 (primers SEQ ID NO:28-SEQID NO:29), BMS-PTX-225 (primers SEQ ID NO:30-SEQ ID NO:31), and BMS-PTX-(39)147 (primers SEQ ID NO:32-SEQ ID NO:33). FIG. 8B: BMS-PTX-459 (primers SEQ ID NO:34-SEQ ID NO:35), BMS-PTX-120 (primers SEQ ID NO:36-SEQ ID NO:37), BMS-PTX-837 (primers SEQ IDNO:38-SEQ ID NO:39), BMS-PTX-062 (primers SEQ ID NO:40-SEQ ID NO:41), BMS-PTX-260 (primers SEQ ID NO:42-SEQ ID NO:43), and BMS-PTX-(29)147 (primers SEQ ID NO:44-SEQ ID NO:45). Key for FIGS. 8A-8B: start=nucleotide position in cDNA where primer sequencebegins; len=length of primer; gc %=percent guanine and cytosine content of the primer; tm=melting temperature of the hybrid; any=a measure of internal complementarity to predict hybridization of the primer; 3'=a measure of 3' complementarity of theprimer; seq=sequence of primer.
FIGS. 9A-9H. The nucleotide sequences encoding the biomarker polypeptides. FIG. 9A: BMS-PTX-265 (SEQ ID NO:46; GenBank Ident. No. 30331109) and BMS-PTX-837 (SEQ ID NO:47; GenBank Ident. No. 30583134). FIG. 9B: BMS-PTX-447 (SEQ ID NO:48;GenBank Ident. No. 12804776) and BMS-PTX-749 (SEQ ID NO:49; GenBank Ident. No. 2460317). FIG. 9C: BMS-PTX-607 (SEQ ID NO:50; GenBank Ident. No. 7212866) and BMS-PTX-808 (SEQ ID NO:51; GenBank Ident. No. 4505028). FIG. 9D: BMS-PTX-860 (SEQ ID NO:52;GenBank Ident. No. 14603146), BMS-PTX-254 (SEQ ID NO:53; GenBank Ident. No. 4557800), and BMS-PTX-225 (SEQ ID NO:54; GenBank Ident. No. 15216174). FIG. 9E: BMS-PTX-(39)147 (SEQ ID NO:55; GenBank Ident. No. 886257). FIG. 9F: BMS-PTX-459 (SEQ IDNO:56; GenBank Ident. No. 971271) and BMS-PTX-120 (SEQ ID NO:57; GenBank Ident. No. 4505620). FIG. 9G: BMS-PTX-062 (SEQ ID NO:58; GenBank Ident. No. 10434264) and BMS-PTX-260 (SEQ ID NO:59; GenBank Ident. No. 12655086). FIG. 9H: BMS-PTX-(29)147(SEQ ID NO:60; GenBank Ident. No. 182113).
FIGS. 10A-D. Quantified Western analyses of murine 14-3-3 ZETA (mouse BMS-PTX-265; FIG. 16A; SEQ ID NO:61) and murine MIF (mouse BMS-PTX-837; FIG. 16B; SEQ ID NO:62) serum levels in mice either prior ("Pre-Treatment") or subsequent("Post-Treatment") to Compound A exposure at either a dose of 10 mg/kg (FIGS. 10A and 10C) or a dose of 50 mg/kg (FIGS. 10B and 10D). The mouse number is noted on the X-axis. Bars represent relative luminosity as determined by integrated bandintensity. Serum levels of were quantified using Quantity One software (Bio-Rad, Hercules, Calif.).
FIGS. 11A-B. Time course of rat 14-3-3 ZETA (rat BMS-PTX-265; FIG. 16C; SEQ ID NO:63) and MIF (rat BMS-PTX-837; FIG. 16D; SEQ ID NO:64) serum levels in rats following Compound B exposure. Values were determined by Western blot using Quantity Onesoftware (Bio-Rad, Hercules, Calif.) and represent the percent increase post-treatment as a percentage over the observed pre-treatment serum levels with either Compound B or vehicle alone ("Vehicle"). Bars represent relative luminosity as determined byintegrated band intensity.
FIGS. 12A-B. Time course of canine 14-3-3 ZETA (canine BMS-PTX-265), in addition to the traditional toxicity markers AST and ALT (inset) following Compound B exposure in two canine subjects (FIG. 12A and FIG. 12B). Canine 14-3-3 ZETA levels weredetermined by Western blot analyses using Quantity One software (Bio-Rad, Hercules, Calif.). For comparison, all values were normalized to percent of pre-dose.
FIGS. 13A-B. HPLC chromatograms of E. coli lysates from cells transformed with vector control (A) or recombinant full length human 14-3-3 ZETA (B). Inset shows anti-human-14-3-3 ZETA specific Western band from peak indicated by arrow in (B).
FIG. 14. Comparison of human 14-3-3 ZETA (BMS-PTX-265; FIG. 4A; SEQ ID NO:1) levels as measured by both Western blot and ELISA as described herein.
FIG. 15. Provides the range of circulating plasma levels of human 14-3-3 ZETA (BMS-PTX-265; FIG. 4A; SEQ ID NO:1) and human MIF that was observed in human volunteers using commercially available recombinant MIF and the recombinant 14-3-3 ZETAdescribed herein, as standards.
FIGS. 16A-D. The primary amino acid sequences of the mouse and rat orthologs of the human BMS-PTX-265 and BMS-PTX-837 biomarker polypeptides. FIG. 16A: mouse BMS-PTX-265; (GenBank Ident. No. gi|AAC53254; SEQ ID NO:61); FIG. 16B: mouseBMS-PTX-837 (GenBank Ident. No. gi|AAH24895; SEQ ID NO:62); FIG. 16C: rat BMS-PTX-265 (GenBank Ident. No. gi|BAA04534; SEQ ID NO:63); and FIG. 16D: BMS-PTX-837 (GenBank Ident. No. gi|AAA62644; SEQ ID NO:64).
FIGS. 17A-D. The nucleotide sequences encoding the biomarker polypeptides acid sequences of the mouse and rat orthologs of the human BMS-PTX-265 and BMS-PTX-837 biomarker polypeptides. FIG. 17A: mouse BMS-PTX-265; (GenBank Ident. No.gi|1711129; SEQ ID NO:65); FIG. 17B: mouse BMS-PTX-837 (GenBank Ident. No. gi|19354169; SEQ ID NO:66); FIG. 17C: rat BMS-PTX-265 (GenBank Ident. No. gi|402510; SEQ ID NO:67); and FIG. 17D: BMS-PTX-837 (GenBank Ident. No. gi|694107; SEQ ID NO:68).
FIG. 18. Non-limiting examples of primers that can be used for the amplification of biomarker polynucleotide sequences, for example, for RT-PCR analysis. Mouse BMS-PTX-265 (primers SEQ ID NO:69 and SEQ ID NO:70), Mouse BMS-PTX-837 (primers SEQID NO:71 and SEQ ID NO:72), Rat BMS-PTX-265 (primers SEQ ID NO:73 and SEQ ID NO:74), and Rat BMS-PTX-837 (primers SEQ ID NO:75 and SEQ ID NO:76). Key for FIG. 18: start=nucleotide position in cDNA where primer sequence begins; len=length of primer; gc%=percent guanine and cytosine content of the primer; tm=melting temperature of the hybrid; any=a measure of internal complementarity to predict hybridization of the primer; 3'=a measure of 3' complementarity of the primer; seq=sequence of primer.
DETAILED DESCRIPTION OF THE INVENTION
In accordance with the present invention, a combination of proteomic and immunological techniques were employed to identify and verify components of the conditioned culture media from immortalized human hepatocytes overexpressing cytochrome P4503A4. Cells were treated with several individual compounds, including L-tyrosine PPAR agonists and HIV protease inhibitors, plus a vehicle control, dimethyl sulfoxide. For each drug class, clinically-determined hepatotoxic and non-hepatotoxic compoundswere compared. Several polypeptides (SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) were identified from this assay, including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ ID NO:2), which were reproducibly and significantly increased inthe conditioned media from cells treated with each of the toxic compounds as compared to media from cells treated with the non-toxic compounds or vehicle alone.
The results for BMS-PTX-265 (SEQ ID NO: 1) and BMS-PTX-837 (SEQ ID NO:2) were confirmed using western blots and enzyme linked immunosorbent assays used to measure the response of these two proteins on an expanded set of 20 compounds. For all 20of the tested drugs, elevations of BMS-PTX-265 correlated exactly with the known safety profile; whereas changes in BMS-PTX-837 correctly predicted the safety profile in 19 of 20 drugs (one false negative was observed). Furthermore, both BMS-PTX-265 andBMS-PTX-837 biomarkers were shown to be readily detectable and quantifiable in the serum and plasma of mice, rats and dogs and that the expression levels of both biomarkers increased with hepatotoxin exposure in a dose dependent manner. Theseobservations indicated that the identified biomarker polypeptides (SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ ID NO:2), can be used in pre- or post-clinical screening toidentify test substances or combinations of test substances that cause hepatic toxicity. Accordingly, the invention can be used to prevent or decrease the incidence of hepatotoxicity, including idiosyncratic hepatotoxicity.
Definitions
Use of the phrases "SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64", and "SEQ ID NO:46 to SEQ ID NO:60, and SEQ ID NO:65 to SEQ ID NO:68" etc., is intended, for convenience, to refer to each individual SEQ ID NO. individually, andis not intended to refer to the sequences collectively. The invention encompasses each sequence individually, as well as any combination thereof.
As used herein, the term "test substance" is meant to encompass any molecule, chemical entity, composition, drug, therapeutic agent, chemotherapeutic agent, or biological agent capable of preventing, ameliorating, or treating a disease or othermedical condition. The term includes small molecule compounds, antisense reagents, siRNA reagents, antibodies, and the like. A test substance can be assayed in accordance with the methods of the invention at any stage during clinical trials, duringpre-trial testing, or following FDA-approval.
A "biomarker polynucleotide" (or nucleic acid) as used herein, refers to a molecule comprising a nucleotide sequence encoding a disclosed polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), for example, as disclosedin FIGS. 9A-9H. Specifically included are DNA and RNA molecules obtained from cellular, cell-free, or synthetic sources, as well as genomic and cDNA sequences, unspliced or partly spliced transcripts, and splicing products. Also included are "proteinnucleic acids" (PNAs) formed by conjugating bases to an amino acid backbone. The nucleic acid sequences of the invention may be single- or double-stranded (i.e., DNA-DNA, DNA-RNA and RNA-RNA hybrids), and may represent the sense or antisense strand(i.e., complementary sequences). Nucleic acids (e.g., fragments, variants, and derivatives thereof) encoding functional equivalents of a biomarker polypeptide are also embraced by the present invention.
A "biomarker polypeptide" (or protein) refers to a molecule comprising an amino acid sequence of a disclosed polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), which may be obtained from any species, preferablymammalian, and more preferably, human, and from a variety of sources, including cellular, cell-free, synthetic, semi-synthetic, or recombinant sources. Functional equivalents of a polypeptide (e.g., fragments, variants, and derivatives thereof) are alsoembraced by the present invention.
"Variant" polynucleotides and polypeptides include molecules containing one or more deletions, insertions and/or substitutions compared to the sequences disclosed in FIGS. 4A-4B, FIGS. 7A-7C, FIGS. 8A-8B, or FIGS. 9A-9H. Variant polynucleotidescan encode the same or a functionally-equivalent biomarker polypeptide. Variants and functional equivalents, preferably, retain at least one activity (e.g., correlation with hepatotoxicity) of the original molecules.
"Derivative" polynucleotides include nucleic acids subjected to chemical modification, for example, replacement of hydrogen by an alkyl, acyl, or amino group. Derivatives, e.g., derivative oligonucleotides, may comprise non-naturally-occurringportions, such as altered sugar moieties or inter-sugar linkages. Exemplary among these are phosphorothioate and other sulfur containing species which are known in the art. Derivative nucleic acids may also contain labels, including radionucleotides,enzymes, fluorescent agents, chemiluminescent agents, chromogenic agents, substrates, cofactors, inhibitors, magnetic particles, and the like. Preferably, a nucleic acid derivative retains at least one activity (e.g., correlation with hepatotoxicity) ofthe original molecule.
A "derivative" polypeptide or peptide is one that is modified, for example, by glycosylation, pegylation, phosphorylation, sulfation, reduction/alkylation, acylation, chemical coupling, or mild formalin treatment. A derivative may also bemodified to contain a detectable label, either directly or indirectly, including, but not limited to, a radioisotope, fluorescent, and enzyme label. Preferably, the polypeptide or peptide retains at least one biological activity (e.g., correlation withhepatotoxicity) of the original molecule.
"Oligonucleotides" or "oligomers" refer to a nucleic acids, preferably comprising contiguous nucleotides, of at least about 6 nucleotides to about 60 nucleotides, preferably at least about 8 to 10 nucleotides in length, more preferably at leastabout 12 nucleotides in length e.g., about 15 to 35 nucleotides, or about 15 to 25 nucleotides, 18 to 20 nucleotides, or about 20 to 35 nucleotides, which can be typically used in PCR amplification assays, hybridization assays, or in microarrays. Itwill be understood that the term "oligonucleotide" is substantially equivalent to the terms primer, probe, or amplimer, as commonly defined in the art. It will also be appreciated by those skilled in the pertinent art that a longer oligonucleotideprobe, or mixtures of probes, e.g., degenerate probes, can be used to detect longer, or more complex, nucleic acid sequences, for example, genomic DNA. In such cases, the probe may comprise at least 20-200 nucleotides, preferably, at least 30-100nucleotides, more preferably, 50-100 nucleotides.
"Amplification" refers to the production of additional copies of a polynucleotide and is generally carried out using polymerase chain reaction (PCR) technologies, which are well known and practiced in the art (see, D. W. Dieffenbach and G. S.Dveksler, 1995, PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y.).
"Microarray" is an array of distinct polynucleotides, oligonucleotides, polypeptides, peptides, or antibodies affixed to a substrate, such as paper, nylon, or other type of membrane; filter; chip; glass slide; or any other type of suitablesupport.
The term "isolated" refers to polynucleotides, polypeptides, peptides, and antibodies, that are substantially purified or separated, and are at least 60% free, preferably 75% to 85% free, and most preferably 90% or greater free from othercomponents with which they are associated with in a cell, cell extract, or cell-free system.
The term "sample" is meant to be interpreted in its broadest sense. A "sample" refers to a biological sample, such as, for example; one or more cells, tissues, or fluids (including, without limitation, plasma, serum, whole blood, cerebrospinalfluid, lymph, tears, urine, saliva, milk, pus, and tissue exudates and secretions) isolated from an individual or from cell culture constituents, as well as samples obtained from, for example, a laboratory procedure. A biological sample may comprisechromosomes isolated from cells (e.g., a spread of metaphase chromosomes), organelles or membranes isolated from cells, whole cells or tissues, nucleic acid such as genomic DNA in solution or bound to a solid support such as for Southern analysis, RNA insolution or bound to a solid support such as for Northern analysis, cDNA in solution or bound to a solid support, oligonucleotides in solution or bound to a solid support, polypeptides or peptides in solution or bound to a solid support, a tissue, atissue print and the like.
As used herein, the term "linker" means a chemical moiety which covalently joins the reactive groups already on the substrate and the molecule (e.g., DNA, antibody, or polypeptide) to be eventually immobilized, having a backbone of chemical bondsforming a continuous connection between the reactive groups on the substrate and the binding elements, and having a plurality of freely rotating bonds along that backbone.
The term "antibody" refers to intact molecules as well as fragments thereof, such as Fab, F(ab').sub.2, Fv, which are capable of binding an epitopic or antigenic determinant. This includes immunoglobulin molecules and immunologically activeportions or fragments of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds an antigen. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY),class or subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) of immunoglobulin molecule. In a preferred embodiment, the immunoglobulin is an IgG1 isotype. In another preferred embodiment, the immunoglobulin is an IgG2 isotype. In another preferredembodiment, the immunoglobulin is an IgG4 isotype.
The term "monoclonal antibody" as used herein is not limited to antibodies produced through hybridoma technology. The term refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and notthe method by which it is produced.
The term "humanized" antibody refers to antibody molecules in which amino acids have been replaced in the non-antigen binding regions in order to more closely resemble a human antibody, while still retaining the original binding capability, e.g.,as described in U.S. Pat. No. 5,585,089 to C. L. Queen et al.
As used herein, "human" antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin andthat do not express endogenous immunoglobulins, as described infra and, for example, in U.S. Pat. No. 5,939,598.
The term "epitopes" as used herein, refers to portions of a polypeptide having antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably a human. In a preferred embodiment, the present invention encompasses apolypeptide comprising an epitope, as well as the polynucleotide encoding this polypeptide.
An "immunogenic epitope" as used herein, refers to a portion of a protein that elicits an antibody response in an animal, as determined by any method known in the art, for example, by the methods for generating antibodies described infra. See,for example, Geysen et al., 1983, Proc. Natl. Acad. Sci. USA, 81:3998-4002.
The term "antigenic epitope" as used herein refers to a portion of a protein to which an antibody can immunospecifically bind to its antigen as determined by any method well known in the art, for example, by the immunoassays described herein.
The term "antigenic determinant" refers to that portion of a molecule that makes contact with a particular antibody (i.e., an epitope). When a polypeptide, peptide, or fragment thereof is used to immunize a host animal, numerous regions of thesequence may induce the production of antibodies which bind specifically to a given region or three-dimensional structure on the sequence; these regions or structures are referred to an antigenic determinants. An antigenic determinant may compete withthe intact antigen (i.e., the immunogen used to elicit the immune response) for binding to an antibody.
The terms "specific binding" or "specifically binding" refer to the interaction between a polypeptide or peptide and a binding molecule, such as an agonist, an antagonist, or an antibody. The interaction is dependent upon the presence of aparticular structure (i.e., an antigenic determinant or epitope) of the protein that is recognized by the binding molecule. For example, if an antibody is specific for epitope "A", the presence of a protein containing epitope A (or free, unlabeled A) ina reaction containing labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.
In accordance with the present invention, Immunospecific binding excludes non-specific binding, but does not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes need not necessarily be immunogenic.
Technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which the present invention pertains, unless otherwise defined. Reference is made herein to various methodologies known tothose of skill in the art. Publications and other materials setting forth such methodologies include the following: McDonald W H, Yates J R 3rd., 2002, Shotgun proteomics and biomarker discovery, Dis. Markers. 18(2):99-105; Link A J, 2002,Multidimensional peptide separations in proteomics, Trends Biotechnol. December; 20(12 Suppl):S8-13. Additional publications outlining the application of such proteomic methods is set forth in the following: J. Gao et al, "Identification of In VitroProtein Biomarkers of Idiosyncratic Liver Toxicity," Toxicology In Vitro, 18(4), 533-541 (2004); J. Gao et al, "Changes in the Protein Expression of Yeast as a Function of Carbon Source," Journal of Proteome Research, 2(6), 643-649 (2003); J. X. Pang etal, "Biomarker Discovery in Urine by Proteomics," Journal of Proteome Research, 1(2), 161-169 (2002). All of these publications are incorporated by reference herein in their entirety.
An additional embodiment of the present invention relates to a method of predicting hepatotoxicity of a test substance comprising the steps of: a) incubating a hepatocyte in the presence and absence of a test substance; and b) comparing levels ofat least one biomarker polypeptide selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64, in the presence and absence of said test substance; wherein an elevated level of said biomarker polypeptide(s) in thepresence of the test substance indicates that the substance is predicted to cause hepatotoxicity, and wherein the level of said biomarker polypeptide(s) is measured using single or multi dimensional high performance liquid chromatography coupled totandem mass spectrometry wherein the number of peptide hits from each protein identification are used to determine the abundance of said biomarker polypeptide(s) in the presence and absence of said test substance.
The application of single or multi dimensional high performance liquid chromatography coupled to tandem mass spectrometry is a novel means of identifying the relative quantitation of the biomarker polypeptide(s). The method takes into accountthe fact that an increased number of fragments of an identified protein isolated using single or multi dimensional high performance liquid chromatography coupled to tandem mass spectrometry directly correlates with the level of the protein present in thesample. Applicants invention represents the first application of single or multi dimensional high performance liquid chromatography coupled to tandem mass spectrometry as a means of quantifying the level of protein in a sample. Other applications ofthis method were simply limited to the task of identifying and/or cataloging the proteins within a sample, and were not directed to quantifying the proteins within that sample.
Polynucleotides
The present invention encompasses isolated polynucleotides that encode biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), as well as complementary sequences, fragments, variants, and derivatives thereof,and can be used to predict hepatotoxicity, e.g., idiosyncratic hepatotoxicity. Any polynucleotide that encodes an amino acid sequence of a biomarker polypeptide or peptide, or complementary sequences, or related fragments or variants, is included in theinvention. In specific aspects, the present invention encompasses polynucleotides comprising one or more of the biomarker nucleotide sequences (SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68), and complementary sequences, fragments,variants, and derivatives thereof. Polynucleotide variants of the present invention include, but are not limited to, variants that share at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%,99.5%, 99.6%, 99.7%, 99.8%, or 99.9% nucleotide sequence identity with any one of the sequences of SEQ ID NO:46 to SEQ ID NO:60, and SEQ ID NO:65 to SEQ ID NO:68, or sequences complementary thereto. Preferred are variants that share at least 45%, 51%,or 56% identity with any one of the sequences of SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68, or sequences complementary thereto. In various embodiments, the invention encompasses polynucleotide fragments, which include, but are notlimited to, fragments comprising at least 8, 10, 12, 15, 18, 20, 25, 30, 35, 36, 40, 45 contiguous nucleotides of any one of the sequences of SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68, or corresponding complementary sequences. Preferably, fragments comprise at least 18, 19, 20, or 21 contiguous nucleotides of any one of the sequences of SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68, or sequences complementary thereto.
Also encompassed by the invention are polynucleotides that are capable of hybridizing to the nucleotide sequences of SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68 under various conditions of stringency. Hybridization conditionsare typically based on the melting temperature (T.sub.m) of the nucleic acid binding complex or probe (see, G. M. Wahl and S. L. Berger, 1987; Methods Enzymol., 152:399-407 and A. R. Kimmel, 1987; Methods of Enzymol., 152:507-511), and may be used at adefined stringency. For example, included in the present invention are sequences capable of hybridizing under moderately stringent conditions to any one of the sequences of SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68, and othersequences that are degenerate to those which encode a biomarker polypeptide. As a non-limiting example, moderate stringency conditions comprise a prewashing solution of 2.times.SSC, 0.5% SDS, 1.0 mM EDTA, pH 8.0, and hybridization conditions of50.degree. C., 5.times.SSC, and overnight incubation.
As will be appreciated by the skilled practitioner in the art, the degeneracy of the genetic code results in the production of a multitude of nucleotide sequences encoding a biomarker polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ IDNO:61 to SEQ ID NO:64). Some of the degenerate sequences may bear minimal homology to the nucleotide sequences of the identified biomarkers (e.g., see SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68). Accordingly, the present inventioncontemplates each and every possible variation of nucleotide sequence that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to thenucleotide sequence of the originally identified biomarker polypeptides, and all such variations are to be considered as being specifically disclosed.
For some purposes, it may be advantageous to produce polynucleotides encoding a biomarker polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), or its fragments, variants, or derivatives, which possess a substantiallydifferent codon usage. Codons may be selected to increase the rate at which expression of the peptide/polypeptide occurs in a particular prokaryotic or eukaryotic host in accordance with the frequency with which particular codons are utilized by thehost. Alterations in codon usage can also be used to produce RNA transcripts having more desirable properties, such as a greater half-life, than transcripts produced from the naturally occurring sequence. In particular, RNA molecules may be modified toincrease intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2' O-methyl, rather thanphosphodiesterase linkages within the backbone of the molecule. This concept is inherent in the production of PNAs and can be extended in all of these molecules by the inclusion of nontraditional bases such as inosine, queosine, and wybutosine, as wellas acetyl-, methyl-, thio-, and similarly modified forms of adenine, cytosine, guanine, thymine, and uridine which are not as easily recognized by endogenous endonucleases.
The biomarker polynucleotides (e.g., SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68), and complementary sequences, and fragments thereof, can be engineered using methods generally known in the art in order to alter the sequencesfor a variety of reasons, including, but not limited to, alterations which modify the cloning, processing, and/or expression of the gene product. For example, DNA shuffling by random fragmentation and PCR reassembly of gene fragments and syntheticoligonucleotides may be used to engineer the nucleotide sequences. In addition, site-directed mutagenesis may be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, or introducemutations, and the like.
Also encompassed by the invention derivatives of the biomarker polynucleotides (e.g., SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68), and complementary sequences, and fragments thereof, which comprise one or more chemicalmodification, for example, replacement of hydrogen by an alkyl, acyl, or amino group. Alternatively, derivative polynucleotides may comprise non-naturally-occurring portions, such as altered sugar moieties or inter-sugar linkages. Exemplary among theseare phosphorothioate and other sulfur containing species which are known in the art. Derivative polynucleotides may also contain detection labels, including radionucleotides (e.g., .sup.32P, .sup.3H, and .sup.35S), enzymes, fluorescent (e.g., rhodamine,fluorescein, and Cy.TM.3, Cy.TM.5), chemiluminescent, or chromogenic, and other labels (e.g., DNP, digoxigenin, and biotin) such as substrates, cofactors, inhibitors, magnetic particles, and the like.
A wide variety of labels and conjugation techniques are known and employed by those skilled in the art. Nucleic acid labeling can be achieved by oligo-labeling, nick translation, end-labeling, or PCR amplification using a labeled primer. Alternatively, polynucleotides, or any portions or fragments thereof, may be cloned into a vector for the production of labeled mRNA sequences. Such vectors are known in the art, are commercially available, and may be used to synthesize labeled RNA invitro by addition of an appropriate RNA polymerase, such as T7, T3, or SP(6) and labeled nucleotides. These procedures may be conducted using a variety of commercially available kits (e.g., from Amersham-Pharmacia; Promega Corp.; and U.S. BiochemicalCorp., Cleveland, Ohio).
The present invention also encompasses the production of polynucleotides, or portions thereof, which encode a biomarker polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), and its fragments, and derivatives, entirelyby synthetic chemistry (see, for example, M. H. Caruthers et al., 1980, Nucl. Acids Res. Symp. Ser., 215-223 and T. Horn et al., 1980, Nucl. Acids Res. Symp. Ser., 225-232). After production, the synthetic sequence may be inserted into any of themany available expression vectors and cell systems using reagents that are well known to those in the art. Moreover, synthetic chemistry may be used to introduce mutations into a sequence encoding a biomarker polypeptide, or any fragment, variant, orderivative thereof. Alternatively, the polynucleotides of the invention can be produced by PCR amplification of the cloned sequences. In addition, the polynucleotides may be produced by recombinant systems, including cell-based and cell-free systems.
Polynucleotides that encode a biomarker polypeptide, or fragments, variants, or derivatives thereof, may be used in recombinant DNA molecules to direct the expression of a biomarker, or fragments or functional equivalents thereof, in appropriatehost cells. Because of the inherent degeneracy of the genetic code, other DNA sequences, which encode substantially the same or a functionally equivalent amino acid sequence, may be produced and these sequences may be used to clone and express abiomarker polypeptide. For expression in recombinant systems, a start and stop codons may be added to the nucleic acid sequence of a biomarker polypeptide. In addition, nucleotide sequences encoding epitopes or protein tags can be added to the nucleicacid sequence of the biomarker polypeptide, as described in detail herein. Methods of cloning and expression are well known to those skilled in the art and are described in numerous publication's, for example, Sambrook, Fritsch, and Maniatis, MolecularCloning: a Laboratory Manual, 2.sup.nd Edition, Cold Spring Harbor Laboratory Press, USA, (1989).
Polypeptides
The present invention encompasses isolated biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ ID NO:2), peptides, and fragments, variants, andderivatives thereof, that can be used to predict in vivo hepatotoxicity, e.g., idiosyncratic hepatotoxicity, as well as polynucleotides (e.g., SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68) encoding these peptides or polypeptides. Inaccordance with the invention, biomarker peptides can range in size from 5 amino acid residues to all but one residue of the entire sequence. Accordingly, peptides include, but are not limited to, fragments comprising at least 5, 6, 7, 8, 9, 10, 11, 12,13, 14, or 15 contiguous amino acids of any one of SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64. Preferably, biomarker peptides comprise antigenic fragments of any one of SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64.
The biomarker polypeptides, peptides, or fragments or variants thereof, may be linked to short tags, e.g., epitope tags such as HA and the like, or to other proteins, such as GST, GFP (e.g., GFP Y66F, GFP Y66H, GFP Y66W, wild type GFP, GFP S65A,GFP S65L, GFP S65T, ECFP, EYFP, DsRed; BD Biosciences CLONTECH, Palo Alto, Calif.), thioredoxin, maltose binding protein, etc. Also provided by the invention are chemically modified derivatives of the peptides and polypeptides of the invention that mayprovide additional advantages such as increased solubility, stability, and circulating time of the polypeptide. The chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propyleneglycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or moreattached chemical moieties.
In addition, amino acid sequence variants of the present invention include, but are not limited to, variants that share at least 40%, 50%, 60%, 61%, 67%, 70%, 74%, 76%, 80%, 81%, 84%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%,99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% nucleotide sequence identity with any one of SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64. For variants that are functional equivalents, the percent amino acid sequence identityis at least 61% or 67%. More preferably, the percent amino acid sequence identity is at least 74% or 76%, still more preferably, at least 81% or 84%, and even more preferably, at least 90% to any one of SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 toSEQ ID NO:64. However, as will be appreciated by the skilled practitioner, biological function per se need not be maintained where a biomarker peptide comprises an antigenic epitope.
Polypeptide and peptide variants include variants differing by the addition, deletion, or substitution of one or more amino acid residues. For example, to isolate biomarker polypeptides or peptides, it may be useful to encode a tagged biomarkerpeptide or polypeptide that can be recognized by a commercially available antibody. In particular, a peptide or polypeptide can be fused or linked to epitope tags (e.g., FLAG, HA, GST, thioredoxin, maltose binding protein, etc.), or affinity tags suchas biotin and/or streptavidin. As one example, a system for the ready purification of non-denatured fusion proteins expressed in human cell lines has been described by Janknecht et al., (1991, Proc. Natl. Acad. Sci. USA, 88:8972-8976). In thissystem, the gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is translationally fused to an amino-terminal tag having six histidine residues. The tag serves as a matrix-binding domain forthe fusion protein. Extracts from cells infected with the recombinant vaccinia virus are loaded onto an Ni.sup.2+ nitriloacetic acid-agarose column and histidine-tagged proteins are selectively eluted with imidazole-containing buffers.
A peptide or polypeptide tagged with an epitope or protein may also be engineered to contain a cleavage site located between the binder coding sequence and the tag coding sequence. This can be used to remove the tag, and isolate the biomarkerpeptide or polypeptide. The biomarker peptides or polypeptides of the invention can be covalently attached to chemical moieties via the amino acid backbone. For these purposes, the peptides or polypeptides may be modified by N- or C-terminal processingof the sequences (e.g., proteolytic processing), deletion of the N-terminal methionine residue, etc. The polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection andisolation of the protein, as described in detail herein.
Also included are modified polypeptides and peptides in which one or more residues are modified, and mutants comprising one or more modified residues. Amino acid variants of the invention can be generated by employing the techniques ofgene-shuffling, motif-shuffling, exon-shuffling, and/or codon-shuffling (collectively referred to as "DNA shuffling"). DNA shuffling can be employed to generate peptides or polypeptides with altered activity. See, generally, U.S. Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al., 1997, Curr. Opinion Biotechnol., 8:724-33; Harayama, 1998, Trends Biotechnol., 16(2):76-82; Hansson, et al., 1999, J. Mol. Biol., 287:265-76; and Lorenzo and Blasco, 1998,Biotechniques, 24(2):308-313, the contents of each of which are hereby incorporated by reference in its entirety.
In one embodiment of the invention, alteration of one or more of the biomarker polypeptide sequences as set forth in SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64 can be achieved by DNA shuffling. DNA shuffling involves theassembly of two or more DNA segments by homologous or site-specific recombination to generate variation in the protein-coding sequence. In another embodiment, the encoded peptides or polypeptides, may be altered by subjecting the coding sequences torandom mutapolynucleotides and polypeptidesis by error-prone PCR, random nucleotide insertion, or other methods, prior to recombination. In another embodiment, one or more components, motifs, sections, parts, domains, fragments, etc., of apolynucleotide encoding a peptide or polypeptide of this invention may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
The peptides and polypeptides may be differentially modified during or after translation, e.g., by derivatization with known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Usefulmodifications may include glycosylation, amidation, phosphorylation, sulfation, reduction/alkylation (Tarr, 1986, Methods of Protein Microcharacterization, J. E. Silver, Ed., Humana Press, Clifton, N.J., pp. 155-194); acylation (Tarr, supra); chemicalcoupling (Mishell and Shiigi (Eds), 1980, Selected Methods in Cellular Immunology, W H Freeman, San Francisco, Calif.; U.S. Pat. No. 4,939,239); and mild formalin treatment (Marsh, 1971, Int. Arch. of Allergy and Appl. Immunol. 41:199-215). Any ofnumerous chemical modifications may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4; acetylation, formylation, oxidation, reduction;metabolic synthesis in the presence of tunicamycin; etc. Additional post-translational modifications encompassed by the invention include, for example, e.g., attachment of N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminalends, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression.
Additionally, D-amino acids, non-natural amino acids, or non-amino acid analogs can be substituted or added to produce a modified polypeptide. Furthermore, the polypeptides disclosed herein can be modified using polyethylene glycol (PEG)according to known methods (S. I. Wie et al., 1981, Int. Arch. Allergy Appl. Immunol. 64(1):84-99) to produce a protein conjugated with PEG. In addition, PEG can be added during chemical synthesis of the protein. Modifications or sequencevariations may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or morecontiguous groups within the reference sequence. The polypeptides and peptides of this invention can be isolated, synthetic, or recombinant. The amino acid sequences may be obtained as individual polypeptides or peptides, or part of a complex.
Polypeptides or peptides may also be modified with a label capable of providing a detectable signal, either directly or indirectly, including, but not limited to, radioisotope, fluorescent, and enzyme labels. Fluorescent labels include, forexample, Coumarin (e.g., Hydroxycoumarin, Aminocoumarin, Methoxycoumarin), R-Phycoerythrin (PE), Fluorescein, FITC, Fluor X, DTAF, Auramine, Alexa (e.g., Alexa Fluor.RTM. 350, -430, -488, -532, -546, -555, -568, -594, -633, -647, -660, -680, -700,-750), BODIPY-FL, Sulforhodamine (e.g., Texas Red.RTM.), Carbocyanine (e.g., Cy2, Cy.TM.3, Cy3.5, Cy.TM.5, Cy5.5, Cy7), Rhodamine, XRITC, TRITC, Lissamine Rhodamine B, Peridinin Chlorphyll Protein (PerCP), Allophycocyanin (APC), PE-Cy5 conjugates (e.g.,Cychrome, Tri-Color.RTM., Quantum Red.RTM.), PE-Cy5.5 conjugates, PE-Cy7 conjugates, PE-Texas Red conjugates (e.g., Red613), PC5-PE-Cy5 conjugates, PerCP-Cy5.5 conjugates (e.g., TruRed), APC-Cy5.5 conjugates, APC-Cy7 conjugates, ECD-PE-Texas Redconjugates, Sulfonated Pyrene (e.g., Cascade Blue), AMCA Blue, Lucifer Yellow.
Preferred isotope labels include .sup.3H, .sup.14C, 32P, .sup.35S, .sup.36Cl, .sup.51Cr, .sup.57Co, .sup.58Co, .sup.59Fe, .sup.90Y, .sup.125I, .sup.131I, and .sup.186Re. Preferred enzyme labels include peroxidase, .beta.-glucuronidase,.beta.-D-glucosidase, .beta.-D-galactosidase, urease, glucose oxidase plus peroxidase, and alkaline phosphatase (see, e.g., U.S. Pat. Nos. 3,654,090; 3,850,752 and 4,016,043). Enzymes can be conjugated by reaction with bridging molecules such ascarbodiimides, diisocyanates, glutaraldehyde, and the like. Enzyme labels can be detected visually, or measured by calorimetric, spectrophotometric, fluorospectrophotometric, amperometric, or gasometric techniques. Other labeling systems, such asavidin/biotin, colloidal gold (e.g., NANOGOLD.RTM.), Tyramide Signal Amplification (TSA.TM.), are known in the art, and are commercially available (see, e.g., ABC kit, Vector Laboratories, Inc., Burlingame, Calif.; NEN.RTM. Life Science Products, Inc.,Boston, Mass.; Nanoprobes, Inc., 95 Horse Block Road, Yaphank, N.Y.).
Biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), peptides, and fragments, variants, and derivatives thereof) may be produced by direct peptide synthesis using solid-phase techniques (J. Merrifield,1963, J. Am. Chem. Soc., 85:2149-2154; J. Y. Roberge et al., 1995, Science, 269:202-204). Protein or peptide synthesis may be performed using manual techniques or by automation. Automated synthesis may be achieved, for example, using ABI 431A PeptideSynthesizer (PE Biosystems). Various fragments of a biomarker polypeptide or peptide can be chemically synthesized separately and then combined using chemical methods to produce the full-length molecule. The newly synthesized peptide can besubstantially purified by preparative high performance liquid chromatography (e.g., T. Creighton, 1983, Proteins, Structures and Molecular Principles, W. H. Freeman and Co., New York, N.Y.), by reversed-phase high performance liquid chromatography, orother purification methods as are known in the art. The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; Creighton, supra). In addition, the amino acid sequence ofbiomarker peptide or polypeptide or any portion thereof, may be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins, or any part thereof, to produce a variant peptide or polypeptide.
In Vitro Validation
It was previously hypothesized that existing pre-clinical in vitro models could be employed to identify molecules that could subsequently be used to predict the likelihood of hepatotoxicity (Fabre, G.; Combalbert, J.; Berger, Y.; Cano, J. P.,1990, Eur. J. Drug Metab. Pharmacokinet. 15:165-171). Such molecules could be assayed using traditional immunological assays, and thereafter be incorporated in a standard protocol for compound evaluation prior to entering the clinical testing. Thus,the goal of the disclosed experiments was to obtain protein biomarkers that showed altered levels in an in vitro hepatocyte system in response to hepatotoxic drugs.
As shown herein, a set of biomarker polypeptides was successfully identified using proteomics, i.e., multidimensional separations coupled to tandem mass spectrometry, and subsequent immunological in vitro assays. The disclosed resultsdemonstrate that levels of biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15), including BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ ID NO:2), can be used to correctly predict in vivo hepatotoxicity. The biomarkers of the invention are usefulfor predicting toxicity of a test substance prior or subsequent to clinical trials. In addition, the disclosed assay systems can be employed with relatively low costs and ease of use, and can be routinely utilized for pre- or post-clinical evaluationsof chemical entities.
There were some differences in the results observed for BMS-PTX-265 and BMS-PTX-837, suggesting that each biomarker may involve separate mechanisms. Yet, BMS-PTX-265 and BMS-PTX-837 were used to correctly predict 18 of the 19 toxicity responsesin experiments employing a single dose (50 .mu.M; perhexelene at 20 .mu.M), and a single time point (20 hr). The assays of the invention thereby provide the basis for a very simple and robust analytical system that can greatly aid the evaluation of pre-or post-clinical compounds.
The characteristics of BMS-PTX-265 and BMS-PTX-837 make them ideal biomarkers for use in in vitro experiments for predicting in vivo toxicity. The observations made for BMS-PTX-265 indicate that it may be the more sensitive of the twobiomarkers, based on the qualified toxic classification of Dantrolene and the larger overall difference between the two classes of compounds. The BMS-PTX-837 biomarker appeared less sensitive, but was also less variable, based on the compressed dynamicrange of its results. Both BMS-PTX-265 and BMS-PTX-837 proteins are small and soluble; they both lack significant hydrophobicity, and possess substantial immunogenicity and specificity in the disclosed assays.
While not wishing to be bound by theory, it is possible that both BMS-PTX-265 and BMS-PTX-837 proteins are leaked from the cells upon treatment, and are not actively induced or secreted. For example, cells may undergo a drug-inducedmorphological change as observed in the case of carcinoembryonic antigen (Babia, T.; Veldman, R. J.; Hoekstra, D.; Kok, J. W., 1998, Eur. J. Biochem. 258:233-242) or aspartate aminotransferase (Pappas, N. J., Jr., 1986, Clin. Chim. Acta 154:181-189). Notably, biomarkers that exhibit a more general response would have certain advantages for the screening of compounds in a pre- or post-clinical candidate optimization setting where a wide variety of compound classes are routinely observed.
The proteomics technology platform disclosed herein provides a practical means for surveying a complex mixture of proteins to identify biomarker candidates and measure relative changes in their abundance. The immunoassays used for verification(see above) demonstrate the validity of the semi-quantitative LC/LC/MS/MS approach. As a result, future experiments can rely on LC/LC/MS/MS data alone, and only progress to immunoassays when large numbers of samples are ready for testing. In futureexperiments, it may also be useful to vary the criteria for selecting candidate biomarkers from the LC/LC/MS/MS data for further evaluation. The disclosed experiments evaluated candidate biomarkers based on several factors, including the filters ofPearson product-moment correlation coefficient, the data set template, commercial availability of antibodies, and correspondence to peer-reviewed literature. It would also be possible to pursue only biomarkers showing the most sensitivity, i.e., thosewith the largest relative change between toxic and non-toxic treatments.
In Vivo Validation
Two of the hepatotoxicity biomarkers of the present invention, BMS-PTX-265 (FIG. 4A; SEQ ID NO:1) and BMS-PTX-837 (FIG. 4B; SEQ ID NO:2), were analyzed to confirm that they could be used in pre-clinical species as `bridging` biomarkers of livertoxicity.
The levels of BMS-PTX-265 (FIG. 4A; SEQ ID NO:1) and BMS-PTX-837 (FIG. 4B; SEQ ID NO:2) were examined in considerable detail following hepatocyte exposure to multiple classes of toxic compounds (Gao et al. In press), some of which are describedherein. The experiments were designed to evaluate these two proteins for their ability to detect drug induced hepatotoxic effects in mice, rats and dogs.
Rodent and canine models of toxicity are routinely and extensively used by the pharmaceutical industry for new drug safety evaluation. Therefore, the serum from mice, rats, and dogs treated with toxic doses of different classes of compounds wereexamine for the presence of BMS-PTX-265 (FIG. 4A; SEQ ID NO:1) and BMS-PTX-837 (FIG. 4B; SEQ ID NO:2).
Animals were administered either an immunomodulatory molecule (biologic, Compound A) or an exploratory cell cycle inhibitor (small molecule, Compound B). These drugs were selected on the basis that high doses of each were known to inducemultiple organ toxicity, including liver, for which the markers were initially identified.
Quantification of relative serum levels of the mouse orthologue of BMS-PTX-265 (also referred to as 14-3-3 ZETA; SEQ ID NO:61) in mice exposed to compound A for four weeks showed an overall increase when compared to pre-dose concentrations (FIG.10 panels A and B). At the lower 10 mg/kg dose, five of eight animals had elevated mouse BMS-PTX-265 (see FIG. 10A) while all eight mice exposed to the higher 50 mg/kg dose had increased serum levels (see FIG. 10B). Of the three animals not exhibitinghigher levels after 10 mg/kg treatment, two remained constant (FIG. 10A; M2201, M2203) and one demonstrated decreased levels (FIG. 10A; M2202). The overall increase in mouse BMS-PTX-265 in the 50 mg/kg ranged from 75% (FIG. 10B; M3101) to greater than3800% (FIG. 10B; M3102).
Analyses of the mouse orthologue of BMS-PTX-837 (also referred to as MIF; SEQ ID NO:62) levels in aliquots of the same samples as the mouse BMS-PTX-265 samples above gave a less definitive dose-response (FIG. 10 panels C and D). At the low 10mg/kg dose, four had increased mouse BMS-PTX-837 concentrations (FIG. 10C; M2101, M2102, M2104, M2204) and three were decreased after treatment (FIG. 10C; M2201, M2202, M2203). Exposure to the higher 50 mg/kg levels of Compound A resulted in decreasedmouse BMS-PTX-837 for one animal (FIG. 10D; M3103), minimal or no change for three animals (FIG. 10D; M3101, M3102, M3104) and increased levels for three mice (FIG. 10D; M3201, M3202, M3203). The magnitude of change was also not as dramatic for themouse BMS-PTX-837 as for the mouse BMS-PTX-265 (compare FIG. 10 panels A and B vs. panels C and D).
Treatment of rats with Compound B at an acutely toxic dose of 22 mg/kg also caused an elevation in serum levels of both of the rat orthologues of BMS-PTX-265 (SEQ ID NO:63) and BMS-PTX-837 (SEQ ID NO:64) as shown in FIG. 11. BMS-PTX-265 wasalready significantly increased by eight hours post exposure and remained high through 16 hours, after which levels fell to roughly those of vehicle (FIG. 11A). Serum levels of the rat BMS-PTX-837 also showed an early increase followed by a tapering offto levels lower than control by 24 hours (FIG. 11B). In contrast to the rat BMS-PTX-265, the rat BMS-PTX-837 appeared to have a more gradual induction or release into the serum (compare FIGS. 11A and B at 8 and 16 hours). However, both reachapproximately the same relative level of 400% versus either pre-dose or vehicle at 16 hours.
A corresponding study in dogs with Compound B also produced a marked effect on serum levels of the canine BMS-PTX-265. A dramatic increase in canine BMS-PTX-265 was observed following acute toxin exposure (FIG. 12). Both animals hadsubstantially elevated canine BMS-PTX-265 at the eight hour conclusion of the study. This rise began, in both cases, between four and five hours post-treatment. Canine BMS-PTX-265 increased approximately 1600% (FIG. 12A) or 3200% (FIG. 12B) overpre-dose levels and outpaced both of the traditional toxicity markers ALT (FIGS. 12A and B inset) and AST. The canine BMS-PTX-837 was unable to be evaluated in the canine model due to the fact that neither the anti-human nor anti-rodent reagents crossreacted with the dog samples. Additionally, since the sequence of the canine BMS-PTX-837 has yet to be determined in dogs, custom antibodies were not able to be generated.
Nonetheless, a wild type recombinant human BMS-PTX-265 was successfully created and isolated for use as a quantification standard. Corresponding chromatograms (FIG. 13) from cell lysates of E. coli transformed with vector alone (A) or a fulllength recombinant human BMS-PTX-265 expression construct (B) show marked differences. Comparison of the HPLC traces revealed a prominent peak specific to the human BMS-PTX-265 expressing cells (FIG. 13B arrow). This fraction was isolated and comparedto the parallel fraction from vector control cells by Western blot. A single strongly immunoreactive band of the predicted molecular weight (28 kDa) was detected in the human BMS-PTX-265 expressing cells (FIG. 13B inset), while no bands were detectablein the vector control lysates. The immunoreactive fraction was estimated to be greater than 90% pure based on subsequent HPLC analyses (data not shown). This purified standard was then used in the development of a human BMS-PTX-265 ELISA.
Human BMS-PTX-265 (SEQ ID NO:1) was readily detectable in human plasma by both Western blot and ELISA. Matching aliquots of frozen reference samples were tested by each method to cross validate the assays. There was an excellent correlation(FIG. 14) between relative human BMS-PTX-265 levels as measured by Western and ELISA. The values not only closely tracked, but did so over a broad range (>30 fold). The range of circulating plasma levels of human BMS-PTX-265 and human BMS-PTX-837(SEQ ID NO:2) that we have been able to detect in human volunteers using commercially available recombinant human BMS-PTX-837 and the recombinant human BMS-PTX-265, described herein, as standards are shown in FIG. 15.
The results demonstrated consistent and reproducible associations between levels of two serum proteins, BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ ID NO:2), and drug induced toxicity in three pre-clinical animal models. These proteins arequite different in structure (Yaffe., FEBS 513(1):53-7 (2002); Bernhagen et al., J. Mol. Med. 76, 151-161 (1998)) and presumed function (Tzivion and Avruch. JBC 277(Gao et al. In press):3061-4 (2002); Lue et al, Microbes and Infection. 4, 449-460(2002)). BMS-PTX-265 (also referred to as 14-3-3 ZETA) is an individual isoform of a family of conserved proteins with multiple functions including signal transduction, cell cycle regulation and stress response (Tzivion and Avruch. JBC 277 (Gao et al.In press):3061-4 (2002); Takahashi, Neurochemical Research 8, 1265-1273 (2003)). Specificity of response can be achieved by expression of particular combinations of isoforms (Aitken et al, Biochem Soc Trans. 4, Streiner and Norman., Health MeasurementScales: A practical Guide to Their Development and Use (Oxford University Press, Oxford, 1995)51-60 (2002)). While other family members have been described in cerebrospinal fluid as indicators of Creutzfeld-Jacobs disease (Green et al., Neuroscienceletters. 324, 57-60 (2002); Green, Neuropathology and Applied Neurobiology. 28, 427-440 (2002)), BMS-PTX-265 has not been identified in mammalian extracellular fluid.
BMS-PTX-837 (also referred to as MIF) is a cytokine that is expressed by both immune and non-immune cells (Calandra et al., Critical Reviews in Immunology. 17, 77-88 (1997)). It has both tautomerase and oxidoreductase activity and regulatesmacrophages and lymhpocytes (reviewed in Tzivion and Avruch. JBC 277 (Gao et al. In press):3061-4 (2002)). BMS-PTX-837 has also been implicated in chronic inflammation and endotoxic shock (Bernhagen et al., Nature 365, 756-759 (1993); Donnelly andBucala., Mol. Med. Today. 3, 502-507 (1998)). It has further been shown to play a role in halothane induced liver toxicity in rodents (Willuweit et al. J. Immunol. 3944-3952 (2001)) and to be readily detectable in mammalian serum (Bourdi et al. BBRC. 294, 225-230 (2002)). In our models, both BMS-PTX-265 and BMS-PTX-837 were consistently up-regulated in animal serum following acute toxin exposure. These models represented not only different animal systems, but compounds with quite differentstructures, modes of operation and targets.
The mouse model represents chronic, intermittent toxin exposure and produced BMS-PTX-265 serum levels that varied from animal to animal, but showed a dose dependent increase with 100% of animals having levels elevated by at least 50% in the 50mg/kg dose group. In contrast, 62.5% of the mice in the 10 mg/kg group had elevated BMS-PTX-265. On the other hand, BMS-PTX-837 did not show a consistent increase after either high or low exposure. These proteins were identified as acute toxicitymarkers in vitro, and the mouse data are consistent with a more acute response in vivo. Transiently elevated BMS-PTX-265 could result from the more recent dosing, while BMS-PTX-837 no longer responds. Long term repeated exposure might also account forthe high degree of inter-animal variability since, even with an inbred strain, small variations in acute response early on may be magnified over the course of eight successive rounds of toxin exposure.
Data from our rat model system using a different class of compound (Compound B) provides further evidence that BMS-PTX-265 and BMS-PTX-837 may be acute markers of toxicity. In these experiments (FIG. 11) animals were given a single dose andserum measured at eight hour intervals out to 32 hours. Both biomarkers showed an early increase, followed by a decrease to below control levels by 24 hours, and remained low at 32 hours. BMS-PTX-265 was already maximally elevated by eight hours andremained high through 16 hours, while BMS-PTX-837 was increased at eight hours but continued to rise to a maximum at 16 hours. These data indicate that while both BMS-PTX-265 and BMS-PTX-837 are effective acute markers of toxicity, they likely workthrough different mechanisms, and therefore, in combination may detect a broader range of toxins than either alone.
This acute response of BMS-PTX-265 after high Compound B inhibitor exposure was further explored using a dog model. The magnitude of increase was additionally compared to two traditional markers of toxicity, AST and ALT. BMS-PTX-265 was clearlyelevated after five hours and continued to climb dramatically to eight hours (FIG. 12). A similar pattern occurred with ALT and AST, but to a lesser degree. While BMS-PTX-265 increased to 1600 or 3200% of pre-treatment levels, AST rose 1400 or 1500%and ALT increased less than 100% (FIGS. 12A and B respectively). The animal studies, taken in toto, demonstrate these markers of in vitro toxicity to be effective serum biomarkers of acute toxicity in vivo.
A fundamental, and often overlooked, consideration in the development of new protein markers is the generation of consistent and quantifiable standards. This is of even more importance if the same potential markers are to be used to bridge thegap from in vitro cell based assays to examination of in vivo biological samples. Full length BMS-PTX-837 is currently commercially available, however, no such reagents were previously available for BMS-PTX-265 analyses. To address this need wegenerated and purified full length, recombinant, immunoreactive BMS-PTX-265 (FIG. 13). This allowed us to produce an unlimited supply of pure (>90%) protein to standardize our high throughput assays. This, in combination with our in-housedevelopment of accurate and sensitive ELISAs for both BMS-PTX-265 and BMS-PTX-837, has opened the door for large scale screening. Ultimately, these standards will be of clinical value when used to define patient thresholds for toxin exposure.
An examination of human plasma samples for the presence and quantification of both biomarkers using reference samples collected by Biological Specialties Inc has been initiated. In addition to sensitivity (FIG. 15), and consistency betweendifferent methods of detection (FIG. 14), these markers have several other positive advantages that make them well suited for examination of clinical samples. Minimal sample volume (10 .mu.l) is required, no enzymatic or time course measurements areneeded, and rapid reproducible results are obtained using standard ELISA techniques. These properties imply that BMS-PTX-265 and BMS-PTX-837 could be of immense value as early predictors of human toxic responses. Since small volumes are required,running conventional assays in conjunction with BMS-PTX-265 and/or BMS-PTX-837 would be practical. Long term stability enables accurate evaluation of archival samples, and the simple detection method should allow any laboratory with standard ELISAcapability to generate consistent results. In addition, combining the ease of measurement with rigorous standards will allow analogous data to be generated between laboratories. The inventors have clearly demonstrated the utility of measuring bothbiomarkers in human samples to identify compounds that are subject to inducing toxicity, and in particular, liver toxicity, both in vitro, and in vivo.
The discovery of toxicity biomarkers that are able to bridge the gaps from in vitro screening to pre-clinical animal studies to human trials may ultimately impact how candidates are evaluated throughout the drug development pipeline. Usingvalidated, common tools from in vitro discovery screening platforms, through clinical trials, and potentially beyond into post-marketing studies permits a cross-correlation of data not currently available. The progression of two such markers, identifiedherein as indicators of toxicity in vitro, through in vivo animal model testing has been demonstrated sufficiently to validate their efficacy in vivo, and in particular their use in tracking toxicity by following their presence in human plasma.
Antibodies
The present invention encompasses antibodies directed to biomarker peptides or polypeptides comprising, or alternatively, consisting of, an epitope of one of the polypeptides set forth in FIGS. 4A-4B, FIGS. 7A-7C, and FIGS. 16A-D which can beused to predict in vivo hepatotoxicity, e.g., idiosyncratic hepatotoxicity. Antibodies directed against the biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) or peptides of the present invention, or antigenic orimmunogenic epitopes thereof, include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library,anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), intracellularly made antibodies (i.e., intrabodies), and epitope-binding fragments of any of the above. Immunoglobulins may have both a heavy and alight chain. An array of IgG, IgE, IgM, IgD, IgA, and IgY heavy chains can be paired with a light chain of the kappa or lambda types.
Most preferably, the antibodies of the present invention are human antigen-binding antibodies and antibody fragments and include, but are not limited to, Fab, Fab' F.(ab') 2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linkedFvs (sdFv) and fragments comprising either a V.sub.L or V.sub.H domain. Antigen-binding antibody fragments, including single-chain antibodies, can comprise the variable region(s) alone or in combination with the entirety or a portion of the following:hinge region, and CH1, CH2, and CH3 domains. Also included in connection with the invention are antigen-binding fragments also comprising any combination of variable region(s) with a hinge region, and CH1, CH2, and CH3 domains. Antibodies of thepresent invention can be described or specified in terms of the epitope(s) or portion(s) of the biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) or peptides of the present invention which they recognize orspecifically bind. The epitope(s) or polypeptide portion(s) can be specified, e.g., by N-terminal and C-terminal positions, by size in contiguous amino acid residues, or as presented in the sequences defined in FIGS. 4A-4B, FIGS. 7A-7C, and FIGS. 16A-D.
The antibodies of the invention may be from any animal origin including birds and mammals. Preferably, the antibodies are of human, murine (e.g., mouse and rat), donkey, sheep, rabbit, goat, guinea pig, camel, horse, or chicken origin. Theantibodies of the present invention can be monospecific, bispecific, trispecific, or of greater multispecificity. Multispecific antibodies can be specific for different epitopes of a polypeptide of the present invention, or can be specific for both apolypeptide of the present invention, and a heterologous epitope, such as a heterologous polypeptide or solid support material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt et al., 1991, J. Immunol., 147:60-69;U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; and Kostelny et al., 1992, J. Immunol., 148:1547-1553.
Various procedures known in the art may be used for the production of such antibodies and antibody fragments. Antibodies generated against the polypeptides or peptides corresponding to one or more of the biomarker sequences of the presentinvention can be obtained by direct injection of the polypeptides or peptides into an animal, or by administering the polypeptides or peptides to an animal, preferably a nonhuman animal. For the preparation of monoclonal antibodies, any technique thatprovides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983,Immunol. Today, 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985. In: Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Techniques described for the production of single chainantibodies (U.S. Pat. No. 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to express humanized antibodies to immunogenic polypeptide products of thisinvention.
Either the full-length protein or an antigenic peptide fragment can be used to produce antibodies. Antibodies are preferably prepared from these regions or from discrete fragments in regions of the biomarker amino acid sequences comprising anepitope. Antibodies can also be prepared from any region of the biomarker polypeptides and peptides, as described herein. A preferred fragment generates the production of an antibody that specifically recognizes a biomarker peptide or polypeptide. Inaddition, antibodies can be developed against an entire polypeptide or domains of the polypeptide. Antibodies can also be developed against specific functional sites, such as the sites that are glycosylated, phosphorylated, myristylated, or amidated,for example.
Polypeptide or peptide fragments that function as epitopes may be produced by any conventional means (see, e.g., Houghten, 1985, Proc. Natl. Acad. Sci. USA, 82:5131-5135; and as described in U.S. Pat. No. 4,631,211). In the presentinvention, antigenic epitopes preferably contain a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25,at least 30, at least 40, at least 50, and, most preferably, between about 15 to about 30 amino acids. Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90,95, or 100 amino acid residues in length. Additional non-exclusive preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as portions thereof, as well as any combination of two, three, four, five or more of these antigenicepitopes.
Antigenic epitopes are useful, for example, to raise antibodies, including monoclonal antibodies, that specifically bind the epitope. In addition, antigenic epitopes can be used as the target molecules in immunoassays (see, for instance, Wilsonet al., 1984, Cell, 37:767-778; and Sutcliffe et al., 1983, Science, 219:660-666). Such fragments as described herein are not to be construed, however, as encompassing any fragments that may be disclosed prior to the invention. Similarly, immunogenicepitopes can be used, for example, to induce antibodies according to methods well known in the art (see, for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow et al., 1985, Proc. Natl. Acad. Sci. USA, 82:910-914; and Bittle et al., 1985,J. Gen. Virol. 66:2347-2354). Preferred immunogenic epitopes include the immunogenic epitopes disclosed herein, as well as any combination of two, three, four, five or more of these immunogenic epitopes.
Biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) or peptides comprising one or more immunogenic epitopes that elicit an antibody response can be introduction together with a carrier protein, such as analbumin, to an animal system (such as rabbit or mouse). Alternatively, if the peptide or polypeptide is of sufficient length (e.g., at least about 25 amino acids), the amino acid sequence can be presented without a carrier. However, immunogenicepitopes comprising as few as 5 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in Western blotting).
Epitope-bearing polypeptides of the present invention may be used to induce antibodies according to methods well known in the art including, but not limited to, in vivo immunization, in vitro immunization, and phage display methods (see, e.g.,Sutcliffe et al., supra; Wilson et al., supra; and Bittle et al., supra). If in vivo immunization is used, animals can be immunized with free peptide; however, the anti-peptide antibody titer may be boosted by coupling the peptide to a macromolecularcarrier, such as keyhole limpet hemacyanin (KLH), or tetanus toxoid (TT). For instance, peptides containing cysteine residues can be coupled to a carrier using a linker such as maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides maybe coupled to carriers using a more general linking agent, such as glutaraldehyde.
Epitope bearing peptides of the invention may also be synthesized as multiple antigen peptides (MAPs), first described by J. P. Tam et al., 1995, Biomed. Pept, Proteins, Nucleic Acids, 199, 1(3):123-32; and Calvo, et al., 1993, J. Immunol.,150(4):1403-12), which are hereby incorporated by reference in their entirety herein. MAPs contain multiple copies of a specific peptide attached to a non-immunogenic lysine core. MAP peptides usually contain four or eight copies of the peptide, whichare often referred to as MAP4 or MAP8 peptides. By way of non-limiting example, MAPs can be synthesized onto a lysine core matrix attached to a polyethylene glycol-polystyrene (PEG-PS) support. The peptide of interest is synthesized onto the lysineresidues using 9-fluorenylmethoxycarbonyl (Fmoc) chemistry. For example, Applied Biosystems (Foster City, Calif.) offers commercially available MAP resins, such as, for example, the Fmoc Resin 4 Branch and the Fmoc Resin 8 Branch, which can be used tosynthesize MAPs. Cleavage of MAPs from the resin is performed with standard trifloroacetic acid (TFA)-based cocktails known in the art. Purification of MAPs, except for desalting, is not generally necessary. MAP peptides can be used in immunizingvaccines which elicit antibodies that recognize both the MAP and the native protein from which the peptide was derived.
Epitope-bearing peptides of the invention can also be incorporated into a coat protein of a virus, which can then be used as an immunogen or a vaccine with which to immunize animals, including humans, in order stimulate the production ofanti-epitope antibodies. For example, the V3 loop of the gp120 glycoprotein of the human immunodeficiency virus type 1 (HIV-1) has been engineered to be expressed on the surface of rhinovirus. Immunization with rhinovirus displaying the V3 loop peptideyielded apparently effective mimics of the HIV-1 immunogens (as measured by their ability to be neutralized by anti-HIV-1 antibodies as well as by their ability to elicit the production of antibodies capable of neutralizing HIV-1 in cell culture). Thistechniques of using engineered viral particles as immunogens is described in more detail in Smith et al., 1997, Behring Inst Mitt Feb, (98):229-39; Smith et al., 1998, J. Virol., 72:651-659; and Zhang et al., 1999, Biol. Chem., 380:365-74), which arehereby incorporated by reference herein in their entireties.
Epitope bearing polypeptides of the invention can be modified, for example, by the addition of amino acids at the amino- and/or carboxy-terminus of the peptide. Such modifications are performed, for example, to alter the conformation of theepitope bearing polypeptide such that the epitope will have a conformation more closely related to the structure of the epitope in the native protein. An example of a modified epitope-bearing polypeptide of the invention is a polypeptide in which one ormore cysteine residues have been added to the polypeptide to allow for the formation of a disulfide bond between two cysteines, thus resulting in a stable loop structure of the epitope-bearing polypeptide under non-reducing conditions. Disulfide bondscan form between a cysteine residue added to the polypeptide and a cysteine residue of the naturally-occurring epitope, or between two cysteines which have both been added to the naturally-occurring epitope-bearing polypeptide.
In addition, it is possible to modify one or more amino acid residues of the naturally-occurring epitope-bearing polypeptide by substitution with cysteines to promote the formation of disulfide bonded loop structures. Cyclic thioether moleculesof synthetic peptides can be routinely generated using techniques known in the art, e.g., as described in PCT publication WO 97/46251, incorporated in its entirety by reference herein. Other modifications of epitope-bearing polypeptides contemplated bythis invention include biotinylation.
As one having skill in the art will appreciate, and as discussed above, the biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) or peptides can be fused to other amino acid sequences. For example, thepolypeptides of the present invention can be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgD, or IgM), or portions thereof, e.g., CH1, CH2, CH3, or any combination thereof, and portions thereof, or with albumin (including, but notlimited to, recombinant human albumin, or fragments or variants thereof (see, e.g., U.S. Pat. No. 5,876,969; EP Patent No. 0 413 622; and U.S. Pat. No. 5,766,883, incorporated by reference in their entirety herein), thereby resulting in chimericpolypeptides. Such fusion proteins may facilitate purification and may increase half-life in vivo. This has been shown for chimeric proteins containing the first two domains of the human CD4-polypeptide and various domains of the constant regions ofthe heavy or light chains of mammalian immunoglobulins. See, e.g., Traunecker et al., 1988, Nature, 331:84-86.
Enhanced delivery of an antigen across the epithelial barrier to the immune system has been demonstrated for antigens (e.g., insulin) conjugated to an FcRn binding partner, such as IgG or Fc fragments (see, e.g., PCT Publications WO 96/22024 andWO 99/04813). IgG fusion proteins that have a disulfide-linked dimeric structure due to the IgG portion disulfide bonds have also been found to be more efficient in binding and neutralizing other molecules than are monomeric polypeptides, or fragmentsthereof, alone. See, e.g., Fountoulakis et al., 1995, J. Biochem., 270:3958-3964.
Another aspect of the present invention relates to antibodies and T-cell antigen receptors (TCRs), which immunospecifically bind to a biomarker polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), peptide, or variantof the present invention as determined by immunoassays well known in the art for assaying specific antibody-antigen binding. Also related are bispecific or bifunctional antibodies, which have two different heavy/light chain pairs and two differentbinding sites. Bispecific antibodies can be produced by a variety of methods, including fusion of hybridomas or linking of Fab' fragments (see, e.g., Songsivilai & Lachmann, 1990, Clin. Exp. Immunol., 79:315-321; Kostelny et al., 1992, J. Immunol.,148:1547 1553). In addition, bispecific antibodies can be formed as "diabodies" (see, Holliger et al., 1993, Proc. Natl. Acad. Sci. USA, 90:6444-6448), or "Janusins" (see, Traunecker et al., 1991, EMBO J., 10:3655-3659 and Traunecker et al., 1992,Int. J. Cancer Suppl. 7:51-52-127).
The antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) can bind immunospecifically to a polypeptide or polypeptide fragment or variant of a human biomarkerpolypeptide as set forth in SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64. By way of non-limiting example, an antibody can be considered to bind to a first antigen preferentially if it binds to the first antigen with a dissociationconstant (Kd) that is less than the antibody's Kd for the second antigen. In another non-limiting embodiment, an antibody can be considered to bind to a first antigen preferentially if it binds to the first antigen with an affinity that is at least oneorder of magnitude less than the antibody's Ka for the second antigen. In another non-limiting embodiment, an antibody can be considered to bind to a first antigen preferentially if it binds to the first antigen with an affinity that is at least twoorders of magnitude less than the antibody's Kd for the second antigen.
In another nonlimiting embodiment, an antibody may be considered to bind to a first antigen preferentially if it binds to the first antigen with an off rate (koff) that is less than the antibody's koff for the second antigen. In anothernonlimiting embodiment, an antibody can be considered to bind to a first antigen preferentially if it binds to the first antigen with an affinity that is at least one order of magnitude less than the antibody's koff for the second antigen. In anothernonlimiting embodiment, an antibody can be considered to bind to a first antigen preferentially if it binds to the first antigen with an affinity that is at least two orders of magnitude less than the antibody's koff for the second antigen.
Production of Antibodies
The antibodies of the present invention may be generated by any suitable method known in the art. Polyclonal antibodies directed against an antigen or immunogen of interest can be produced by various procedures. For example, a biomarkerpolypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) or peptide of the invention can be administered to various host animals as elucidated above to induce the production of sera containing polyclonal antibodies specific forthe antigen. For the production of antibodies in vivo, host animals, such as rabbits, rats, mice, sheep, or goats, can immunized with either free or carrier-coupled peptides or MAP peptides, for example, by intraperitoneal and/or intradermal injection. Injection material is typically an emulsion containing about 100 .mu.g of peptide or carrier protein and Freund's adjuvant, or any other adjuvant known for stimulating an immune response.
Various adjuvants may be used depending on the host species, including but not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions,peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum. Such adjuvants are also well known in the art. Several booster injections maybe needed, for instance, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free polypeptide or peptide adsorbed to a solid surface. The titer of anti-biomarkerantibodies in serum from an immunized animal can be increased by selection of anti-biomarker antibodies, e.g., by adsorption of the biomarker polypeptide or peptide onto a solid support and elution of the selected antibodies according to methods wellknown in the art.
Monoclonal antibodies can be prepared using a wide variety of techniques known in the art, including the use of hybridoma, recombinant and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be producedusing hybridoma techniques as known and practiced in the art and as taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd Ed. 1988; Hammerling, et al., In: Monoclonal Antibodies and T-CellHybridomas, Elsevier, N.Y., pages 563-681, 1981, the contents of which are incorporated herein by reference in their entireties. Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in theart.
In a nonlimiting example, mice can be immunized with a biomarker polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) or peptide of the invention, or with a cell expressing the polypeptide or peptide. Once an immuneresponse is detected, e.g., antibodies specific for the antigen are detected in the sera of immunized mice, the spleen is harvested and splenocytes are isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells, forexample cells from cell line SP2/0 or P3.times.63-AG8.653 available from the ATCC. Hybridomas are selected and cloned by limiting dilution techniques. The hybridoma clones are then assayed by methods known in the art to determine and select those cellsthat secrete antibodies capable of binding to a polypeptide of the invention. Ascites fluid, which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones.
Accordingly, the present invention encompasses methods of generating monoclonal antibodies, as well as the antibodies produced by these methods, comprising culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, thehybridoma is generated by fusing splenocytes isolated from a mouse immunized with a biomarker polypeptide or peptide antigen of the invention with myeloma cells and then screening the hybridomas resulting from the fusion for hybridoma clones that secretean antibody that binds to a polypeptide of the invention.
Another well known method for producing both polyclonal and monoclonal human B cell lines is transformation using Epstein Barr Virus (EBV). Protocols for generating EBV-transformed B cell lines are commonly known in the art, such as, forexample, the protocol outlined in Chapter 7.22 of Current Protocols in Immunology, Coligan et al., Eds., 1994, John Wiley & Sons, NY, which is hereby incorporated by reference herein in its entirety. The source of B cells for transformation is commonlyhuman peripheral blood, but B cells for transformation can also be obtained from other sources including, but not limited to, lymph node, tonsil, spleen, tumor tissue, and infected tissues. Tissues are generally prepared as single cell suspensions priorto EBV transformation. In addition, T cells that may be present in the B cell samples can be either physically removed or inactivated (e.g., by treatment with cyclosporin A). The removal of T cells is often advantageous, because T cells fromindividuals seropositive for anti-EBV antibodies can suppress B cell immortalization by EBV. In general, a sample containing human B cells is innoculated with EBV and cultured for 3-4 weeks. A typical source of EBV is the culture supernatant of theB95-8 cell line (ATCC; VR-1492). Physical signs of EBV transformation can generally be seen toward the end of the 3-4 week culture period.
By phase-contrast microscopy, transformed cells appear large, clear and "hairy"; they tend to aggregate in tight clusters of cells. Initially, EBV lines are generally polyclonal. However, over prolonged periods of cell culture, EBV lines canbecome monoclonal as a result of the selective outgrowth of particular B cell clones. Alternatively, polyclonal EBV transformed lines can be subcloned (e.g., by limiting dilution) or fused with a suitable fusion partner and plated at limiting dilutionto obtain monoclonal B cell lines. Suitable fusion partners for EBV transformed cell lines include mouse myeloma cell lines (e.g., SP2/0, X63-Ag8.653), heteromyeloma cell lines (human.times.mouse; e.g., SPAM-8, SBC-H20, and CB-F7), and human cell lines(e.g., GM 1500, SKO-007, RPMI 8226, and KR-4). Thus, the present invention also includes a method of generating polyclonal or monoclonal human antibodies against polypeptides of the invention or fragments thereof, comprising EBV-transformation of humanB cells.
Antibody fragments that recognize specific epitopes can be generated by known techniques. For example, Fab and F(ab')2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain(to produce Fab fragments) or pepsin (to produce F (ab')2 fragments). F(ab')2 fragments contain the variable region, the light chain constant region and the CH1 domain of the heavy chain.
Antibodies encompassed by the present invention can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles that carry thepolynucleotide sequences encoding them. In a particular embodiment, such phage can be utilized to display antigen-binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine). Phage expressing an antigen bindingdomain that binds to the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured onto a solid surface or bead. Phage used in these methods are typically filamentous phage including fd andM13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein.
Non-limiting examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al., 1995, J. Immunol. Methods, 182:41-50; Ames et al., 1995, J. Immunol. Methods,184:177-186; Kettleborough et al., 1994, Eur. J. Immunol., 24:952-958; Persic et al., 1997, Gene, 187:9-18; Burton et al., 1994, Advances in Immunology, 57:191-280; PCT application No. PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108, each of whichis incorporated herein by reference in its entirety.
As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, andexpressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below. For example, techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed usingmethods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et al., 1992, BioTechniques, 12(6):864-869; Sawai et al., 1995, AJRI, 34:2634; and Better et al., 1988, Science, 240:1041-1043, which are hereby incorporated byreference herein in their entireties.
Examples of techniques that can be used to produce single-chain Fvs and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al., 1991, Methods in Enzymology, 203:46-88; Shu et al., 1993, Proc. Natl. Acad. Sci. USA, 90:7995-7999; and Skerra et al., 1988, Science, 240:1038-1040. For some uses, including the in vivo use of antibodies in humans and in in vitro detection assays, it may be preferable to use chimeric, humanized, or human antibodies. Achimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies are known in the art. See, e.g., Morrison, 1985, Science, 229:1202; Oi et al., 1986, BioTechniques, 4:214; Gillies et al., 1989, J. Immunol. Methods, 125:191-202; and U.S. Pat. Nos. 5,807,715; 4,816,567; and4,816,397, which are incorporated herein by reference in their entirety.
Standard techniques known to those of skill in the art can be used to introduce mutations in the nucleotide sequence encoding a an antibody molecule of the invention, including, for example, site-directed mutapolynucleotides and polypeptidesisand PCR-mediated mutapolynucleotides and polypeptidesis which result in amino acid substitutions. Preferably the molecules are immunoglobulin molecules. Also, preferably, the variants (including derivatives) encode less than 50 amino acidsubstitutions, less than 40 amino acid substitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, lessthan 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions, relative to the reference V.sub.H domain, V.sub.H CDR1, V.sub.H CDR2, V.sub.H CDR3, V.sub.L domain,V.sub.L CDR1, V.sub.L CDR2, or V.sub.L CDR3.
Antibody variants may comprise one or more conservative amino acid substitutions, such that amino acid residues are replaced with residues having a side chains with a similar properties. Families of amino acid residues having side chains withsimilar properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine,asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromaticside chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutapolynucleotides and polypeptidesis. The resultant mutants can bescreened for biological activity to identify mutants that retain activity.
For example, it is possible to introduce mutations only in framework regions or only in CDR regions of an antibody molecule. Introduced mutations can be silent or neutral missense mutations, i.e., have no, or little, effect on an antibody'sability to bind antigen. These types of mutations can be useful to optimize codon usage, or to improve hybridoma antibody production. Alternatively, non-neutral missense mutations can alter an antibody's ability to bind antigen. The location of mostsilent and neutral missense mutations is likely to be in the framework regions, while the location of most non-neutral missense mutations is likely to be in the CDRs, although this is not an absolute requirement. One of skill in the art is able todesign and test mutant molecules with desired properties, such as no alteration in antigen binding activity or alteration in binding activity (e.g., improvements in antigen binding activity or change in antibody specificity). Followingmutapolynucleotides and polypeptidesis, the encoded protein may routinely be expressed and the functional and/or biological activity of the encoded protein can be determined using techniques described herein or by routinely modifying techniques known andpracticed in the art.
It is well known within the art that polypeptides, or fragments or variants thereof, with similar amino acid sequences often have similar structure and many of the same biological activities. Thus, in one embodiment, an antibody (including amolecule comprising, or alternatively consisting of, an antibody fragment or variant thereof), that immunospecifically binds to a biomarker polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) or fragments or variants of abiomarker polypeptide, comprises, or alternatively consists of, a V.sub.H domain having an amino acid sequence that is at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of a V.sub.H domain of a heavy chain expressed by an anti-biomarker polypeptide antibody-expressing cell line of the invention.
In another embodiment, an antibody, including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof, that immunospecifically binds to a biomarker polypeptide or fragments or variants of a biomarkerpolypeptide, comprises, or alternatively consists of, a V.sub.L domain having an amino acid sequence that is at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, atleast 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of a V.sub.L domain of a light chain expressed by an anti-biomarker polypeptide antibody-expressing cell line of the invention.
Antibodies of the invention may be chemically synthesized or produced through the use of recombinant expression systems. Accordingly, the invention further embraces polynucleotides comprising a nucleotide sequence encoding an antibody of theinvention and fragments thereof. The invention also encompasses polynucleotides that hybridize under stringent or lower stringency hybridization conditions, e.g., as defined supra, to polynucleotides that encode an antibody, preferably, an antibody thatspecifically binds to a polypeptide of the invention, preferably, an antibody that binds to a polypeptide having the amino acid sequence of one or more of the biomarker sequences as set forth in SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ IDNO:64.
If the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody can be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques, 17:242), which, briefly,involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, the annealing and ligating of those oligonucleotides, and then the amplification of the ligated oligonucleotides by PCR. Alternatively, apolynucleotide encoding an antibody can be generated from nucleic acid from a suitable source. For example, if the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin can be chemically synthesized or obtained from asuitable source, e.g., an antibody cDNA library, or a cDNA library generated from, or a nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of theinvention by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence. Alternatively, the sequence can be cloned using an oligonucleotide probe specific for the particular gene sequence to identify, for example, acDNA clone from a cDNA library. Amplified nucleic acids generated by PCR can then be cloned into replicable cloning vectors using any method well known in the art.
Once the nucleotide sequence and corresponding amino acid sequence of the antibody are determined, the nucleotide sequence of the antibody can be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g.,recombinant DNA techniques, site directed mutapolynucleotides and polypeptidesis, PCR, etc. to generate antibodies having a different amino acid sequence, for example, to create amino acid substitutions, deletions, and/or insertions. See, for example,the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY,which are both incorporated by reference herein in their entireties.
A variety of host expression vector systems can be utilized to express the antibody molecules of the invention. Such expression systems represent vehicles by which the coding sequences of interest can be expressed, their encoded productsproduced and subsequently purified. These systems also represent cells that can, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ. Cell expression systems include,but are not limited, to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces or Pichia)transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected withrecombinant virus expression vectors (e.g., cauliflower mosaic virus (CaMV) or tobacco mosaic virus (TMV)), transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g.,COS, CHO, BHK, 293, 3T3, NSO cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vacciniavirus 7.5K promoter). Preferably, bacterial cells such as E. coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecules, are used for the expression of a recombinant antibody molecule. Forexample, mammalian cells such as Chinese hamster ovary (CHO) cells, in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus, is an effective expression system for antibodies (Foecking et al.,1986, Gene, 45:101; Cockett et al., 1990, BioTechnology, 8:2).
In bacterial systems, a number of expression vectors can be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, when a large quantity of such a protein is to be produced for thegeneration of pharmaceutical compositions of an antibody molecule, for example, vectors that direct the expression of high levels of fusion protein products that are readily purified are often desirable. Such vectors include, but are not limited to, theE. coli expression vector pUR278 (Ruther et al., 1983, EMBO J., 2:1791), in which the antibody coding sequence can be ligated individually into the vector in-frame with the lacZ coding region so that a fusion protein is produced; pIN vectors (Inouye &Inouye, 1985, Nucleic Acids Res., 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem., 24:5503-5509; and the like). pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general,such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin orfactor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign polynucleotides and polypeptides. The virus grows in Spodoptera figuriperda cells. The antibody coding sequence may be clonedindividually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). In mammalian host cells, a number of viral based expression systems can beutilized. In cases in which an adenovirus is used as an expression vector, the antibody coding sequence of interest can be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. Thischimeric gene can then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) results in a recombinant virus that is viable and capable of expressing theantibody molecule in infected hosts. See, e.g., Logan and Shenk, 1984, Proc. Natl. Acad. Sci. USA, 81:355-359. Specific initiation signals can also be required for efficient translation of inserted antibody coding sequences. These signals includethe ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in-phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals andinitiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., 1987,Methods in Enzymol., 153:51-544).
In addition, a host cell strain can be chosen to modulate the expression of the inserted sequences, or to modify and process the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g.,cleavage) of protein products can be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate celllines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript,glycosylation, and phosphorylation of the gene product can be used. Such mammalian host cells include, but are not limited to, CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI38, and in particular, breast cancer cell lines such as, for example, BT483,Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell lines such as, for example, CRL7030 and Hs578Bst.
For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express the antibody molecule can be engineered. Rather than using expression vectors that contain viral originsof replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoters, enhancer sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following theintroduction of the foreign DNA, such genetically engineered cells can be allowed to grow for 1-2 days in an enriched medium, and then are typically replated in a selective medium. A selectable marker in the recombinant plasmid confers resistance to theselection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which, in turn, can be cloned and expanded into cell lines. This method can advantageously be used to engineer cell lines expressing the antibodymolecule. Such engineered cell lines are particularly useful in screening and evaluation of compounds that interact directly or indirectly with the antibody molecule.
A number of selection systems can be used, including but not limited to, herpes simplex virus thymidine kinase (HSV TK), (Wigler et al., 1977, Cell, 11:223), hypoxanthine-guanine phosphoribosyltransferase (HGPRT), (Szybalska and Szybalski, 1992,Proc. Natl. Acad. Sci. USA, 48:202), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell, 22:817) polynucleotides and polypeptides can be employed in tk-, hgprt-, or aprt-cells (APRT), respectively.
In addition, anti-metabolite resistance can be used as the basis of selection for the following polynucleotides and polypeptides: dhfr, which confers resistance to methotrexate (Wigler et al., 1980, Proc. Natl. Acad. Sci. USA, 77:357; andO'Hare et al., 1981, Proc. Natl. Acad. Sci. USA, 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan and Berg, 1981, Proc. Natl. Acad. Sci. USA, 78:2072); neo, which confers resistance to the aminoglycoside G418 (ClinicalPharmacy, 12:488-505; Wu and Wu, 1991, Biotherapy, 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol., 32:573-596; Mulligan, 1993, Science, 260:926-932; Anderson, 1993, Ann. Rev. Biochem., 62:191-21; May, 1993, TIB TECH, 11(5):155-215; andhygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene, 30:147). Methods commonly known in the art of recombinant DNA technology can be routinely applied to select the desired recombinant clone, and such methods are described, forexample, in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY; in Chapters 12 and 13, Dracopoli et al. (eds), CurrentProtocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., 1981. J. Mol. Biol., 150:1, which are incorporated by reference herein in their entireties.
The expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned polynucleotides and polypeptides inmammalian cells in DNA cloning, Vol. 3. (Academic Press, New York, 1987). When a marker in the vector system expressing an antibody is amplifiable, an increase in the level of inhibitor present in the host cell culture will increase the number ofcopies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse et al., 1983, Mol. Cell. Biol., 3:257).
Vectors that use glutamine synthase (GS) or DHFR as the selectable markers can be amplified in the presence of the drugs methionine sulphoximine or methotrexate, respectively. An advantage of glutamine synthase based vectors is the availabilityof cell lines (e.g., the murine myeloma cell line, NSO) which are glutamine synthase negative. Glutamine synthase expression systems can also function in glutamine synthase expressing cells (e.g. Chinese Hamster Ovary (CHO) cells) by providingadditional inhibitor to prevent the functioning of the endogenous gene.
Vectors that express glutamine synthase as the selectable marker include, but are not limited to, the pEE6 expression vector described in Stephens and Cockett, 1989, Nucl. Acids. Res., 17:7110. A glutamine synthase expression system andcomponents thereof are detailed in PCT publications: WO87/04462; WO86/05807; WO89/01036; WO89/10404; and WO91/06657, which are incorporated by reference herein in their entireties. In addition, glutamine synthase expression vectors that can be used inaccordance with the present invention are commercially available from suppliers, including, for example, Lonza Biologics, Inc. (Portsmouth, N.H.). The expression and production of monoclonal antibodies using a GS expression system in murine myelomacells is described in Bebbington et al., 1992, BioTechnology, 10:169 and in Biblia and Robinson, 1995, Biotechnol. Prog., 11:1, which are incorporated by reference herein in their entireties.
A host cell can be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors can contain identicalselectable markers that enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector can be used which encodes, and is capable of expressing, both the heavy and light chain polypeptides. In such situations, the lightchain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, 1986, Nature, 322:52; Kohler, 1980, Proc. Natl. Acad. Sci. USA, 77:2197). The coding sequences for the heavy and light chains can comprise cDNA orgenomic DNA.
Once an antibody molecule of the invention has been produced by an animal, chemically synthesized, or recombinantly expressed, it can be purified by any method known in the art for the purification of an immunoglobulin or polypeptide molecule,for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen, Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for thepurification of proteins. In addition, the antibodies of the present invention or fragments thereof can be fused to heterologous polypeptide sequences described herein or otherwise known in the art, to facilitate purification.
Moreover, the antibodies or fragments thereof of the present invention can be fused to marker sequences, such as a peptide, to facilitate their purification. In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide,such as the tag provided in a pQE vector (QIAGEN, Inc., Chatsworth, Calif.), among others, many of which are commercially available. As described in Gentz et al., 1989, Proc. Natl. Acad. Sci. USA, 86:821-824, for instance, hexa histidine providesfor convenient purification of the fusion protein. Other peptide tags useful for purification include, but are not limited to, the "HA" tag, which corresponds to an epitope derived from the influenza hemagglutinin (HA) protein (Wilson et al., 1984,Cell, 37:767) and the "flag" tag.
The present invention encompasses antibodies that are recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugated) to a biomarker polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ IDNO:64), or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide, to generate fusion proteins. The fusion does not necessarily need to be direct, but can occur through linker sequences. Theantibodies can be specific for antigens other than the biomarker polypeptides, or portions thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of a polypeptide of the present invention. Antibodies fused or conjugated tothe polypeptides of the present invention may also be used in in vitro immunoassays and purification methods using methods known in the art. See, e.g., Harbor et al., supra, and PCT publication WO 93/21232; EP 439, 095; Naramura et al., 1994, Immunol. Lett., 39:91-99; U.S. Pat. No. 5,474,981; Gillies et al., 1992, Proc. Natl. Acad. Sci. USA, 89:1428-1432; Fell et al., 1991, J. Immunol., 146:2446-2452, which are incorporated by reference herein in their entireties.
In various aspects of the invention, antibodies of the present invention (including fragments or variants thereof) can also be fused to albumin (including, but not limited to, recombinant human serum albumin (see, e.g., U.S. Pat. No. 5,876,969,issued Mar. 2, 1999; EP Patent 0 413 622; and U.S. Pat. No. 5,766,883, issued Jun. 16, 1998, incorporated herein by reference in their entirety), resulting in chimeric polypeptides. In a preferred embodiment, antibodies of the present invention(including fragments or variants thereof) are fused with the mature form of human serum albumin (i.e., amino acids 1-585 of human serum albumin as shown in FIGS. 1 and 2 of EP Patent 0 322 094, which is herein incorporated by reference in its entirety). More preferably, antibodies of the present invention, including fragments or variants thereof, are fused with polypeptide fragments comprising, or alternatively consisting of, amino acid residues 1-z of human serum albumin, where z is an integer from 369to 419, as described in U.S. Pat. No. 5,766,883 incorporated herein by reference in its entirety. Such fusions may, for example, facilitate purification and may increase half-life in vivo.
The present invention further includes compositions comprising the biomarker polypeptides of the present invention (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) fused or conjugated to antibody domains other than thevariable region domain. For example, the polypeptides of the present invention can be fused or conjugated to an antibody Fc region, or portion thereof. The antibody portion fused to a polypeptide of the present invention can comprise the constantregion, hinge region, CH1 domain, CH2 domain, CH3 domain, or any combination of whole domains or portions thereof. The polypeptides can also be fused or conjugated to the above antibody portions to form multimers. For example, Fc portions fused to thepolypeptides of the present invention can form dimers through disulfide bonding between the Fc portions. Higher multimeric forms can be made by fusing the polypeptides to portions of IgA and IgM. Methods for fusing or conjugating the polypeptides ofthe present invention to antibody portions are known in the art. See, e.g., U.S. Pat. Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., 1991,Proc. Natl. Acad. Sci. USA, 88:10535-10539; Zheng et al., 1995, J. Immunol., 154:5590-5600; and Vil et al., Proc. Natl. Acad. Sci. USA, 89:11337-11341, which are hereby incorporated by reference herein in their entireties.
Such fusions can be used to increase the in vivo half-life of the polypeptides, facilitate purification, or carry out immunoassays using methods known in the art. As guidance, chimeric proteins having the first two domains of the human CD4polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins have been described (see, e.g., EP 394,827; Traunecker et al., 1988, Nature, 331:84-86). The polypeptides of the present invention fused orconjugated to an antibody, or portion thereof, having disulfide-linked dimeric structures due to the IgG, for example, can also be more efficient in binding and neutralizing other molecules, than the monomeric secreted protein or protein fragment alone(Fountoulakis et al., 1995, J. Biochem., 270:3958-3964). In many cases, the Fc portion in a fusion protein is beneficial in therapy, diagnosis, and/or screening methods, and thus can result in, for example, improved pharmacokinetic properties (see,e.g., EP A 232, 262). In drug discovery, for example, the biomarker polypeptides can be fused with Fc domains for the purpose of high-throughput screening assays to identify biomarker antagonists (see, Bennett et al., 1995, J. Molecular Recognition,8:52-58; and Johanson et al., 1995, J. Biol. Chem., 270:9459-9471). Alternatively, the Fc portion can be deleted after the fusion protein has been expressed, detected, and purified. For example, the Fc portion of the fusion protein can be deleted fortherapeutic and diagnostic applications.
The present invention further encompasses antibodies or fragments thereof conjugated to a molecule to facilitate detection. Nonlimiting examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials,luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron emission tomographies, and nonradioactive paramagnetic metal ions. The detectable substance can be coupled or conjugated eitherdirectly to the antibody (or fragment thereof) or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Pat. No. 4,741,900 for metal ions that can be conjugatedto antibodies for use as diagnostics according to the present invention. Nonlimiting examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; Nonlimiting examples of suitableprosthetic group complexes include streptavidin/biotin and avidin/biotin; nonlimiting examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansylchloride or phycoerythrin; a nonlimiting example of a luminescent material includes luminol; nonlimiting examples of bioluminescent materials include luciferase, luciferin, and aequorin; and nonlimiting examples of suitable radioactive material includeiodine (.sup.125I, .sup.131I), carbon (.sup.14C), sulfur (3sus), tritium (.sup.3H), indium (.sup.111In and other radioactive isotopes of inidium), technetium (.sup.99Tc, .sup.99mTc), thallium (20Ti), gallium (.sup.68Ga, .sup.67Ga), palladium(.sup.103Pd), molybdenum (.sup.99Mo), xenon (.sup.133Xe), fluorine (.sup.19F), .sup.153Sm, .sup.177Lu, Gd, radioactive Pm, radioactive La, radioactive Yb, .sup.166Ho, .sup.90Y, radioactive Sc, radioactive Re, radioactive Re, .sup.142Pr, .sup.105Rh, and.sup.97Ru. Antibodies can also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon,polystyrene, polyvinyl chloride or polypropylene.
As nonlimiting examples, antibodies of the present invention can be used to purify, detect, and target the polypeptides of the present invention, including both in vitro and in vivo diagnostic, detection, screening, and/or therapeutic methods. For example, the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of the biomarker polypeptides of the present invention in biological samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, ColdSpring Harbor Laboratory Press, 2nd Ed. 1988, which is incorporated by reference herein in its entirety. In specific aspects of the invention, the antibodies can be utilized for typing of drugs, compounds, or other therapeutic agents incubated withcell lines or patients' cells. Antibodies directed against a specific biomarker polypeptide, epitope, or combination of epitopes, allow for the measurement of levels (e.g., extracellular, intracellular, or cell lysate levels) of on or more biomarkers. Various techniques utilizing antibodies can be employed to screen for levels of the biomarker(s), including magnetic separation using antibody-coated magnetic beads, and "panning" with antibody(ies) attached to a solid matrix (i.e., tissue cultureplate). These techniques allow for the screening of particular populations of cells, such as cells from individual patients or patient populations.
Antibodies according to this invention can be assayed for immunospecific binding by any method known in the art. The immunoassays which can be used include, but are not limited to, competitive and non-competitive assay systems using techniquessuch as BIAcore analysis, FACS (Fluorescence Activated Cell Sorter) analysis, immunofluorescence, immunocytochemistry, Western blots, radioimmunoassays (RIAs), ELISAs (enzyme linked immunosorbent assays), "sandwich" immunoassays, immunoprecipitationassays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, to name but a few. Such assays areroutine and well known and practiced in the art (see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incorporated by reference herein in its entirety). Nonlimiting, exemplaryimmunoassays are described briefly below.
Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (i.e., 1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol)supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate); adding the antibody of interest to the cell lysate; incubating for a period of time (e.g., 1 to 4 hours) at 4.degree. C.; adding protein Aand/or protein G sepharose beads to the cell lysate; incubating for about 60 minutes or more at 4.degree. C.; washing the beads in lysis buffer; and resuspending the beads in SDS/sample buffer. The ability of the antibody of interest toimmunoprecipitate a particular antigen can be assessed by, for example, Western blot analysis. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the binding of the antibody to an antigen and decreasethe background (e.g., pre-clearing the cell lysate with sepharose beads). For further discussion regarding immunoprecipitation protocols, see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., NewYork, at 10.16.1.
Western blot analysis generally comprises preparing protein samples; electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%-20% SDS PAGE depending on the molecular weight of the antigen); transferring the protein sample from thepolyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon; blocking the membrane in blocking solution (e.g., PBS with 3% BSA or nonfat milk); washing the membrane in washing buffer (e.g., PBS-Tween 20); blocking the membrane with primaryantibody (the antibody of interest) diluted in blocking buffer; washing the membrane in washing buffer; blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzymaticsubstrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., .sup.32P or .sup.125I) diluted in blocking buffer; washing the membrane in wash buffer; and detecting the presence of the antigen. One of skill in the artwould be knowledgeable as to the parameters that can be modified to increase the signal detected and to reduce the background noise. For further discussion regarding Western blot protocols, see, e.g., Ausubel et al, eds, 1994, Current Protocols inMolecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, at 10.8.1.
In one embodiment of the invention, ELISAs comprise preparing antigen, coating the wells of a multi-well microtiter plate with antigen, adding to the wells the antibody of interest conjugated to a detectable compound such as an enzymaticsubstrate (e.g., horseradish peroxidase or alkaline phosphatase), incubating for a period of time; and detecting the presence of the antigen. In ELISAs, the antibody of interest does not have to be conjugated to a detectable compound; instead, a secondantibody (which recognizes the antibody of interest) conjugated to a detectable compound can be added to the wells. Further, instead of coating the wells with antigen, the antibody can be first coated onto the well. In this case, a second antibodyconjugated to a detectable compound can be added to the antibody-coated wells following the addition of the antigen of interest. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected, aswell as other variations of ELISAs known in the art. For further discussion regarding ELISAs, see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, at 11.2.1.
The binding affinity of an antibody to an antigen and the off-rate of an antibody-antigen interaction can be determined by competitive binding assays. One example of a competitive binding assay is a radioimmunoassay involving the incubation oflabeled antigen (e.g., .sup.3H or .sup.125I), or a fragment or variant thereof, with the antibody of interest in the presence of increasing amounts of labeled antigen, and the detection of the antibody bound to the labeled antigen. The affinity of theantibody of interest for a biomarker polypeptide and the binding off rates can be determined from the data by Scatchard plot analysis. Competition with a second antibody can also be determined using radioimmunoassays. In this case, the biomarkerpolypeptide is incubated with antibody of interest conjugated to a labeled compound (e.g., a compound labeled with .sup.3H or .sup.125I) in the presence of increasing amounts of an unlabeled second antibody. This kind of competitive assay between twoantibodies may also be used to determine if two antibodies bind to the same or different epitopes.
In a preferred embodiment, BIAcore kinetic analysis is used to determine the binding on and off rates of antibodies (including antibody fragments or variants thereof) to a biomarker polypeptide, or fragments of a biomarker polypeptide. Kineticanalysis comprises analyzing the binding and dissociation of antibodies from chips with immobilized biomarker polypeptide or peptide on the chip surface.
It is to be further understood that the above-described techniques for the production, expression, isolation, and manipulation of antibody molecules, for example, by recombinant techniques involving molecular biology, as well as by othertechniques related to the analysis of polynucleotides and polypeptides and proteins, are applicable to other polypeptide or peptide molecules of the invention as described herein, in particular, the biomarker polypeptides or peptides themselves, asapplicable or warranted, in accordance with the various embodiments of this invention.
Treatments
In another embodiment, the present invention embraces the use of one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) identified herein that can serve as targets for the development of drugtherapies for hepatotoxicity, e.g., idiosyncratic hepatotoxicity. Because extracellular levels of these biomarker polypeptides are elevated in the presence of hepatotoxic substances, they may serve as targets for treating hepatotoxicity. As examples,various treatments can be used to decrease extracellular levels of a biomarker polypeptides, including administration of anti-biomarker antibodies such as polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chainantibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), intracellularly made antibodies (i.e., intrabodies),and epitope-binding fragments thereof, as described in detail herein. If expression levels of one or more nucleic acids (e.g., SEQ ID NO:46 to SEQ ID NO:60) encoding the disclosed biomarker polypeptides are also elevated in the presence of hepatotoxicsubstances, then other treatments may be used to counteract hepatotoxicity, for example, antisense sequences that prevent transcription or translation of the biomarkers of the invention (see, e.g., N. S. Templeton and D. D. Lasic, 2000, Gene Therapy:Therapeutic Mechanisms and Strategies, Marcel Dekker).
For antibody-based treatments, it may be preferable to use humanized antibodies, which bind to one or more biomarker polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), and comprise complementarity determiningregion(s) (CDRs) from a nonhuman species and framework regions from a human immunoglobulin molecule. For such antibodies, framework residues in the human framework regions are often substituted with the corresponding residues from the CDR donor antibodyto alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigenbinding, and by sequence comparison to identify unusual framework residues at particular positions. See, e.g., Queen et al., U.S. Pat. No. 5,585,089; and Riechmann et al., 1988, Nature, 332:323, which are incorporated herein by reference in theirentireties. Antibodies can be humanized using a variety of techniques known in the art, including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and 5,585,089); veneering or resurfacing (EP592,106; EP 519,596; Padlan, 1991, Molecular Immunology, 28(4/5):489-498; Studnicka et al., 1994, Protein Engineering, 7(6):805-814; Roguska et al., 1994, Proc. Natl. Acad. Sci. USA, 91:969-973; and chain shuffling (U.S. Pat. No. 5,565,332).
Because humanized (i.e., chimeric) antibodies typically are comprised of a human constant region and a murine variable region, it is expected that certain human anti-chimeric antibody (HACA) responses will be observed, particularly in treatmentsinvolving chronic or multi-dose utilizations of the antibody. Thus, it is desirable to provide fully human antibodies against the biomarker polypeptides in order to vitiate concerns and/or effects of human anti-mouse antibody (HAMA) or HACA responses. Completely human antibodies can be made by a variety of established methods, including the phage display methods described above, using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Pat. Nos. 4,444,887 and 4,716,111;and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety. In addition, completely human antibodies that recognize a selectedepitope can be generated using a technique referred to as "guided selection". In this approach, a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al., 1988, BioTechnology, 12:899-903). For a detailed discussion of the technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publications WO 98/24893; WO92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; 5,939,598; 6,075,181; and 6,114,598, which are incorporated byreference herein in their entirety.
Human antibodies can also be produced using XenoMouse.RTM. technology (Abgenix, Fremont, Calif.; Green et al., 1994, Nature Genetics, 7:13-21), or similar approaches. See Mendez et al., 1997, Nature Genetics, 15:146-156; Green and Jakobovits,1998, J. Exp. Med., 188:483-495; and Green, 1999, Journal of Immunological Methods, 231:11-23, the disclosures of which are hereby incorporated herein by reference. Such methods employ a transgenic mouse that has a substantial portion of the humanantibody producing genome inserted, and carries deletions of endogenous antibody producing regions. These mice are capable of producing human immunoglobulin molecules and antibodies, and are deficient in the production of murine immunoglobulin moleculesand antibodies. Technologies utilized for achieving the same are disclosed in the patents, applications, and references disclosed herein. Notably, fully human antibodies are expected to minimize the immunogenic and allergic responses intrinsic to mouseor mouse-derivatized monoclonal antibodies and thus to increase the efficacy and safety of the administered antibodies. The use of fully human antibodies can be expected to provide a substantial advantage in the treatment or prevention ofhepatotoxicity, which may require repeated antibody administrations.
In specific embodiments, human antibodies can be made by introducing the human heavy and light chain immunoglobulin gene complexes randomly, or by homologous recombination, into mouse embryonic stem cells. Alternatively, the human variableregion, constant region, and diversity region may be introduced into mouse embryonic stem cells, in addition to the human heavy and light chain polynucleotides and polypeptides. The mouse heavy and light chain immunoglobulin polynucleotides andpolypeptides can then be rendered nonfunctional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In accordance with these methods, homozygous deletion of the J.sub.H region prevents endogenousantibody production. Following this, the modified embryonic stem cells can be expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice can then be bred to produce homozygous offspring which express human antibodies, andthese offspring can be immunized in the normal fashion with a selected antigen, e.g., all or a portion of a biomarker polypeptide of the invention. Monoclonal antibodies directed against the antigen can be obtained from the immunized transgenic miceusing conventional hybridoma technology. The human immunoglobulin transpolynucleotides and polypeptides harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, usingsuch a technique, it is possible to produce useful human IgG, IgA, IgM and IgE antibodies. For an overview of the technology for producing human antibodies, see Lonberg and Huszar, 1995, Intl. Rev. Immunol. 13:65-93.
Intrabodies directed to one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) can also be produced in accordance with the invention. Intrabodies are antibodies, often scFvs, that are expressedfrom a recombinant nucleic acid molecule and are engineered to be retained intracellularly, e.g., retained in the cytoplasm, endoplasmic reticulum, or periplasm of the host cells. Intrabodies can be used, for example, to ablate the function of thebiomarker polypeptide to which the intrabody binds. The expression of intrabodies can also be regulated through the use of inducible promoters in the nucleic acid expression vector comprising nucleic acid encoding the intrabody. Intrabodies of theinvention can be produced using methods known in the art, such as those disclosed and reviewed in Chen et al., 1994, Hum. Gene Ther., 5:595-601; Marasco, W. A., 1997, Gene Ther., 4:11-15; Rondon and Marasco, 1997, Annu. Rev. Microbiol., 51:257-283;Proba et al., 1998, J. Mol. Biol., 275:245-253; Cohen et al., 1998, Oncogene, 17:2445-2456; Ohage and Steipe, 1999, J. Mol. Biol., 291:1119-1128; Ohage et al., 1999, J. Mol. Biol., 291:1129-1134; Wirtz and Steipe, 1999, Protein Sci., 8:2245-2250; Zhu etal., 1999, J. Immunol. Methods, 231:207-222.
For some purposes, it may be preferable to conjugate the anti-biomarker antibodies of the invention to one or more other therapeutic moieties for the treatment of hepatotoxicity. Techniques for conjugating therapeutic moieties to antibodies arewell known, see, e.g., Hellstrom et al., "Antibodies For Drug Delivery", In: Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53, Marcel Deldcer, Inc., 1987. Alternatively, an antibody can be conjugated to a second antibody to forman antibody heteroconjugate, e.g., as described in U.S. Pat. No. 4,676,980 to Segal, which is incorporated herein by reference in its entirety. An antibody, i.e., an antibody specific for a biomarker polypeptide of this invention, with or without atherapeutic moiety conjugated to it, can be administered alone or in combination with other treatments for hepatotoxicity.
Screens
The present invention encompasses methods of determining or predicting if a drug, compound, or other therapeutic agent for use in the treatment for a disease or other medical condition will be likely to have hepatotoxic effects, e.g.,idiosyncratic hepatotoxicity, in vivo. Ideally, such methods are performed prior to administration of the test substance (or combination of test substances) to an individual patient or patient population. In accordance with the method of the invention,hepatocyte cell lines or liver cells from a patient are subjected to a screening assay as described herein, to determine levels (e.g., extracellular, intracellular, or cell lysate levels) of one or more biomarker polypeptide (e.g., SEQ ID NO:1 to SEQ IDNO:15 and SEQ ID NO:61 to SEQ ID NO:64) in the presence and absence of one or more test substances. The biomarker polypeptide levels obtained from cells in the presence or absence of the test substance(s) are compared to determine if elevated levelscorrelate with treatment with the test substance(s). If increased levels of one or more biomarker polypeptides are observed in the presence of the test substance(s), it is highly likely or predicted that substance will cause in vivo hepatotoxicity. Bycontrast, if comparable levels of one or more biomarker polypeptides are observed in the presence and absence of the test substance(s), it is highly likely or predicted that the substance(s) will not cause in vivo hepatotoxicity. Thus, success orfailure of treatment due to hepatotoxic effects can be predicted by measuring levels of the biomarker polypeptides of the invention.
For use with the methods of the present invention, any drug, compound, or other therapeutic agent can be screened for hepatotoxicity. As non-limiting examples, the methods of the invention can be used to test or screen anti-cancer,anti-bacterial, anti-fungal, anti-viral, anti-hypertension, anti-depression, anti-anxiety, and anti-arthritis substances, as well as substances for the treatment of allergies, diabetes, hypercholesteremia, osteoporosis, Alzheimer's disease, Parkinson'sdisease, and/or other neurodegenerative diseases, and obesity. Specific categories of test substances can include, but are not limited to, PPAR agonists, HIV protease inhibitors, anti-inflammatory drugs, estrogenic drugs, anti-estrogenic drugs,antihistimines, muscle relaxants, anti-anxiety drugs, anti-psychotic drugs, and anti-angina drugs.
Non-limiting examples of PPAR agonists include Pioglitazone, Rosiglitazone, Tesaglitazar, Ragaglitazar, Troglitazone, Farglitazar, Ciglitazone, Azelaoyl PAF, 2-Bromohexadecanoic acid, Clofibrate, 15-Deoxy-d12,14-prostaglandin, Fenofibrate,Fmoc-Leu-OH, GW1929, GW7647, 8(S)-Hydroxy-(5Z,9E,11Z,14Z)-eicosatetraenoic acid (8(S)-HETE), Leukotriene B4, LY-171,883 (Tomelukast), Prostaglandin A2, Prostaglandin J2, Tetradecylthioacetic acid (TTA), WY-14643 (Pirinixic acid), and NN622 (Novo Nordisk,A/S), and related substances. Non-limiting examples of anti-anxiety and anti-psychotic drugs include Hydroxyzine Hydrochloride, Lorazepam, Buspirone Hydrochloride, Pazepam, Chlordiazepoxide, Meprobamate, Oxazepam, Trifluoperazine, ClorazepateDipotassium, Diazepam, Clozapine, Prochlorperazine, Haloperidol, Thioridazine, Thiothixene, Risperidone, Trifluoperazine Hydrochloride, Chlorpromazine, and related substances. Non-limiting examples of HIV protease inhibitors include Saquinavir,Amprenavir, Ritonavir, Nelfinavir, Indinavir, Atazanavir (BMS232632; Bristol-Myers Squibb), Fosamprenavir (GW433908; GlaxoSmithKline), L-756,423 (Merck), Mozenavir (DMP450; Triangle Pharmaceuticals), Tipranavir (PNU-140690; Boehringer Ingelheim);R0033-4649 (Roche) TMC114 (Tibotec Virco), and related substances.
Non-limiting examples of anti-inflammatory drugs include Diclofenac, Diflunisal, Etodolac, Fenoprofen, Flurbiprofen, Ibuprofen, Indomethacin, Ketoprofen, Ketorolac, Meclofenamate, Mefenamic Acid, Nabumetone, Naproxen, Oxaprozin, Piroxicam,Sulindac, Tolmetin, and related substances. Non-limiting examples of antihistimines include Azelastine (Astelin.RTM.), Fexofenadine (e.g., Allegra.RTM.), Cetirizine (e.g., Zyrtec.RTM.), Desloratadine (e.g., Clarinex.RTM.), Loratadine (e.g.,Claritin.RTM., Alayert.RTM.), Astemizole, Azatadine, Brompheniramine, Chlorpheniramine, Clemastine, Cyproheptadine, Dexchlorpheniramine, Dimenhydrinate, Diphenhydramine, Doxylamine, Hydroxyzine, Phenindamine, Pyrilamine, Terfenadine, Tripelennamine,Triprolidine, Methdilazine, Promethazine, Trimeprazine, Diphenhydramine Liquid, and related substances. Non-limiting examples of muscle relaxants include Dantrolene (e.g., Dantrium.RTM.), Baclofen (e.g., Lioresal.RTM.), Carisoprodol (e.g., Soma.RTM.),Chlorphenesin (e.g., Maolate.RTM.), Chlorzoxazone (e.g., Paraflex.RTM.), Cisatracurium, Cyclobenzaprine (e.g., Flexeril.RTM.), Dantrolene, Diazepam (e.g., Valium.RTM.), Metaxalone (e.g., Skelaxin.RTM.), Gallamine, Methocarbamol (e.g., Robaxin.RTM.),Mivacurium, Orphenadrine (e.g., Norflex.RTM.), Pancuronium, Rocuronium, Tizanidine, Suxamethonium, Vecuronium, and related substances.
Non-limiting examples of estrogens and anti-estrogens include conjugated estrogens (e.g., Premarin.RTM.), esterified estrogens (e.g., Estratab.RTM., Menest.RTM., Estratest.RTM.), synthetic conjugated estrogens (e.g., Cenestin.RTM.), Estropipate(e.g., Ogen.RTM., Ortho-Est.RTM.), Ethinyl Estradiol (e.g., Estinyl.RTM.), Desogestrel, Diethylstilbestrol (e.g., Stilphostrol.RTM.), Dienestrol (e.g., Ortho Dienestrol.RTM.), Chlorotrianisene (Tace.RTM.), Estradiol (e.g., Estrace.RTM., Alora.RTM.,Climara.RTM., Vivelle.RTM.), Estradiol Cypionate (e.g., Depo-Estradiol.RTM., Depogen.RTM., Dura-Estrin.RTM., Estra-D.RTM., Estro-Cyp.RTM., Estroject-LA.RTM., Estronol-LA.RTM.), Estropipate, Ethacrynic Acid, Ethynodiol Diacetate, Levonorgestrel,Medroxyprogesterone, Medroxyprogesterone Acetate, Mestranol, Norethindrone, Norgestimate, Norgestrel, Tamoxifen (e.g., Nolvadex.RTM.), Toremifene (e.g., Fareston.RTM.), Raloxifene (e.g., Evista.RTM.), Megestrol Acetate (Megace.RTM.), Aminogluthethimide(e.g., Cytadren.RTM.), Anastrozole (e.g., Arimidex.RTM.), Letrozole (e.g., Femara.RTM.), Exemestane (e.g., Aromasin.RTM.), Goserelin (e.g., Zoladex.RTM.), Leuprolide (e.g., Lupron.RTM.), and related substances. Non-limiting examples of anti-angina drugsinclude Calan SR, Isoptin, Isoptin SR, Verelan, Nicardipine Hydrochloride, Diltiazem Hydrochloride, Nadolol, Isosorbide Mononitrate, Isosorbide Dinitrate, Metroprolol Tartrate, Nitroglycerin, Amlodipine Besylate, Nifedipine, Atenolol, and relatedsubstances.
The methods of the invention can employ available hepatocyte cell lines or liver cells obtained from individual patients. Preferably, the hepatocyte cell lines are human in origin, although mouse, rat, and porcine cell lines may also be used. Non-limiting examples of human hepatocyte cell lines include THLE-5 (Pfeifer, A. M., et al., 1993, Proc. Natl. Acad. Sci. U.S.A. 90, 5123-5127; also called THLE-5B), THLE-5B-c15, HH25 (Smalley et al., 1999, In Vitro Cell. Dev. Biol--Animal35:22-32), HH29 (Kono and Roberts, 1996, Biochem. Biophys. Res. Commun. Mar 27; 220(3):628-32), HHY41 (Kono et al., 1995, Exp. Cell. Res. December; 221(2):478-85), HuH7 (Yamada et al., 1994, Mol. Carcinog. July; 10(3):151-8), Hep3B (Majello etal., 1990, EMBO J. February; 9(2):457-65), HepG2 (Schilsky et al., 1989, J. Clin. Invest. November; 84(5):1562-8), OUMS-29 (Kobayashi et al., 2000, Transplantation January 27;69(2):202-7), ACTIVTox.RTM. (Amphioxus Cell Technologies, Houston, Tex.),PH5CH (Kato et al., 1996, Jpn. J. Cancer Res. 1996 August; 87(8):787-92), HepG2/C3A (ATCC No. CRL-10741), THLE-3 (ATCC No. CRL-11233), DBTRG-05MG (ATCC No. CRL-2020), THLE-2 (ATCC No. CRL-2706), SW 1783 (ATCC No. HTB-13), U-138 MG (ATCC No. HTB-16),SK-LMS-1 (ATCC No. HTB-88). In one aspect of the invention, immortalized but non-tumorigenic hepatic cell lines can be used, for example, HepLiu (Liu et al., 2001, Artificial Organs 25(7):539-545; Liu et al., 1999, Cell Transplantation 8:219-232;Cascio, 2001, Artificial Organs 25(7):529-538). In addition, various constructs can be used for transient or stable transformation of these cell lines, for example, constructs comprising one or more cytochrome P450 enzymes, such as 1A1, 1A2, 2A6, 2B6,2C8, 2C9, 2C10, 2C19, 2D6, 2E1, 3A4, 3A5, and 3A7 (see, e.g., E. F. Johnson and M. R. Waterman, Methods in Enzymology Series: Cytochrome P450, Part C, Volume 357, Academic Press, 2002)
In a specific aspects of the invention, the disclosed methods are employed for predicting and/or determining prior to treatment whether a patient requiring one or more drugs for treatment of a disease (e.g., an anti-cancer drug or anti-HIV drug)will or will not successfully tolerate the drug(s). The methods of the invention can also be used for predicting or monitoring the patient's tolerance of one or more drugs once treatment has commenced. To monitor treatment with a therapeutic substance,for example, levels of biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) can be measured using biological samples obtained from one or more patients at designated intervals during treatment. In addition, samplescan be tested before and after treatment, to determine base-line and post-treatment levels, respectively. As non-limiting examples, biological samples may include blood, urine, and/or saliva samples. In other aspects of the invention, treatmentsinvolving a specific combination of drugs (e.g., "drug cocktails" of anti-cancer or anti-HIV drugs) can be screened for hepatotoxic effects before or after administration to a patient. Preferably, the methods of the invention are used to screen a drug,compound, or other therapeutic agent prior to clinical testing. If a prediction of hepatotoxicity is obtained, the drug treatment(s) can be avoided, modified, changed, or discontinued.
Various techniques can be used to measure levels of one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) found in the presence of absence of at least one drug, compound, or therapeutic agent(see, e.g., R. Seethala and P. Fernandes, 2001, Handbook of Drug Screening, Marcel Dekker). Non-limiting detection methods include direct, competitive, and sandwich RIAs and ELISAs, immunoprecipitation, immunofluorescence microscopy, indirectimmunofluorescence, immunohistochemistry, western blotting, and other methods disclosed herein. One suitable method involves immunoprecipitation in solution followed by measuring the development of turbidity using a turbidimeter or nephelometer (see,e.g., Deverill and Reeves, 1980, J. Immunol. Methods. 38(3-4):191-204; Borque et al., 1995, J. Clin. Lab. Anal. 9(5):302-7; E. Diamandis and T. Christopoulus, 1996, Immunoassay, Academic Press, San Diego).
In some cases, it may be useful to measure levels of one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) produced in situ in hepatocytes incubated in the presence or absence of a test substance. For immunofluorescence microscopy, anti-biomarker antibodies can be labeled, for example, with a fluorescent dye (e.g., Cy.TM.3, Cy.TM.5, Alexa, BODIPY, fluorescein, rhodamine, auramine, Texas Red, AMCA Blue, Lucifer Yellow, peridinin chlorophyllprotein, and phycoerythrin, or others disclosed herein, or known in the art) and then incubated with the treated and untreated cells. Alternatively, the anti-biomarker antibody can be detected by a fluorescently labeled anti-immunoglobulin, using atechnique known as indirect immunofluorescence. The stained cells can be examined in a microscope that exposes them to light to excite the fluorescent dye, which emits light at a characteristic wavelength and is observed through a selective filter (see,e.g., Janeway et al., Immunobiology. 5th ed., Garland Publishing, New York and London, 2001). In various aspects of the invention, different biomarker polypeptides can be detected by labeling anti-biomarker antibodies or secondary antibodies with dyesof distinctive color.
As an alternative to immunofluorescence, immunohistochemistry can be used to detecting levels of one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) in hepatocytes incubated in the presence orabsence of a test substance. In this technique, an anti-biomarker antibody is chemically coupled to an enzyme that converts a colorless substrate into a colored reaction product in situ. Alternatively, the anti-biomarker antibody can be detected by ananti-immunoglobulin conjugated to an enzyme label. In both cases, the labeled antibody can be localized by deposits of colored product that can be directly observed under a light microscope. This method is analogous to ELISA, and frequently uses thesame coupled enzymes (e.g., horseradish peroxidase, alkaline phosphatase, or other enzymes disclosed herein or known in the art). As with immunofluorescence, the native structure of the biomarker polypeptide being sought usually needs to be preserved,so that it will be recognized by the antibody. Cells are therefore fixed by relatively gentle chemical fixation techniques or frozen samples are used and fixed only after the antibody reaction has been performed (see, e.g., Janeway et al.,Immunobiology. 5th ed., Garland Publishing, New York and London, 2001).
In some instances the screening process is preferably automated so as to allow screening of suitable numbers of samples. Some examples of widely used types of automated detection systems include densitometric or ELISA readers, fluorescencereaders, scintillation counters, and photoluminescence readers (see, e.g., D. Wild, 2001, Immunoassay Handbook, 2nd ed, Nature Publishing Group; Fluor-S Max reader, Bio-Rad, Hercules, Calif.). There are a variety of ways to use ELISA/densitometricreaders and fluorescence readers to measure biomarker polypeptides in the test samples. Sample treatment varies according to the kind of sample and the type of reader being used. Automated ELISA reader devices are well known in the art (Davis, et al.Microbiology 4th. ed., pp. 269-270 (1990)) and are commercially available (see, e.g., Multiskan EX and RC, Komabiotech, Seoul, Republic of Korea; HT3, Anthos Analytical, Durham, N.C.).
In another embodiment, the present invention encompasses methods of classifying whether biological systems comprising hepatic cells will or will not tolerate one or more drugs, compounds, or other therapeutic agents. In a preferred aspect ofthis invention, cell tolerance to a test agent is determined, e.g., for cells obtained from a hepatic cell line or liver sample. For this method, levels (e.g., extracellular, intracellular, or cell lysate levels) of biomarker polypeptide are measured inthe presence and absence of the test substance, using the protocols disclosed herein. If levels of biomarker polypeptide(s) are elevated in the presence of the test substance, this can predict that the hepatic cells will not tolerate the test substance. If levels of biomarker polypeptide(s) are comparable in the presence or absence of the test substance, this can predict that the hepatic cells will successfully tolerate the test substance. Advantageously, the methods of the invention can be performedusing a variety of hepatic cell lines or liver samples, and many different types of test substances, or combinations thereof.
The present invention also embraces kits for determining or predicting in vivo hepatoxicity in a patient or patient population prior to or during administration of a drug, compound, or other therapeutic agent. Such kits are useful in clinical orpre-clinical settings, and can be used concurrently with various stages of patient trials. Provided in the kit are one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) for use as positive controls, andanti-biomarker antibodies, for example, comprising a microarray, or in suitable containers, for use in testing cells, extracellular media, or cell lysates from hepatocyte cell lines or patient liver samples for toxic effects, and instructions for use. The kits of the invention can encompass a variety of methods and systems by which the levels of the biomarker polypeptides can be assayed and/or monitored, for example, via immunoassays, such as ELISA. In kits for performing immunoassays, e.g. ELISAs,immunoblotting assays, and the like, antibodies, or bindable portions thereof, that specifically bind to biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), or to antigenic or immunogenic peptides thereof, aresupplied, in addition to buffers and reagents as necessary for performing the method.
The present invention also encompasses nucleic acids (e.g., SEQ ID NO:46 to SEQ ID NO:60) encoding the disclosed biomarker polypeptides, or fragments, variants, or derivatives thereof, which can be used as biomarkers for hepatotoxic effects ofone or more drugs, compounds, or other therapeutic agents. If expression levels of such nucleic acids are elevated in the presence of hepatotoxic substances, they can be used in screening and detection assays of the invention. Such assays embrace avariety of methods for measuring nucleic acid levels in cells that have been exposed to one or more test substances. Suitable methods include detection and evaluation of gene activation or expression of, for example, DNA, RNA, or mRNA. As non-limitingexamples, PCR assays (e.g., RT-PCR), Northern blotting, in situ hybridization, and other assays as known and practiced in the art can be employed to quantify RNA in cells being assayed for tolerance to a drug treatment (see, e.g., J. O'Connell, 2002,RT-PCR Protocols, Humana Press, Totowa, N.J.; R. Rapley and D. L. Manning, 1998, RNA Isolation and Characterization Protocols, Humana Press; R. Rapley, 2000, Nucleic Acid Protocols Handbook, Humana Press). In accordance with such assays, if levels of atleast one biomarker nucleic acid are elevated in the presence of one or more test substances, this can predict that the substance(s) will cause in vivo hepatotoxic effects. If levels of at least one biomarker nucleic acids are comparable in the presenceor absence of one or more test substance(s), this can predict that the substance(s) will not cause in vivo hepatotoxic effects.
In specific examples, expression of biomarker mRNA in the presence or absence of a test substance can be determined, for example, by Northern blotting or in situ hybridization of labeled DNA or RNA in hepatocytes. Northern blots permitcomparison of both the level of expression and the size of mRNAs in treated and untreated cells. Although the sensitivity of in situ hybridization is lower than that of Northern blot analysis, it can be very helpful in identifying an mRNA that isexpressed at very high levels in a subclass of cells (see, e.g., Lodish et al., Molecular Cell Biology, 4th ed., W H Freeman & Co, New York, 2000). Probes comprising all or a fragment of a biomarker nucleic acid (e.g., SEQ ID NO:46 to SEQ ID NO:60), orcomplementary sequences thereof, can be modified to include a detectable label (e.g., digoxigenin, fluorescent tag, or radiolabel), and incubated with hepatocytes incubated with or without a drug, compound, or other therapeutic agent. For thistechnique, the cells are not exposed to a high pH, so the chromosomal DNA remains double-stranded and cannot bind the probe. Instead the cells are gently fixed so that its mRNA is retained in an exposed form that will hybridize when the tissue isincubated with a complementary DNA or RNA probe (see, e.g., Alberts et al., Molecular Biology of the Cell, 3rd ed., Garland Publishing, New York and London, 1994). In this way the patterns of biomarker expression can be observed in the treated anduntreated cells.
Also encompassed by the invention are kits for determining or predicting in vivo hepatotoxicity of a test substance using nucleic acids (e.g., SEQ ID NO:46 to SEQ ID NO:60) encoding the disclosed biomarker polypeptides, or complementarysequences, fragments, variants, or derivatives thereof. Such kits are useful in a clinical or pre-clinical settings, and preferably, can be used prior to patient trials. Provided in the kit are one or more biomarker polynucleotides whose levelscorrelate with increasing likelihood of hepatotoxicity, provided as a microarray or in suitable containers, along with instructions for use. Such kits are not limited to the employment of microarrays, but can encompass a variety of methods and systemsby which the expression of the biomarker nucleic acids can be assayed and/or monitored, both at the level of mRNA and of protein, for example, via PCR assays such as RT-PCR, Northern analysis, or in situ hybridization. In kits for performing PCR assaysor in situ hybridization, for example, nucleic acid primers (see, e.g., FIGS. 8A-8B) or probes comprising fragments of one or more of the biomarker nucleic acids, or complementary sequences, or fragments thereof, are supplied, in addition to buffers andreagents as necessary for performing the method, and, optionally, instructions for use.
Microarrays
The present invention encompasses microarrays, e.g., protein or antibody microarrays, which allow profiling of the extracellular or cell lysate levels of one or more biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 toSEQ ID NO:64) in the presence or absence of a test substance, which can be used to predict in vivo hepatotoxicity, e.g., idiosyncratic hepatotoxicity. Protein or antibody microarrays can be used to compare the relative abundance of various biomarkerpolypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) in samples of media. For a protein microarrays, extracellular or cell lysate polypeptides or peptides (i.e., sample polypeptides) obtained from cell lines or patients'cells contacted with a test substance can be affixed to a substrate or support. The protein microarrays can then be contacted with labeled anti-biomarker antibodies, and levels of the biomarker polypeptides can be determined.
Protein microarrays can include, but are not limited to, sample polypeptides such as biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), particularly BMS-PTX-265 (SEQ ID NO:1) and BMS-PTX-837 (SEQ IDNO:2), and peptides and fragments thereof, that can be used to predict in vivo hepatotoxicity, as described in detail herein. For antibody microarrays, anti-biomarker antibodies can be affixed to a substrate or support. The antibody microarrays canthen be contacted with labeled extracellular or cell lysate polypeptides (i.e., sample polypeptides) obtained from cell lines or patients' cells incubated with test substances, and levels of the biomarker polypeptides can be determined. Antibodymicroarrays can include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, anti-idiotypic(anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), intracellularly made antibodies (i.e., intrabodies), and epitope-binding fragments thereof, specific for a biomarker polypeptide (e.g., SEQ ID NO:1 to SEQ ID NO:15and SEQ ID NO:61 to SEQ ID NO:64), as described in detail herein.
As with DNA arrays, protein and antibody microarrays are designed to be used as qualitative analysis tools, allowing determination of the presence, absence, and/or relative abundance of a biomarker polypeptide in samples of interest. See, e.g.,BD Biosciences CLONTECH, Palo Alto, Calif.; United States Patent Application No. 2002/0076727, published Jun. 20, 2002; United States Patent Application No. 2003/0044389, published Mar. 6, 2003; Arenkov et al., 2000, Anal. Biochem. 278:123-131; UnitedStates Patent Application No. 2002/0102617, published Aug. 1, 2002, which are incorporated herein by reference. However, protein and antibody arrays can be used where changes in protein levels do not necessarily correlate with changes in geneexpression. In addition, protein and antibody microarrays can be used in tandem with DNA microarrays to compare changes in gene expression with changes in protein expression. In this way, DNA, protein, and antibody microarrays can be employed ascomplementary techniques.
In preferred embodiments, the entire protein or antibody microarray analysis, from sample prep to data collection, is performed in the same day on the bench-top (see, e.g., BD Biosciences CLONTECH). A complete buffer system is provided forsample labeling and incubation. The buffer system is designed to ensure a consistent representation of sample polypeptides by maintaining sample integrity and solubility. Observed sensitivity is in the low pg/ml range, and the open array-platformdesign is compatible with commercially available fluorescent scanners commonly used for DNA microarrays. The microarray includes multiple antibodies (e.g., monoclonal antibodies) or proteins covalently bound in an ordered layout to a slide (e.g.,standard size, 1 inch.times.3 inches).
Preferably, the sample polypeptides or anti-biomarker antibodies are labeled (e.g., using Cy.TM.3 or Cy.TM.5) prior to incubation with the appropriate microarray. The microarray is then read using a scanner typically used for DNA microarrays. Ideally, the instrument accommodates a slide and is capable of exciting and detecting the label(s) employed. Examples of scanners include those manufactured by Axon, Packard Biochip, Genomic Solutions and Genetic Microsystems and others. For optimalresults, the scanner uses a minimum scanning resolution of 10-15 .mu.m. Once the slides are scanned, the raw intensity values are obtained from each spot on the array using the software supplied with the scanner. The raw intensity values are thendownloaded from the software into a spreadsheet (such as Microsoft Excel) for analysis. Specific experimental protocols can be used to normalize for potential differences in labeling and incubation, and obtain the most accurate results.
The protein or antibody microarrays of the present invention can be formed upon any suitable substrate or support. The characteristics of these substrates or supports may vary widely depending upon the intended use, and their form may takeessentially any shape. Although it is preferred that the substrate or support has at least one surface which is substantially planar or flat, it may also include indentations, protuberances, steps, ridges, terraces and the like. The substrate orsupport can be in the form of a sheet, a disc, a tubing, a cone, a sphere, a concave surface, a convex surface, a strand, a string, or a combination of any of these and other geometric forms. Several different substrate or support surfaces can becombined in accordance with the invention. One example would be to sandwich target-containing samples between two flat substrate surfaces with microarrays formed on both surfaces.
Various materials, organic or inorganic or a combination of both, can be used as substrate or support for this invention. Suitable materials include, but are not limited to, glasses, ceramics, plastics, metals, alloys, carbon, papers, agarose,silica, quartz, cellulose, polyacrylamide, polyamide, and gelatin, as well as other polymer supports, other solid-material supports, or flexible membrane supports. Polymers that may be used as substrate include, but are not limited to: polystyrene;poly(tetra)fluoroethylene (PTFE); polyvinylidenedifluoride; polycarbonate; polymethylmethacrylate; polyvinylethylene; polyethyleneimine; polyoxymethylene (POM); polyvinylphenol; polylactides; polymethacrylimide (PMI); polyalkenesulfone (PAS);polypropylene; polyethylene; polyhydroxyethylmethacrylate (HEMA); polydimethylsiloxane; polyacrylamide; polyimide; and various block co-polymers. The substrate or support can also comprise a combination of materials, whether water-permeable or not, inmulti-layer configurations.
Examples of solid substrates or supports include gels, which allow samples to reside in a three-dimensional environment, while still being completely or partially exposed to potentially immobilized or diffused cues (e.g. collagen gels, matrigels,and ECM gels). In addition, derivitized and coated slides are of particular interest. Such slides are commercially available, or may be produced using conventional methods. For example, SuperAldehyde.TM. substrates contain primary aldehyde groupsattached covalently to a glass surface. Coated-slides include films of nitrocellulose (FastSlides.TM., Schleicher & Schuell), positively-charged nylon membranes (CastSlides.TM., Schleicher & Schuell), and a polyacrylamide matrix (HydroGel.TM., PackardBioscience), etc. A preferred embodiment of the invention employs a 2.5 cm.times.7.5 cm glass slide with surface Si--OH functionalities. The substrates or supports can take a variety of configurations, including filters, fibers, membranes, beads,particles, dipsticks, sheets, rods, etc. The materials from which the substrate can be fabricated should ideally exhibit a low level of non-specific binding during binding events, except for cases where some non-specific binding is desired.
In order to allow attachment by a linker or directly by a protein or antibody, the surface of the substrate may need to undergo initial preparation in order to create suitable reactive groups. Such reactive groups could include simple chemicalmoieties such as amino, hydroxyl, carboxyl, carboxylate, aldehyde, ester, ether (e.g. thio-ether), amide, amine, nitrile, vinyl, sulfide, sulfonyl, phosphoryl, or similarly chemically reactive groups. Alternatively, reactive groups may comprise morecomplex moieties that include, but are not limited to, maleimide, N-hydroxysuccinimide, sulfo-N-hydroxysuccinimide, nitrilotriacetic acid, activated hydroxyl, haloacetyl (e.g., bromoacetyl, iodoacetyl), activated carboxyl, hydrazide, epoxy, aziridine,sulfonylchloride, trifluoromethyldiaziridine, pyridyldisulfide, N-acyl-imidazole, imidazolecarbamate, vinylsulfone, succinimidylcarbonate, arylazide, anhydride, diazoacetate, benzophenone, isothiocyanate, isocyanate, imidoester, fluorobenzene, biotin andavidin. Techniques for placing such reactive groups on a substrate by mechanical, physical, electrical or chemical means are well known in the art, such as those described by U.S. Pat. No. 4,681,870, incorporated herein by reference.
Methods of coupling the sample polypeptides or anti-biomarker antibodies to the reactive end groups on the surface of the substrate or on the linker include reactions that form linkage such as thioether bonds, disulfide bonds, amide bonds,carbamate bonds, urea linkages, ester bonds, carbonate bonds, ether bonds, hydrazone linkages, Schiff-base linkages, and noncovalent linkages mediated by, for example, ionic or hydrophobic interactions. The form of reaction will depend, of course, uponthe available reactive groups on both the substrate/linker and the antibodies.
To achieve high-density protein or antibody arrays, it may be necessary to "pack" the support surface with reactive groups to a higher density. One preferred method in the case of a glass surface is to first "strip" the surface with reagentssuch as a strong acid, and then to apply or reapply reactive groups to the surface. In the case of a glass surface, the reactive groups can be silanes, Si--OH, silicon oxide, silicon nitride, primary amines or aldehyde groups. Slides treated with analdehyde-containing silane reagent are preferred in immobilizing many binding elements and are commercially available from TeleChem International (Cupertino, Calif.) under the trade name SuperAldehyde Substrates.TM.. The aldehyde groups on the surfaceof these slides react readily with primary amines on proteins to form a Schiff base linkage. Since typical proteins/antibodies display many lysine residues on their surfaces, as well as the generally more reactive alpha-amines at their N-termini, theycan attach to the slide in a variety of orientations, permitting different sides of the protein/antibody to interact with the target(s) in solution. After arraying sample polypeptides or anti-biomarker antibodies onto these aldehyde slides, a buffercontaining bovine serum albumin (BSA) may be applied to the slide to block later non-specific binding between targets and unreacted aldehyde groups on the slide.
Once the initial preparation of reactive groups on the substrate is completed, if desired, linker molecules may optionally be added to the surface of the substrate to make it suitable for further attachment chemistry. Linkers may be selectedfrom any suitable class of compounds and may comprise polymers or copolymers of organic acids, aldehydes, alcohols, thiols, amines and the like. For example, polymers or copolymers of hydroxy-, amino-, or di-carboxylic acids, such as glycolic acid,lactic acid, sebacic acid, or sarcosine may be employed. Alternatively, polymers or copolymers of saturated or unsaturated hydrocarbons such as ethylene glycol, propylene glycol, saccharides, and the like may be employed. Preferably, the linker shouldbe of an appropriate length that allows the binding element, which is to be attached, to interact freely with molecules in a sample solution and to form effective binding.
The linker in the present invention may include at least two reactive groups with the first to bind the substrate and the second to bind the sample polypeptide or anti-biomarker antibody. The two reactive groups may be of the same chemicalmoiety, and may include any of the chemical moieties described above of reactive groups on the substrate. One preferred group comprises a maleimide group. Another preferred group is a vinyl sulfone group. It is believed that the hydrophilicity ofthese groups helps limit nonspecific binding by analytes such as proteins/antibodies when assays are conducted in aqueous buffers. Methods for binding the linker to the surface of the substrate will vary depending on the reactive groups already on thesubstrate and the linker selected, and will vary as considered appropriate by one skilled in the art. For example, siloxane bonds may be formed via reactions between the trichlorosilyl or trisalkoxy groups of a linker and the hydroxyl groups on thesupport surface. The linkers may be either branched or unbranched, but this and other structural attributes of the linker should not interfere stereochemically with relevant functions of the proteins/antibodies, such as a target interaction. Protectiongroups, known to those skilled in the art, may be used to prevent linker's end groups from undesired or premature reactions. For instance, U.S. Pat. No. 5,412,087, incorporated herein by reference, describes the use of photo-removable protectiongroups on a linker thiol group.
In a preferred embodiment, the linker comprises a BSA molecule. In particularly preferred embodiments, BSA-NHS slides are used to make protein or antibody microarrays. Although appropriate for some applications, slides functionalized withaldehyde groups and further blocked with BSA are not suitable for arrays of peptides or small proteins. In such cases, the BSA obscures the molecules of interest, and BSA-NHS slides are preferable. For such slides, a molecular monolayer of BSA isattached to the surface of the support. As a non-limiting example, a glass slide with hydroxyl groups can be silanated with aminopropyl triethoxy silane before being activated with N,N'-disuccinimidyl carbonate. The activated amino group on the slide,in turn, can form covalent bonds with a linker such as BSA. Then, the surface of the BSA is activated with N,N'-disuccinimidyl carbonate, resulting in activated carbamate and ester, such as a N-hydroxy succinimide (NHS) group. The activated lysine,aspartate, and glutamate residues on the BSA react readily with the surface amines on the sample polypeptide or anti-biomarker antibody to form covalent urea or amide linkages. Any remaining reactive groups on BSA are subsequently quenched with glycine. The result is a sample polypeptide or anti-biomarker antibody immobilized to a support through a BSA linker molecule. In contrast to the BSA-blocked slides with aldehyde functionality, proteins/antibodies arrayed on BSA-NHS substrates are displayed ontop of the BSA monolayer, rendering them accessible to targets in solution.
As will be apparent to those of skill in the art, the sample polypeptides and anti-biomarker antibodies may be modified in order to facilitate attachment, through covalent or non-covalent bonds, to the reactive groups on the surface of thesubstrate, or to the second reactive groups of a linker attached to the substrate. As examples of such modifications, nucleophilic S-, N- and O-containing groups may be added to facilitate attachment of the binding element to the solid support via aMichael addition reaction to the linker. To preserve binding affinity, it is preferred that the sample polypeptide or anti-biomarker antibody is modified so that it binds to the support substrate at a region separate from the region responsible forinteracting with its target. If the anti-biomarker antibody or sample polypeptide binds its target at a first terminus, it may be useful to attach the antibody/polypeptide to the support at a second or opposite terminus, or somewhere in between thetermini.
In a preferred embodiment, where the antibody component is an scFv, the present invention provides a modification method such that the scFv can be attached to the surface of a glass slide through binding with an electrophilic linker, such as amaleimide group, without interfering with the scFv's antigen-binding activity. According to this method, an scFv is first engineered so that its carboxy-terminus includes a cysteine residue that can then form a thioether linkage with an electrophiliclinker such as the maleimide group. Such methods can be used with other polypeptide moieties that comprise thiol groups. An N-terminus of an antibody can also be engineered to include a reactive group for attachment to the support surface. A Michaeladdition may be employed to attach compounds to glass slides, and plain glass slides may be derivatized to give surfaces that are densely functionalized with maleimide groups.
The protein or antibody microarrays of the invention may be produced by a number of means, including "spotting" wherein small amounts of the reactants are dispensed to particular positions on the surface of the substrate. Methods for spottinginclude, but are not limited to, microfluidics printing, microstamping (see, e.g., U.S. Pat. Nos. 5,515,131 and 5,731,152), microcontact printing (see, e.g., PCT Publication WO 96/29629) and inkjet head printing. Of particular interest is the use ofan automated spotting device, such as the Beckman Biomek 2000 (Beckman Instruments). A number of contact and non-contact microarray printers are available and may be used to print the binding members on a substrate. For example, non-contact printersare available from Perkin Elmer (BioChip Arrayer.TM., Packard). Contact printers are commercially available from TeleChem International (ArrayIt.TM.). Non-contact printers are of particular interest because they are more compatible with soft/flexiblesurfaces. Generally, the dispensing device includes calibrating means for controlling the amount of sample deposition, and may also include a structure for moving and positioning the sample in relation to the support surface.
The volume of fluid to be dispensed for the protein/antibody in an array varies with the intended use of the array, and available equipment. Preferably, a volume formed by one dispensation is less than 100 nl, more preferably less than 10 nl,and most preferably about 1 nl. The amount of protein/antibody present in each spot will be sufficient to provide for adequate binding of targets during the assay in which the array is employed. The spot will usually have an overall circular dimensionand the diameter will range from about 10 to 5,000 .mu.m, usually from about 20 to 1000 .mu.m and more usually from about 50 to 500 .mu.m. In preferred embodiments, these spots are about 150-200 .mu.m in diameter, to yield about 1600 spots per squarecentimeter. The size of a spot in an array corresponding to a single protein/antibody spot may be reduced through the addition of media such as glycerol or trehalose that increase the viscosity of the solution, and thereby inhibit the spreading of thesolution. Hydrophobic boundaries on a hydrophilic substrate surface can also serve to limit the size of the spots comprising an array.
Adding a humectant to the solution of the protein/antibody may also effectively prevent the dehydration of the microarrays, once they are created on the surface of the substrate. Because dehydration can result in chemical or stereochemicalchanges to proteins/antibodies, such as oxidation or denaturation, the addition of a humectant can act to preserve and stabilize the microarray and maintain the functionality of binding elements such as scFv. For example, in some preferred embodiments,scFv are coupled to maleimide-derivatized glass in phosphate-buffered saline (PBS) solutions with 40% glycerol. The glycerol helps maintain continued hydration which, in turn, helps to prevent denaturation. Solutions of blocking agents may be appliedto the microarrays to prevent non-specific binding by reactive groups that have not bound to a binding element. Solutions of bovine serum albumin (BSA), casein, or nonfat milk, for example, may be used as blocking agents to reduce background binding insubsequent assays.
In one aspect, the present invention encompasses protein and antibody arrays, including high-density microarrays, of proteins or antibodies immobilized on a substrate directly or via a linker. According to the methods of the present invention,extremely high density microarrays, with a density over 50, 100, 200, preferably over 500, further preferably over 1000, and further preferably over 2000 spots per square centimeter, can be formed by attaching an protein or antibody to a support surfacewhich has been functionalized to create a high density of reactive groups or which has been functionalized by the addition of a high density of linkers bearing reactive groups. The total number of protein/antibody spots on the substrate will varydepending on the number of different tests and conditions to be explored, as well as the number of control spots, calibrating spots and the like, as may be desired. Each distinct microarray composition may be present in duplicate or more (usually, atleast 5 replicas) to provide an internal correlation of results. Also, for some tasks it is desirable to replicate blocks, each having several identical spots.
By printing onto the surfaces of multi-well plates (preferably flat-surfaced), this combines the advantages of the array approach with those of the multi-well approach. Since the separation between tips in standard microarrayers is compatiblewith both 384-well and 96-well plates, one can simultaneously print each load in several wells. Printing into wells can be done using both contact and non-contact technology, where the latter is also compatible with non-flat multi-well plates. Thesample polypeptide or anti-biomarker antibody will be present in the solution at a concentration of from about 0.0025 to about 10 .mu.g/ml, and may be diluted in series to determine binding curves, etc.
In preferred embodiments, high-precision, contact-printing robots are used to pick up small volumes of dissolved anti-biomarker antibodies or sample polypeptides from the wells of a microtiter plate and to repetitively deliver approximately 1 nlof the solutions to defined locations on the surfaces of substrates, such as chemically-derivatized glass microscope slides. Examples of such robots include the GMS 417 Arrayer, commercially available from Affymetrix of Santa Clara, Calif., and a splitpin arrayer constructed according to instructions downloadable from the web (hypertext transfer protocol://cmgm.stanford.edu/pbrown). The chemically-derivatized glass microscope slides are preferably prepared using custom slide-sized reaction vesselsthat enable the uniform application of solution to one face of the slide. This results in the formation of microscopic spots of compounds on the slides. It will be appreciated by one of ordinary skill in the art, however, that the current invention isnot limited to the delivery of 1 nl volumes of solution, to the use of particular robotic devices, or to the use of chemically derivatized glass slides, and that alternative means of delivery can be used that are capable of delivering microliter,nanoliter, picoliter, or smaller volumes. Hence, in addition to a high precision array robot, other means for delivering the compounds can be used, including, but not limited to, ink jet printers, piezoelectric printers, and small volume pipettingrobots.
In forming arrays or microarrays of molecules on the surface of a substrate, in situ photochemistry maybe used in combination with photoactivatable reactive groups, which may be present on the surface of the substrate, on linkers, or on theproteins/antibodies. Such photoactivatable groups are well known in the art. Sample polypeptides or anti-biomarker antibodies may be tagged with fluorescent, radioactive, chromatic and other physical or chemical labels or epitopes as described indetail herein. For certain preferred embodiments where quantified labeling is possible, this yields great advantage for later assays. In a preferred embodiment, a fluorescent dye containing a hydrophilic polymer moiety such as polyethyleneglycol isused.
Upon formation of microarrays of proteins/antibodies on the solid support, large quantities of samples may be incubated with the support surface for binding assays. For protein microarrays, one or more anti-biomarker antibodies can be incubatedwith the arrays to test for levels of biomarker polypeptides or peptides. For antibody arrays, samples (e.g., extracellular media or cell lysates) can be incubated with the arrays, for example, samples obtained from cell lines or patients' cellsincubated with test substances, such as drugs, compounds, or other therapeutic agents. The samples may be derived from cell populations which have been incubated in the presence or absence of compounds or other treatments to be tested fordeleteriousness due to hepatoxicity, and differences between the treated and untreated populations may be used to assess the deleterious effects of the treatment, as described in detail herein.
The polypeptides in a given sample may be modified to enable later detection by using techniques known to one of ordinary skill in the art, such as using fluorescent, radioactive, chromatic and other physical or chemical labels. In a preferredembodiment, a fluorescent dye containing a hydrophilic polymer moiety such as polyethyleneglycol (e.g. fluorescin-PEG2000-NHS) is used. Labeling can be accomplished through direct labeling of anti-biomarker antibodies or sample polypeptides, or throughlabeling of an affinity tag (indirect labeling). Direct labeling of sample peptides or polypeptides with different fluorescent dyes makes it possible to conduct multiple assays from the same spot (e.g., measuring polypeptide levels and phosphorylationlevels).
Where direct labeling is used, over-labeling of sample polypeptides can cause aggregation, and result in non-specific staining. Over-labeling can also reduce the specificity of a anti-biomarker antibody for its target, and cause loss of signal. To prevent over-labeling, the labeling reaction time can be shortened or the substrate:label ratio can be increased. To prevent labeling of internal epitopes, sample polypeptides can be digested into peptides, and then the peptides can be labeled attheir termini. In a preferred embodiment, sample polypeptides are digested with trypsin before subjected to labeling by a succinimidyl ester dye such as Cy.TM.3, CY.TM.5 or an Alexa dye. A succinimidyle ester dye labels primary amines, such as the onein lysine. Trypsin cleaves after lysines, generating peptides with lysines at their C-terminus and no internal lysines. Thus, a succinimidyl ester dye will only label tryptic peptides at their termini.
In an alternative embodiment, another protease may be used to digest a polypeptide, and succinimidyl ester dye can be used for labeling as long as the resulting peptides do not contain internal lysines. Such peptides may be used as a preferredpanning peptides. Ideally, for preferred panning peptides, antibodies are first raised to the peptides. Sample polypeptides, e.g., from media or cell lysates, is digested with a protease or a combination of proteases that will generate the specificpanning peptides. These sample peptides are then labeled to completion with a succinimidyl ester dye. A large excess of reactive labeling reagent may be used to ensure complete labeling. Then, the labeled peptides are applied to the microarray forcapture. Because the amount of labeling on the preferential panning peptides is known, one can quantify the amount of such peptide in a given sample through the amount of label signals detected after affinity capture. Once the number of such panningpeptides resulting from the protease digestion of one target protein is known, that number can be easily translated into the amount of the target protein in the sample. Amino acids other than lysine can also be utilized with this method. For example,proteins with limited number of natural or added cysteine may be selected or constructed to be labeled, via a reduced thiol with maleimide-coupled dye such as maleimide-coupled Alexa 488 (commercially available from Molecular Probes of Eugene, Oreg.).
Indirect labeling of a sample polypeptide or anti-biomarker antibody may be achieved by using a second antibody or antibody fragment that has been labeled for subsequent detection (e.g., with radioactive atoms, fluorescent molecules) in asandwiched fashion. In a preferred embodiment, a sample polypeptide or peptide that binds to a microarray of antibodies is detected through a second fluorescently labeled antibody to the antigen, obviating the need for labeling the antigen. In afurther preferred embodiment, the second antibody is a labeled phage particle that displays an antibody fragment. Standard phage display technology using phages such as M13 may be used to produce phage antibodies including antibody fragments such asscFv. This allows relatively easy and fast production of reagents for sandwich detection from phage display antibody libraries. To ensure that the phage antibodies recognize an epitope different from the one that the immobilized capture antibodyrecognizes on the antigen, selection from phage display libraries may be carried out. First, tubes are coated with the same antibody that is immobilized in microarray for capture purpose. Next, the tube is blocked and the antigen is added and capturedby the coated antibody, and after washing, phage antibody libraries are panned in the tubes. The isolated phage antibodies (or polyclonal phage antibody) will bind only to epitopes distinct from the epitope recognized by the capture antibody, and aretherefore ideal for the sandwich detection approach.
Specific binding may be detected and measured in a number of different ways, depending on the way the target molecules in the sample are labeled. A common example is to use the technique of autoradiography to detect binding of moleculespre-labeled with radioactive isotopes. For antibody microarrays, fluorescent dyes (e.g., Cy.TM.5) can be used to label proteins in a given sample before the sample is applied to a slide surface printed with microarrays of functional scFv. Afterincubation and washes, the slide surface is then dried and imaged on a molecular dynamics STORM or ArrayWorx.TM. optical reader (Applied Precision of Seattle, Wash.). In another preferred embodiment, secondary antibodies labeled with fluorochromes suchas Cy.TM.3 are used for later detection of a primary antibody participating in the binding. Various detection methods known in the art such as mass spectrometry, surface plasmon resonance, and optical spectroscopy, to name a few, can be used in thisinvention to allow detection of binding even if binding targets are not labeled.
If expression levels of one or more genes encoding the biomarker polypeptides (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64) are elevated in the presence of hepatotoxic substances, then DNA microarrays can also be used withthe screening methods of the invention. The present invention therefore contemplates the preparation of one or more specialized microarrays (e.g., oligonucleotide microarrays or cDNA microarrays) comprising one or more of the polynucleotides encodingthe biomarker polypeptides (e.g., SEQ ID NO:46 to SEQ ID NO:60, and SEQ ID NO:65 to SEQ ID NO:68), or complementary sequences, or fragments thereof. In accordance with this aspect of the invention, the oligonucleotide sequences or cDNA sequences includeany of the disclosed polynucleotides or fragments or combinations thereof, which are highly expressed in resistant or sensitive cells, and are contained on a microarray, e.g., a oligonucleotide microarray or cDNA microarray in association with, orintroduced onto, any supporting materials, such as glass slides, nylon membrane filters, glass or polymer beads, or other types of suitable substrate material.
For DNA microarray analysis, cellular nucleic acid, e.g., RNA, can be isolated from cells incubated in the presence and absence of a substance to be tested for hepatotoxic effects. The isolated nucleic acid can be appropriately labeled andapplied to one or more of the specialized microarrays. The resulting pattern of gene expression on the specialized microarray can be analyzed as described herein and known in the art. An increase in gene expression correlating with hepatotoxicity of atleast one test substance can be determined, e.g., via comparison with the gene expression patterns in the absence of the test substance(s). If levels of biomarker gene expression in the presence of the test substance(s) are elevated relative tocontrols, then the test substance(s) is/are predicted to have hepatotoxic effects. If levels of biomarker gene expression are comparable in the presence and absence of the test substance(s), then the test substance(s) is/are predicted to havehepatotoxic effects, then the test substance(s) is/are predicted to not have hepatotoxic effects. The latter result would indicate that the test substance(s) are unlikely to produce hepatotoxicity, e.g., idiosyncratic hepatotoxicity.
Methods for producing and using DNA microarrays are well known in the art (see, e.g., J. B. Rampal, 2001, DNA Arrays: Methods and Protocols, Humana Press; M. Schena, 2002, Microarray Analysis, John Wiley & Sons; M. Schena, 2000, MicroarrayBiochip Technology, Eaton Publishing). Briefly, to determine gene expression using microarray technology, polynucleotides, e.g., RNA, DNA, cDNA, preferably RNA, are isolated from a biological sample, e.g., cells incubated in the presence or absence of atest substance. Such cells can include cells obtained from hepatic cell lines or liver samples. The isolated nucleic acid is detectably labeled, e.g., by fluorescent, enzyme, or chemiluminescent label, and applied to a microarray, e.g., one or more ofthe specialized DNA microarrays provided by this invention. The array is then washed to remove unbound material and visualized by staining or fluorescence, or other means known in the art depending on the type of label utilized.
In alternate embodiments of the invention, cell-based microarrays can be used in conjunction with the screening methods of the invention. Cell-based microarrays and their uses are well-known in the art (see, e.g., Blagoev and Pandey, 2001,Trends Biochem. Sci. 26:639-641; Ziauddin and Sabatini, 2001, Nature 411:107-110). As an example, DNA constructs for the expression of one or more cytochrome P450 enzymes can be spotted onto individual wells or a microarray platform in associationwith, or introduced onto, any supporting materials, such as glass slides, nylon membrane filters, glass or polymer beads, or other types of suitable substrate material. Following this, the spotted DNA can be incubated with a transfection solution, andhepatocytes can be added to the wells or arrays, and allowed to replicate. Next, the transfected cells can be spotted with a test substance, and assayed for biomarker expression levels, for example, levels of biomarker nucleic acids (e.g., SEQ ID NO:46to SEQ ID NO:60) or proteins (e.g., SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64), as determined by in situ assays performed on the multi-well or microarray platform.
Embodiments of the Invention
Section 1
A method of predicting hepatotoxicity of a test substance comprising: a) incubating an hepatocyte in the presence and absence of a test substance; and b) comparing levels of at least one biomarker polypeptide selected from the group consisting ofSEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64, which are produced by the hepatocyte in the presence and absence of the test substance; wherein elevated levels of the biomarker polypeptide in the presence of the test substance indicate thatthe substance is predicted to cause hepatotoxicity.
A method of predicting hepatotoxicity of a test substance comprising: a) incubating an hepatocyte in the presence and absence of a test substance; and b) comparing levels of a biomarker polypeptide as set forth in SEQ ID NO:1, which are producedby the hepatocyte in the presence and absence of the test substance; wherein elevated levels of the biomarker polypeptide in the presence of the test substance indicate that the substance is predicted to cause hepatotoxicity.
A method of predicting hepatotoxicity of a test substance comprising: a) incubating an hepatocyte in the presence and absence of a test substance; and b) comparing levels of a biomarker polypeptide as set forth in SEQ ID NO:2, which are producedby the hepatocyte in the presence and absence of the test substance; wherein elevated levels of the biomarker polypeptide in the presence of the test substance indicate that the substance is predicted to cause hepatotoxicity.
The method according to any one of the embodiments of this section, wherein the hepatotoxicity is idiosyncratic hepatotoxicity.
The method according to any one of the embodiments of this section, wherein the extracellular levels of the biomarker polypeptide are measured. In specific embodiments, the extracellular levels of the biomarker polypeptide are measured using amethod selected from the group consisting of RIA, ELISA, immunoprecipitation, and immunoblotting.
The method according to any one of the embodiments of this section, wherein the intracellular levels of the biomarker polypeptide are measured. In specific embodiments, the intracellular levels of the biomarker polypeptide are measured using amethod selected from the group consisting of immunofluorescence microscopy, indirect immunofluorescence, immunohistochemistry, and immunoblotting.
The method according to any one of the embodiments of this section which is automated.
The method according to any one of the embodiments of this section, wherein the levels of the biomarker polypeptide are measured using a hybridization technology. In specific embodiments, the hybridization technology is selected from the groupconsisting of microarrays, protein, antibody, and cell-based microarrays, PCR, RT-PCR, southern blots, northern blots, in situ hybridization, etc.
The method according to any one of the embodiments of this section, wherein the hepatocyte is obtained from a liver sample from a patient or from a liver for transplant.
The method according to any one of the embodiments of this section, wherein the hepatocyte is obtained from a hepatic cell line. In specific embodiments, the hepatic cell line is selected from the group consisting of mouse, rat, canine, porcine,and human cell lines. In other specific embodiments, the human hepatic cell line is selected from the group consisting of THLE-5, THLE-5B, THLE-5B-c15, HH25, HH29, HHY41, HuH7, Hep3B, HepG2, OUMS-29, ACTIVTox.RTM., PH5CH, HepG2/C3A, THLE-3, DBTRG-05MG,THLE-2, SW 1783, U-138 MG, and SK-LMS-1.
The method according to any one of the embodiments of this section, wherein the hepatocyte includes an expression construct comprising a human cytochrome P450 enzyme selected from the group consisting of 1A1, 1A2, 2A6, 2B6, 2C8, 2C9, 2C10, 2C19,2D6, 2E1, 3A4, 3A5, and 3A7.
The method according to any one of the embodiments of this section, wherein the test substance is selected from the group consisting of anti-cancer, anti-bacterial, anti-fungal, anti-viral, anti-hypertension, anti-depression, anti-anxiety, andanti-arthritis substances, and substances for the treatment of allergies, diabetes, hypercholesteremia, osteoporosis, Alzheimer's disease, Parkinson's disease, other neurodegenerative diseases, and obesity. In specific embodiments, test substance isselected from the group consisting of PPAR agonists, HIV protease inhibitors, anti-inflammatory drugs, estrogenic drugs, anti-estrogenic drugs, antihistimines, muscle relaxants, anti-anxiety drugs, anti-psychotic drugs, and anti-angina drugs.
Section 2
A method of predicting in vivo hepatotoxicity of a test substance comprising: a) incubating an hepatocyte in the presence and absence of a test substance; and b) comparing levels of at least one biomarker polynucleotide that encodes a polypeptideselected from the group consisting of SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64; which are produced by the hepatocyte in the presence and absence of the test substance; wherein elevated levels of the biomarker polynucleotide in thepresence of the test substance indicate that the substance is predicted to cause hepatotoxicity.
The method according to any one of the embodiments of this section, wherein the biomarker polynucleotide is selected from the group consisting of SEQ ID NO:46 to SEQ ID NO:60.
The method according to any one of the embodiments of this section, wherein the hepatotoxicity is idiosyncratic hepatotoxicity.
The method according to any one of the embodiments of this section, wherein the intracellular levels of the biomarker polynucleotide are measured. In specific embodiments, the intracellular levels are measured using a method selected from thegroup consisting of RT-PCR, Northern blotting, and in situ hybridization.
The method according to any one of the embodiments of this section which is automated.
The method according to any one of the embodiments of this section, wherein the intracellular levels of the biomarker polynucleotide are measured using a microarray. In specific embodiments, the microarray is selected from the group consistingof cDNA, oligonucleotide, and cell-based microarrays.
The method according to any one of the embodiments of this section, wherein the hepatocyte is obtained from a liver sample from a patient.
The method according to any one of the embodiments of this section, wherein the hepatocyte is obtained from a hepatic cell line. In specific embodiments, the hepatic cell line is selected from the group consisting of mouse, rat, porcine, andhuman cell lines. In other specific embodiments, the human hepatic cell line is selected from the group consisting of THLE-5, THLE-5B, THLE-5B-c15, HH25, HH29, HHY41, HuH7, Hep3B, HepG2, OUMS-29, ACTIVTox.RTM., PH5CH, HepG2/C3A, THLE-3, DBTRG-05MG,THLE-2, SW 1783, U-138 MG, and SK-LMS-1.
The method according to any one of the embodiments of this section, wherein the hepatocyte includes an expression construct comprising a human cytochrome P450 enzyme selected from the group consisting of 1A1, 1A2, 2A6, 2B6, 2C8, 2C9, 2C10, 2C19,2D6, 2E1, 3A4, 3A5, and 3A7.
The method according to any one of the embodiments of this section, wherein the test substance is selected from the group consisting of anti-cancer, anti-bacterial, anti-fungal, anti-viral, anti-hypertension, anti-depression, anti-anxiety, andanti-arthritis substances, and substances for the treatment of allergies, diabetes, hypercholesteremia, osteoporosis, Alzheimer's disease, Parkinson's disease, other neurodegenerative diseases, and obesity. In specific embodiments, test substance isselected from the group consisting of PPAR agonists, HIV protease inhibitors, anti-inflammatory drugs, estrogenic drugs, anti-estrogenic drugs, antihistimines, muscle relaxants, anti-anxiety drugs, anti-psychotic drugs, and anti-angina drugs.
Section 3
A kit for predicting in vivo hepatotoxicity of a test substance comprising: a) an antibody directed to at least one biomarker polypeptide selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64; b) atleast one reagent for detecting antibody binding to the biomarker polypeptide.
A kit for predicting in vivo hepatotoxicity of a test substance comprising: a) an antibody directed to a biomarker polypeptide as set forth in SEQ ID NO:1; b) at least one reagent for detecting antibody binding to the biomarker polypeptide.
A kit for predicting in vivo hepatotoxicity of a test substance comprising: a) an antibody directed to a biomarker polypeptide as set forth in SEQ ID NO:2; b) at least one reagent for detecting antibody binding to the biomarker polypeptide.
A kit for predicting in vivo hepatotoxicity of a test substance comprising: a) a set of two or more antibodies, wherein each antibody binds to a different biomarker polypeptide selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:15 andSEQ ID NO:61 to SEQ ID NO:64; b) at least one reagent for detecting binding of the antibodies to the biomarker polypeptides.
A kit for predicting in vivo hepatotoxicity of a test substance comprising: a) a set of two or more antibodies, wherein each antibody binds to a different biomarker polypeptide selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2; b)at least one reagent for detecting binding of the antibodies to the biomarker polypeptides.
The kit according to any one of the embodiments of this section, wherein the kit is used to detect intracellular levels of the biomarker polypeptide(s). In specific embodiments, the intracellular levels of the biomarker polypeptide(s) aremeasured using a method selected from the group consisting of immunofluorescence microscopy, indirect immunofluorescence, immunohistochemistry, and immunoblotting.
The kit according to any one of the embodiments of this section, wherein the kit is used to detect extracellular levels of the biomarker polypeptide(s). In specific embodiments, the extracellular levels of the biomarker polypeptide(s) aremeasured using a method selected from the group consisting of RIA, ELISA, immunoprecipitation, and immunoblotting.
The kit according to any one of the embodiments of this section, wherein the antibody(ies) is/are labeled with a label selected from the group consisting of fluorescent labels, enzyme labels, and radiolabels. In specific embodiments, thefluorescent labels are selected from the group consisting of Coumarin; Hydroxycoumarin; Aminocoumarin; Methoxycoumarin; R-Phycoerythrin; Fluorescein; FITC; Fluor X; DTAF; Auramine; Alexa Fluor.RTM. 350, -430, -488, -532, -546, -555, -568, -594, -633,-647, -660, -680, -700, -750; BODIPY-FL; Sulforhodamine; Texas Red.RTM., Carbocyanine; Cy2; Cy.TM.3; Cy3.5; Cy.TM.5; Cy5.5; Cy7; Rhodamine; XRITC; TRITC; Lissamine Rhodamine B; Peridinin Chlorphyll Protein (PerCP); Allophycocyanin (APC); PE-Cy5conjugates; Cychrome; Tri-Color.RTM.; Quantum Red.RTM.; PE-Cy5.5 conjugates; PE-Cy7 conjugates; PE-Texas Red conjugates; Red613; PC5-PE-Cy5 conjugates; PerCP-Cy5.5 conjugates; TruRed; APC-Cy5.5 conjugates; APC-Cy7 conjugates; ECD-PE-Texas Red conjugates;Sulfonated Pyrene; Cascade Blue; AMCA Blue; and Lucifer Yellow. In other specific embodiments, the radiolabels are selected from the group consisting of .sup.3H, .sup.14C, .sup.32P, .sup.35S, .sup.36Cl, .sup.51Cr, .sup.57Co, .sup.58Co, .sup.59Fe,.sup.90Y, .sup.125I, .sup.131I, and .sup.186Re. In further specific embodiments, the enzyme labels are selected from the group consisting of peroxidase, .beta.-glucuronidase, .beta.-D-glucosidase, .beta.-D-galactosidase, urease, glucose oxidase plusperoxidase, and alkaline phosphatase.
The kit according to any one of the embodiments of this section, wherein the antibody(ies) is/are unlabeled, but supplied with a label selected from the group consisting of fluorescent labels, enzyme labels, and radiolabels. In specificembodiments, the fluorescent labels are selected from the group consisting of Cy.TM.3, Cy.TM.5, Alexa, BODIPY, fluorescein, Fluor X, DTAF, FITC, rhodamine, TRITC, auramine, Texas Red, AMCA Blue, peridinin chlorophyll protein, phycoerythrin, ECD-PE-TexasRed tandem conjugate, PC5-PE-Cy5 tandem conjugate, allophycocyanin, and Lucifer Yellow. In other specific embodiments, the radiolabels are selected from the group consisting of .sup.3H, .sup.14C, .sup.32P, .sup.35S, .sup.36Cl, .sup.51Cr, .sup.57Co,.sup.58Co, .sup.59Fe, .sup.90Y, .sup.125I, .sup.131I, and .sup.186Re. In additional specific embodiments, the enzyme labels are selected from the group consisting of peroxidase, .beta.-glucuronidase, .beta.-D-glucosidase, .beta.-D-galactosidase, urease,glucose oxidase plus peroxidase, and alkaline phosphatase.
Section 4
A kit for predicting in vivo hepatotoxicity of a test substance comprising: a) at least one oligonucleotide that hybridizes with a biomarker polynucleotide that encodes a polypeptide selected from the group consisting of SEQ ID NO:1 to SEQ IDNO:15 and SEQ ID NO:61 to SEQ ID NO:64; b) at least one reagent for detecting hybridization to the biomarker polynucleotide.
A kit for predicting in vivo hepatotoxicity of a test substance comprising: a) at least one oligonucleotide that hybridizes with a biomarker polynucleotide selected from the group consisting of SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQID NO:68; b) at least one reagent for detecting hybridization to the biomarker polynucleotide.
A kit for predicting in vivo hepatotoxicity of a test substance comprising: a) a set of two or more oligonucleotides, wherein each oligonucleotide hybridizes to a different biomarker polynucleotide selected from the group consisting of SEQ IDNO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68; b) at least one reagent for detecting hybridization to the biomarker polynucleotides.
A kit for predicting in vivo hepatotoxicity of a test substance comprising: a) a set of two or more oligonucleotides, wherein each oligonucleotide hybridizes to a different biomarker polynucleotide selected from the group consisting of SEQ IDNO:46-SEQ ID NO:47; b) at least one reagent for detecting hybridization to the biomarker polynucleotides.
A kit for predicting in vivo hepatotoxicity of a test substance comprising: a) a set of two or more oligonucleotides, wherein each oligonucleotide hybridizes to a different biomarker polynucleotide selected from the group consisting of SEQ IDNO:1 and SEQ ID NO:2; b) at least one reagent for detecting binding of the antibodies to the biomarker polypeptides.
The kit according to any one of the embodiments of this section, wherein the oligonucleotide(s) is/are labeled with a label selected from the group consisting of radionucleotide, enzyme, fluorescent, chemiluminescent, substrate, cofactor,inhibitor, magnetic particle, and chromogenic labels. In specific embodiments, the label is selected from the group consisting of .sup.32P, .sup.3H, .sup.35S, rhodamine, fluorescein, Cy.TM.3, Cy.TM.5, DNP, digoxigenin, and biotin.
The kit according to any one of the embodiments of this section, wherein the oligonucleotide(s) is/are unlabeled, but supplied with a label selected from the group consisting of radionucleotide, enzyme, fluorescent, chemiluminescent, substrate,cofactor, inhibitor, magnetic particle, and chromogenic labels. In specific embodiments, the label is selected from the group consisting of .sup.32P, .sup.3H, .sup.35S, rhodamine, fluorescein, Cy.TM.3, Cy.TM.5, DNP, digoxigenin, and biotin.
Section 5
A microarray for predicting in vivo hepatotoxicity of a test substance comprising an antibody directed to at least one biomarker polypeptide selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64.
A microarray for predicting in vivo hepatotoxicity of a test substance comprising an antibody directed a biomarker polypeptide as set forth in SEQ ID NO:1.
A microarray for predicting in vivo hepatotoxicity of a test substance comprising an antibody directed a biomarker polypeptide as set forth in SEQ ID NO:2.
A microarray for predicting in vivo hepatotoxicity of a test substance comprising a set of two or more antibodies, wherein each antibody binds to a different biomarker polypeptide selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:15and SEQ ID NO:61 to SEQ ID NO:64.
A microarray for predicting in vivo hepatotoxicity of a test substance comprising a set of two or more antibodies, wherein each antibody binds to a different biomarker polypeptide selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2.
The microarray of any of the embodiments of this section, wherein the antibody(ies) is/are affixed to a support comprising one or more materials selected from the group consisting of glasses, ceramics, plastics, metals, alloys, carbon, papers,agarose, silica, quartz, cellulose, polymers, polyacrylamide, polyamide, gels and gelatin. In specific embodiments, the polymers are selected from the group consisting of polystyrene; poly(tetra)fluoroethylene; polyvinylidenedifluoride; polycarbonate;polymethylmethacrylate; polyvinylethylene; polyethyleneimine; polyoxymethylene; polyvinylphenol; polylactides; polymethacrylimide; polyalkenesulfone; polypropylene; polyethylene; polyhydroxyethylmethacrylate; polydimethylsiloxane; polyacrylamide;polyimide; and various block co-polymers. In other specific embodiments, the gels are selected from the group consisting of collagen gels, matrigels, and ECM gels. In additional specific embodiments, the support may be selected from the groupconsisting of glass slides coated with primary aldehyde groups, nitrocellulose films, positively charged nylon membranes, and a polyacrylamide matrix.
Section 6
A microarray for predicting in vivo hepatotoxicity of a test substance comprising at least one polynucleotide that hybridizes to a nucleic acid selected from the group consisting of SEQ ID NO:46 to SEQ ID NO:60 and SEQ ID NO:65 to SEQ ID NO:68.
A microarray for predicting in vivo hepatotoxicity of a test substance comprising an antibody directed a biomarker polypeptide as set forth in SEQ ID NO:1.
A microarray for predicting in vivo hepatotoxicity of a test substance comprising an antibody directed a biomarker polypeptide as set forth in SEQ ID NO:2.
A microarray for predicting in vivo hepatotoxicity of a test substance comprising a set of two or more antibodies, wherein each antibody binds to a different biomarker polypeptide selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:15and SEQ ID NO:61 to SEQ ID NO:64.
A microarray for predicting in vivo hepatotoxicity of a test substance comprising a set of two or more antibodies, wherein each antibody binds to a different biomarker polypeptide selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2.
The microarray of any of the embodiments of this section, wherein the oligonucleotide(s) is/are affixed to a support comprising one or more materials selected from the group consisting of glasses, ceramics, plastics, metals, alloys, carbon,papers, agarose, silica, quartz, cellulose, polymers, polyacrylamide, polyamide, gels and gelatin. In specific embodiments, the polymers are selected from the group consisting of polystyrene; poly(tetra)fluoroethylene; polyvinylidenedifluoride;polycarbonate; polymethylmethacrylate; polyvinylethylene; polyethyleneimine; polyoxymethylene; polyvinylphenol; polylactides; polymethacrylimide; polyalkenesulfone; polypropylene; polyethylene; polyhydroxyethylmethacrylate; polydimethylsiloxane;polyacrylamide; polyimide; and various block co-polymers. In other specific embodiments, the gels are selected from the group consisting of collagen gels, matrigels, and ECM gels. In additional specific embodiments, the support may be selected from thegroup consisting of glass slides coated with primary aldehyde groups, nitrocellulose films, positively charged nylon membranes, and a polyacrylamide matrix.
Section 7
A method for identifying a biomarker polypeptide that can be used to predict in vivo hepatotoxicity, comprising: a) incubating an hepatocyte in medium in the presence and absence of a test substance; and b) analyzing the medium by dimensionalpacked capillary high performance liquid chromatography coupled to tandem mass spectrometry identifying at least one polypeptide in the medium and comparing the levels of the identified polypeptide in the presence and absence of the test substance;wherein elevated levels of the polypeptide in the medium in presence of the test substance indicate identification of a biomarker polypeptide that can be used to predict in vivo hepatotoxicity.
The method according to any one of the embodiments of this section, wherein the hepatotoxicity is idiosyncratic hepatotoxicity.
The method according to any one of the embodiments of this section, wherein the levels of the polypeptide are measured using a method selected from the group consisting of RIA, ELISA, immunoprecipitation, and immunoblotting.
The method according to any one of the embodiments of this section which is automated.
The method according to any one of the embodiments of this section, wherein the levels of the polypeptide are measured using a microarray. In specific embodiments, the microarray is selected from the group consisting of protein, antibody, andcell-based microarrays.
The method according to any one of the embodiments of this section, wherein the hepatocyte is obtained from a liver sample from a patient.
The method according to any one of the embodiments of this section, wherein the hepatocyte is obtained from a hepatic cell line. In specific embodiments, the hepatic cell line is selected from the group consisting of mouse, rat, porcine, andhuman cell lines. In other specific embodiments, the human hepatic cell line is selected from the group consisting of THLE-5, THLE-5B, THLE-5B-c15, HH25, HH29, HHY41, HuH7, Hep3B, HepG2, OUMS-29, ACTIVTox.RTM., PH5CH, HepG2/C3A, THLE-3, DBTRG-05MG,THLE-2, SW 1783, U-138 MG, and SK-LMS-1.
The method according to any one of the embodiments of this section, wherein the hepatocyte includes an expression construct comprising a human cytochrome P450 enzyme selected from the group consisting of 1A1, 1A2, 2A6, 2B6, 2C8, 2C9, 2C10, 2C19,2D6, 2E1, 3A4, 3A5, and 3A7.
The method according to any one of the embodiments of this section, wherein the levels of a polypeptide selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:15 and SEQ ID NO:61 to SEQ ID NO:64 are also measured in the media in thepresence and absence of the test substance as a positive control.
The method according to any one of the embodiments of this section, wherein the test substance is selected from the group consisting of anti-cancer, anti-bacterial, anti-fungal, anti-viral, anti-hypertension, anti-depression, anti-anxiety, andanti-arthritis substances. In other embodiments, the test substance is selected from and substances for the treatment of allergies, diabetes, hypercholesteremia, osteoporosis, Alzheimer's disease, Parkinson's disease, other neurodegenerative diseases,and obesity. In specific embodiments, test substance is selected from the group consisting of PPAR agonists, HIV protease inhibitors, anti-inflammatory drugs, estrogenic drugs, anti-estrogenic drugs, antihistimines, muscle relaxants, anti-anxiety drugs,anti-psychotic drugs, and anti-angina drugs.
EXAMPLES
The Examples herein are meant to exemplify the various aspects of carrying out the invention and are not intended to limit the scope of the invention in any way. The Examples do not include detailed descriptions for conventional methodsemployed, such as biphasic high performance liquid chromatography, tandem mass spectrometry, western blotting, or enzyme linked immunosorbent assay. Such methods are well known to those skilled in the art and described in numerous publications, forexample, 2-D Proteome Analysis Protocols, Andrew J. Link, editor, Humana Press, 1999, ISBN: 0896035247; Mass Spectrometry of Proteins and Peptides, J. R. Chapman, editor, Humana Press, 2000, ISBN: 089603609X.
Example 1
Cell Culture
The human hepatocyte cell line THLE-5 (CRL-11113, ATCC, Manassas, Va.) has been immortalized by transformation with simian virus 40 large T antigen (Pfeifer, A. M., et al., 1993, Proc. Natl. Acad. Sci. U.S.A. 90:5123-5127, herebyincorporated by reference in its entirety). These immortalized cells are reported to be similar to quiescent normal human hepatocytes. In particular, the cells are observed to be non-tumorigenic when injected into nude mice, they have near-diploidkaryotypes, they do not express alpha-fetoprotein, and they are free of Hepatitis B or human immunodeficiency virus (Pfeifer et al, 1993, supra). The THLE-5 cell line (also named THLE-5B) was previously deposited under the terms and conditions of theBudapest Treaty at the American Type Culture Collection on Apr. 23, 1992, and has been assigned the accession number CRL-11113. The parent cell line, THLE-5B-c15 (T5-c15), does not express Phase I metabolizing activity, but retains normal expression ofmost Phase II metabolizing enzymes, such as glutathione S-transferase, epoxide hydrolase, N-acetyl transferase type I, aldehyde reductase, and quinone reductase, as well as detoxification systems, such as superoxide dismutase (SOD) and catalase.
The cell line THLE-5B-3A4, which expresses the 3A4 isoform of cytochrome P450, was derived by transfection of THLE-5B-c15 with a CMV expression vector comprising a human cDNA coding for the specific P450 isoenzyme and a selection marker, usingmethods known in the art. The construction of this cell line was disclosed in U.S. Ser. No. 10/285,093, "Methods of Screening for Toxicity of Test Compounds" filed Oct. 31, 2002, which is hereby incorporated by reference herein. THLE-5B cell linesexpressing 3A4 have been previously described (Krauskopf A, et al., 2002, Br. J. Pharmacol. 135(4):977-86; Mace, K., et al., 1997, Carcinogenesis 18:1291-1297). The 3A4 isoform was chosen because it is responsible for the metabolism of the largestshare of marketed pharmaceutical compounds (Evans, W. E.; Relling, M. V., 1999, Science 286:487-491).
Cells were grown in 150 mm culture dish with 50 ml of 3% fetal bovine serum-containing low calcium medium (PMFR-4, BioSource International, Camarillo, Calif.), supplemented with 1.75 uM insulin, 5 ng/ml epidermal growth factor, 10 ug/mltransferrin, 50 ng/ml triiodothyronine, and 15 ug/ml bovine pituitary extract, as supplied by the manufacturer. When the cells reached confluence, the medium was removed by aspiration, and replaced with 30 ml of serum and transferrin free PMRF-4 medium(SFM) containing either vehicle (0.5% DMSO) or compound in 0.5% DMSO.
TABLE-US-00001 TABLE 1 Toxicity Compound Concentration Class in HHA Cells DMSO N/A Vehicle Non-Toxic Rosiglitazone 50 .mu.M PPAR Agonist Non-Toxic Tesaglitazar 50 .mu.M PPAR Agonist Non-Toxic Troglitazone 32.7 .mu.M PPAR Agonist ToxicCiglitazone 38 .mu.M PPAR Agonist Toxic Farglitazar 8.61 .mu.M PPAR Agonist Toxic Indinavir 50 .mu.M HIV Protease Inhibitor Non-Toxic Ritonavir 39 .mu.M HIV Protease Inhibitor Toxic
Table 1. Names, classes, concentrations, and known toxicities of the 8 compounds used to survey the supernatants of the hepatocytes for possible biomarkers of toxicity by LC/LC/MS/MS and immunological assay.
TABLE-US-00002 TABLE 2 Toxicity in HHA Compound Concentration Class Cells DMSO N/A Vehicle Non-Toxic Pioglitazone 50 .mu.M PPAR Agonist Non-Toxic Rosiglitazone 50 .mu.M PPAR Agonist Non-Toxic Tesaglitazar 50 .mu.M PPAR Agonist Non-ToxicRagaglitazar 50 .mu.M PPAR Agonist Non-Toxic Indinavir 50 .mu.M HIV Protease Inhibitor Non-Toxic Ethinyl Estradiol 50 .mu.M Synthetic Estrogen Non-Toxic Diclofenac 50 .mu.M Anti-Inflammatory Non-Toxic Ketoprofen 50 .mu.M Anti-Inflammatory Non-ToxicIbuprofen 50 .mu.M Anti-Inflammatory Non-Toxic Dantrolene 50 .mu.M Skeletal Muscle Relaxant Toxic Troglitazone 50 .mu.M PPAR Agonist Toxic Farglitazar 50 .mu.M PPAR Agonist Toxic Ciglitazone 50 .mu.M PPAR Agonist Toxic Ritonavir 50 .mu.M HIV ProteaseInhibitor Toxic Raloxifene 50 .mu.M Selective ER Modulator Toxic Tamoxifen 50 .mu.M Non-Steroidal Anti- Toxic Estrogen Terfenadine 50 .mu.M 2.sup.nd Generation Toxic Antihistamine Trifluoperazine 50 .mu.M Anti-Anxiety/Anti- Toxic Psychotic Perhexilene 20.mu.M Antiangina Toxic
Table 2. Names, classes, concentrations, and known toxicities of the 20 compounds tested to evaluate the specificity of BMS-PTX-265 and BMS-PTX-837 as general predictors of toxicity. ER=estrogen receptor.
Cells were incubated for 20 hr at 37.degree. C. Conditioned media (i.e., media incubated with cells) was collected by decanting, then syringe-filtered through 0.22 .mu.m membrane, and stored at -70.degree. C. before preparation for LC/LC/MS/MSanalysis. LC/LC/MS/MS analysis employs multidimensional packed capillary high performance liquid chromatography coupled to tandem mass spectrometry (Link, A. J.; Eng, J.; Schieltz, D. M.; Carmack, E.; Mize, G. J.; Morris, D. R.; Garvik, B. M.; Yates, J.R., 3.sup.rd, 1999, Nat. Biotechnol. 17:676-682). This technique has been shown to be useful for the simultaneous identification of large numbers of soluble proteins, both in vivo and in vitro, without the need for antibodies (Washburn, M. P.;Wolters, D.; Yates III, J. R., 2001, Nature Biotechnol. 19:242-247). LC/LC/MS/MS analysis has also been shown to be semi-quantitative, and can be used to determine relative changes in protein levels (James X. Pang, N. G., Ashok R. Dongre, Stanley A.Hefta, and Gregory J. Opiteck, 2002, J. Proteome Res. 1:161-169; Gao, J.; Friedrichs, M.; Dongre, A. R.; Hefta, S. A.; Opiteck, G. J., 2003, J. Proteome Research, submitted.
Hepatotoxic drugs were administered to the cells at their IC.sub.50 values for cytotoxicity, which was determined in the culture system using inhibition of ATP synthesis as the endpoint (Crouch, S. P. M.; Kozlowski, R.; Slater, K. J.; Fletcher,J., 1993, J. Immunol. Methods 160:81-88) via a bioluminescence assay (CellTiter-Glo Luminescent Cell Viability Assay, Promega, Madison, Wis.; Petty, R. D.; Sutherland, L. A.; Hunter, E. M.; Cree, I. A., 1995, J Biolumin. Chemilumin. 10:29-34). Theclinically non-toxic drugs were confirmed to be non-cytotoxic in this culture system to the limit of their solubility. For the purposes of this study, the non-hepatotoxic drugs were administered at 50 .mu.M (Table 1).
Example 2
Protein Concentration, Proteolysis, and Solid Phase Extraction
Following a single thaw in a 1 L cylinder of water at room temperature, the filtered media were concentrated by centrifugal filtration (10 kDa, Pall Gelman Laboratory, Ann Arbor, Mich.). The resulting samples were chloroform methanolprecipitated (Barnidge, D. R.; Dratz, E. A.; Jesaitis, A. J.; Sunner, J., 1999, Anal. Biochem. 269:1-9) to further concentrate and remove major organic soluble impurities, and then re-solubilized in 200 .mu.l of 8 M urea/400 mM ammonium bicarbonate(Sigma, St. Louis, Mo.). The samples were then subjected to an assay for total protein by the bicinchoninic acid method (Smith, P. K.; Krohn, R. I.; Hermanson, G. T.; Mallia, A. K.; Gartner, F. H.; Provenzano, M. D.; Fujimoto, E. K.; Goeke, N. M.;Olson, B. J.; Klenk, D. C., 1985, Anal. Biochem. 150:76-85), and then normalized to 500 .mu.g of total protein. Following this, 225 nmol of dithiothreitol (Sigma) was added to each sample and then incubated for 30 min at 50.degree. C. After reduction,500 nmol of iodoacetamide (Sigma) was added to each sample and incubated in the dark at room temperature for an additional 30 min. Finally, samples were diluted four-fold and 20 .mu.g of TPCK-treated porcine trypsin (Promega, Madison, Wis.) was added toeach sample prior to incubation for 18 hr at 37.degree. C. Samples were subsequently desalted using separate C18 spin columns (Nest Group, Southboro, Mass.) before injection onto the LC/LC/MS/MS system.
Example 3
Separations and Mass Spectrometry
The digested samples were separated and analyzed using a two dimensional biphasic capillary (100 .mu.m i.d..times.365 .mu.m o.d.; Link, A. J.; Eng, J.; Schieltz, D. M.; Carmack, E.; Mize, G. J.; Morris, D. R.; Garvik, B. M.; Yates, J. R., 1999,Nat. Biotechnol. 17:676-682), which was pulled with a Model P-2000 laser puller (Sutter Instrument Company, Novato, Calif.). The capillary column was first packed with 10 cm of C18 reversed-phase material (SelfPack Poros 10 R2, ABI, Framingham,Mass.), and this was followed by 5 cm of strong cation exchange material (Poros 20 HS SCX, ABI). A load of 200 .mu.g of digested material, based on the total protein assay, was used for each analysis.
For these experiments, the four buffer solutions included Buffer A: 0.1% acetic acid, 0.2% isopropanol, 0.001% TFA in water; Buffer B: 95% acetonitrile, 0.1% acetic acid, 0.2% isopropanol, 0.001% TFA; Buffer C: 1 M ammonium acetate, 0.1% aceticacid, 0.2% isopropanol, 0.001% TFA; and Buffer D: equal to Buffer A. Fifteen fully automated LC/LC analyses were conducted for each sample. Each analysis included a salt step, followed by buffer wash, then a reversed phase run of increasing organicconcentration. Following the completion of each successive reversed phase gradient, the salt concentration was increased, and the cycle was begun again (FIG. 2).
The fifteen salt wash steps (expressed as a ratio of Buffer C to Buffer D), which were used for analyses of each sample, included: 0%, 2.5%, 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, 40%, 60%, 80%, 100% Buffer C in Buffer D. After eachsalt wash, the biphasic capillary column was washed with 100% Buffer D for 10 min followed by reversed phase separation. This separation included a 100 min analysis with a gradient of 0-40% Buffer A to B for 0 to 75 min, 40-100% B for 75-85 min, 100-0%B for 85-90 min, and finally a re-equilibration hold at 0% B for 90-100 min. The aforementioned gradients were delivered by a binary pump (1100, Agilent, Wilmington, Del.), which was split 1:200 prior to connection to the capillary column.
The capillary was interfaced with an ion trap mass spectrometer (LCQDeca, ThermoFinnigan, San Jose) equipped with a nano-LC electrospray source (Gatlin, C. L.; Eng, J. K.; Cross, S. T.; Detter, J. C.; Yates, J. R., 2000, Analyt. Chem.72:757-763). The mass spectrometer's capillary temp was set to 200.degree. C., and the spray voltage was set to 2 kV. In survey scan mode, two microscans were used to acquire 9e.sup.7 counts, with a maximum acquisition time of 1000 msec. In MS/MSmode, 3 microscans were used to acquire 2e.sup.7 counts, with a maximum acquisition time of 300 msec. The instrument was set to trigger data dependent fragmentation of the three most intense ions detected during the MS survey scan.
Example 4
Data Analysis
The SEQUEST algorithm (Eng, J. K.; McCormack, A. L.; Yates, J. R., 1994, J. Am. Soc. Mass Spectrom. 5:976-989) was used to process all mass spectral data files in conjunction with the non-redundant human protein database downloaded from theNational Center for Biotechnology Information (file transfer protocol://file transfer protocol.ncbi.nih.gov). The search results from SEQUEST were filtered (Dongre, A. R.; Opiteck, G. J.; Rios, C.; Friedrichs, M.; Hefta, S. A., 2003, J. Proteome Res.,in preparation; Tabb, D. L.; McDonald, W. H.; Yates, J. R. I., 2002, J. Proteome Research 1:21-26) based on each data file having met four out of the five acceptance criteria, i.e., Xcorr>2.5, DelCn>0.095, Sp>500, Rsp<5 and % ions >35. The list of tentative protein/peptide identifications from each sample was then compiled and compared using our proprietary ANALYSIS software package, which is similar to publicly available programs (Tabb, D. L.; McDonald, W. H.; Yates, J. R. I., 2002,J. Proteome Res. 1:21-26; Eddes, J. S.; Kapp, E. A.; Frecklington, D. F.; Connolly, L. M.; Layton, M. J.; Moritz, R. L.; Simpson, R., 2002, J. Proteomics 2:1097-1103) that determine relative changes in protein concentration on the basis of peptide"hits" from a particular protein (Gao, J.; Friedrichs, M.; Dongre, A. R.; Hefta, S. A.; Opiteck, G. 2003, J. Proteome Research, submitted; Pang, J. X.; Ginani, N.; Dongre, A. R.; Hefta, S. A.; Opiteck, G. J., 2002, J. Proteome Res. 1:161-169). Theoutput file from the ANALYSIS program was then downloaded to desktop spreadsheet programs for further statistical analysis (Excel, Microsoft, Redmond, Wash.).
Example 5
Western Blotting and ELISA Assay of BMS-PTX-265
Aliquots (10 .mu.l) of conditioned medium were diluted in an equal volume of sample buffer under reducing conditions (Nupage LDS, Invitrogen, Carlsbad, Calif.), boiled for 5 min, and resolved using 4-12% Bis Tris Gels and MES Buffer (Invitrogen). Following electrophoresis, the proteins were transferred to PVDF membrane at 30 V for 1 hr. The blots were subsequently blocked with 5% non-fat dry milk in phosphate buffered saline including 0.5% Tween-20 (Sigma), and incubated overnight at 4.degree. C. with gentle shaking. Next, the blots were probed with rabbit anti-BMS-PTX-265 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.) for 2 hr at 23.degree. C. Following incubation with an anti-rabbit secondary antibody (1:5000 dilution,Sigma), bands were visualized using an enhanced chemiluminescent detection system (ECL+, Amersham, Piscataway, N.J.) and imaged using a cooled charge-coupled device camera (Fluor S-Max, Bio-Rad, Hercules, Calif.). The signals from the blots werequantified using Quantity One software (Bio-Rad).
Western Blotting and ELISA Assay of BMS-PTX-837
The levels of BMS-PTX-837 in the conditioned media were measured with an ELISA sandwich assay using commercially available antibodies (R&D Systems, Minneapolis, Minn.). Briefly, each well of a 96-well microtiter plate was coated with 100 .mu.lof purified mouse monoclonal antibody at 2 .mu.g/ml and incubated overnight at 25.degree. C. After washing with PBS plus 0.05% Tween 20, the plate was blocked with 250 .mu.l of PBS plus 1% BSA and 5% sucrose. Standards were made (100 .mu.l of aserially diluted sample) and added to each well. Samples were then incubated with a goat polyclonal anti-BMS-PTX-837 antibody conjugated to biotin (R&D Systems) and anti-Streptavidin-HRP (Upstate Biotechnology, Lake Placid, N.Y.). After washing fourtimes with 200 .mu.l of PBS plus 0.05% Tween 20, the mixture was incubated at 25.degree. C. for 30 min in the presence of 3,3,5,5-tetramethylbenzidine. The color reaction was terminated with 2N H.sub.2SO.sub.4 (J. T. Baker, Phillipsburg, N.J.) and theoptical density was read at 450 nm with wavelength correction set at 570 nm (Rainbow Thermo Reader, Tecan, RTP, NC).
Example 6
Discovery System Results
Eight treatments (including seven distinct drugs and vehicle alone; Table 1) were chosen on the basis of their documented response in humans during clinical trials or post-marketing analyses. Within this set, Rosiglitazone, Tesaglitazar,Troglitazone, Ciglitazone, and Farglitazar were selected from the class of drugs called thiazolidinediones, also known as PPAR agonists. Troglitazone, Ciglitazone, and Farglitazar are known to be toxic, while Rosiglitazone and Tesaglitazar arenon-toxic. In addition, a set of hepatotoxic and non-hepatotoxic drugs, Indinavir and Ritonavir, were selected from the class of drugs known as HIV protease inhibitors. These drugs are distinct from the PPAR agonists both structurally and by targetclass, and were used to gain some understanding as to the selectivity and specificity of the biomarkers for tracking hepatotoxicity.
The time point of 20 hr was chosen based on the established protocol for the in vitro cytotoxicity assay, and because the same cells showed substantial changes in transcription profiles at 20 hr in gene chip array experiments (unpublishedobservations). It was therefore believed that the release of a variety of proteins into the conditioned media would take place at 20 hr. Altogether, the eight treatments were repeated in triplicate, thereby generating 24 distinct samples for analysis. The multidimensional chromatography and mass spectrometry platform was selected based on its non-discriminatory nature and its use in identifying extracellular proteins without the need for specific antibodies. This system worked remarkably well,identifying more than 1000 proteins in the conditioned media from the eight treatments. Since the goal of this project was to identify a small number of proteins that could be assayed by traditional immunological methods, this number of candidates hadto be reduced before any further verification or validation could be performed.
Example 7
Results for Selection of BMS-PTX-265 and BMS-PTX-837
Within the array of possible biomarkers, a "template" was applied to the data set to find proteins that were present at the highest concentration when treated with toxic compounds and at the lowest concentration when treated with non-toxiccompounds. The template was applied as a mathematical tool such that an artificial protein entry was listed with a value of 100 for each toxic compound, and a value of 1 for each non-toxic compound. Each of the 1000 proteins on the list were comparedto this template entry and examined for closeness of fit using a Pearson product-moment correlation coefficient (Hane, B. G.; Jager, K.; Drexler, H. G., 1993, Electrophoresis 14:967-972).
In addition, the list of candidates was also examined for potential biomarkers having commercially available antibodies that would be readily adaptable to a high throughput assay. The list was also searched for polypeptides with publications orpublished mechanisms, i.e. biological relevance, to explain their association with hepatocellular injury. This generated a subset of approximately 15 biomarkers (Table 3) that were believed to be suitable for hepatotoxicity screening.
TABLE-US-00003 TABLE 3 Protein ID DMSO Rosi Tesa Trog Ciglit Farg Ind Rit Pearson template 0 0 0 1000 1000 1000 0 1000 1.00 BMS-PTX-265 26 3 8 66 93 49 19 59 0.90 BMS-PTX-447 7 9 6 33 82 54 4 56 0.87 BMS-PTX-749 6 17 6 60 142 87 34 77 0.86BMS-PTX-607 3 0 0 7 6 13 5 11 0.84 BMS-PTX-808 5 6 1 10 14 10 2 18 0.83 BMS-PTX-860 2 3 0 4 9 15 1 12 0.83 BMS-PTX-254 0 3 1 7 28 14 2 17 0.83 BMS-PTX-225 0 0 0 11 25 10 0 28 0.83 BMS-PTX-(39)147 2 1 1 19 36 24 0 64 0.82 BMS-PTX-459 6 10 8 14 31 24 12 210.82 BMS-PTX-120 5 6 3 12 44 35 0 50 0.81 BMS-PTX-837 1 10 8 17 25 15 4 36 0.81 BMS-PTX-062 0 0 1 4 27 29 1 28 0.81 BMS-PTX-260 3 1 0 4 24 21 4 30 0.80 BMS-PTX-(29)147 11 25 31 67 239 128 32 118 0.79
Table 3. LC/LC/MS/MS data showing the peptide hits for each polypeptide and for a "template" entry. The template was the quantitative response anticipated from the known toxicity of each compound. Below it, the top 15 polypeptides identifiedare shown in descending order of their Pearson product-moment correlation coefficient to the template.
The two polypeptides that had the best match to the template, available publications, and commercially available antibodies, were BMS-PTX-265 and BMS-PTX-837. The LC/LC/MS/MS data for each of these two polypeptides is shown in FIGS. 3A and 3B. Description of the remaining 13 biomarker polypeptides is found in FIGS. 7A-7C and Table 4.
TABLE-US-00004 TABLE 4 BMS GenBank BMS Frescobi Acc. Frescobi Acc. Identifier No. (abbrev.) No. (full) No. Common name BMS-PTX-447 P1_7447 gi|65922| L-lactate dehydrogenase BMS-PTX-749 P1_246749 gi|2460318| RNA-binding protein regulatorysubunit BMS-PTX-607 P1_221607 gi|7212867| transaldolase BMS-PTX-808 P1_42808 gi|4505029| leukotriene A4 hydrolase BMS-PTX-860 P1_165860 gi|14603147| coactosin-like protein BMS-PTX-254 P51_11254 gi|4557801| purine nucleoside phosphorylase BMS-PTX-225P4_3225 gi|15216175| putative 42-9-9 protein BMS-PTX-(39)147 P1_139147 gi|2497297| activated leukocyte-cell adhesion molecule (ALCAM) BMS-PTX-459 P1_144459 gi|2136258| template activating factor-I BMS-PTX-120 P2_90120 gi|4505621| prostatic bindingprotein BMS-PTX-062 P2_66062 gi|10434265| unnamed protein product BMS-PTX-260 P2_88260 gi|20141722| serine (or cysteine) proteinase inhibitor, clade B BMS-PTX-(29)147 P1_29147 gi|119339| 2-phospho-D-glycerate hydrolyase
Table 4. GenBank Identifier Numbers and common names for 13 of the biomarker polypeptides. Columns 1 and 2 show BMS Accession information; Column 3 shows GenBank Identifier information; Column 4 shows the common name for each polypeptide. Other names are also available for these polypeptides. The polypeptide sequences of each of these biomarkers, as presented in their respective Genbank Identifier number entries, are hereby incorporated herein by reference in their entirety.
GenBank Identifier Numbers for the polynucleotides encoding the identified biomarker polypeptides, including BMS-PTX-265 and BMS-PTX-837, are shown in Table 5. SEQ ID NOs for each of the biomarker polypeptides (FIGS. 4A-4B and FIGS. 7A-7C),polynucleotides (FIGS. 9A-9H), and exemplary primers (FIGS. 8A-8B) are shown in Table 6.
TABLE-US-00005 TABLE 5 Frescobi Acc. No. (abbrev.) GenBank Ident. No. GenBank Acc. No. BMS-PTX-265 gi: 30331109 CD014650 BMS-PTX-447 gi: 12804776 BC001829 BMS-PTX-749 gi: 2460317 AF021819 BMS-PTX-607 gi: 7212866 AF058913 BMS-PTX-808 gi:4505028 NM_000895 BMS-PTX-860 gi: 14603146 BC010039 BMS-PTX-254 gi: 4557800 NM_000270 BMS-PTX-225 gi: 15216174 AJ344101 BMS-PTX-(39)147 gi: 886257 L38608 BMS-PTX-459 gi: 971271 D45198 BMS-PTX-120 gi: 4505620 NM_002567 BMS-PTX-837 gi: 30583134 BT007148BMS-PTX-062 gi: 10434264 AK022710 BMS-PTX-260 gi: 12655086 BC001394 BMS-PTX-(29)147 gi: 182113 M14328
Table 5. GenBank Identifier and Accession Numbers for the nucleotide sequences encoding the biomarker polypeptides of the invention. Columns 1 and 4 show BMS Accession information; Columns 2 and 5 show GenBank Identifier information; Columns 3and 6 show GenBank Accession information. The polynucleotide sequences of each of these biomarkers, as presented in their respective Genbank Identifier and Accession Number entries, are hereby incorporated herein by reference in their entirety.
TABLE-US-00006 TABLE 6 BMS Frescobi Acc. Polypeptides Primers Polynucleotides No. (abbrev.) SEQ ID NO: SEQ ID NO: SEQ ID NO: BMS-PTX-265 1 16, 17 46 BMS-PTX-837 2 38, 39 47 BMS-PTX-447 3 18, 19 48 BMS-PTX-749 4 20, 21 49 BMS-PTX-607 5 22, 23 50BMS-PTX-808 6 24, 25 51 BMS-PTX-860 7 26, 27 52 BMS-PTX-254 8 28, 29 53 BMS-PTX-225 9 30, 31 54 BMS-PTX-(39)147 10 32, 33 55 BMS-PTX-459 11 34, 35 56 BMS-PTX-120 12 36, 37 57 BMS-PTX-062 13 40, 41 58 BMS-PTX-260 14 42, 43 59 BMS-PTX-(29)147 15 44, 45 60Mouse BMS-PTX-265 61 69, 70 65 Mouse BMS-PTX-837 62 71, 72 66 Rat BMS-PTX-265 63 73, 74 67 Rat e BMS-PTX-837 64 75, 76 68
Table 6. Summary of the SEQ ID NOs assigned to the biomarker polypeptide sequences, polynucleotide sequences, and exemplary primer sequences of the invention.
BMS-PTX-265 is a 245 residue homodimer having a mass of 28 kDa and an isoelectric point of 4.7, making it fairly acidic. It is believed to reside in the cytoplasm (Rittinger, K.; Budman, J.; Xu, J.; Volinia, S.; Cantley, L. C.; Smerdon, S. J.;Gamblin, S. J.; Yaffe, M. B., 1999, Mol. Cell. 4:153-166) where it activates various hydroxylases and kinases and may regulate cell signaling (Van Der Hoeven, P. C.; Van Der Wal, J. C.; Ruurs, P.; Van Blitterswijk, W. J., 2000, Biochem. J.347:781-785). BMS-PTX-265 exists in several different isoforms (Chaudhri, M.; Scarabel, M.; Aitken, A., 2003, Biochem. Biophys. Res. Commun. 300:679-685). It has been reported to have phospholipase A2 activity (Zupan, L. A.; Steffens, D. L.; Berry,C. A.; Landt, M.; Gross, R. W., 1992, J. Biol. Chem. 267:8707-8710), and has been used as a biomarker for brain wasting diseases (Green, A. J., 2002, Neuropathol. Appl. Neurobiol. 28:427-440). The various names and synonyms for this protein listedon the ExPASy Molecular Biology Server (hypertext transfer protocol://us.expasy.org/) include protein kinase C inhibitor protein-1, KCIP-1, 14-3-3 zeta, 14-3-3 delta, factor activating exoenzyme S, FAS, and the product of gene YWHAZ. The amino acidsequence of BMS-PTX-265 is shown in FIG. 4A (GenBank Ident. No. 112695; GenBank Annotation: 14-3-3-zeta protein; BMS Frescobi Acc. No. (full) P1.sub.--18265).
While the LC/LC/MS/MS data for BMS-PTX-837 did not show as tight a correlation to the template as BMS-PTX-265, BMS-PTX-837 did have both commercially available antibodies and a significant number of publications. The BMS-PTX-837 enzyme is a 114residue homotrimer having a mass of 12 kDa and an isoelectric point of 8.24, making it slightly basic. BMS-PTX-837 is thought to be involved in regulating immune responses (Mitchell, R. A.; Liao, H.; Chesney, J.; Fingerle-Rowson, G.; Baugh, J.; David,J.; Bucala, R., 2002, Proc. Natl. Acad. Sci. USA 99:345-350), and may act as phenylpyruvate tautomerase (Lubetsky, J. B.; Dios, A.; Han, J.; Aljabari, B.; Ruzsicska, B.; Mitchell, R.; Lolis, E.; Al-Abed, Y., 2002, J. Biol. Chem. 277:24976-24982). The various names and synonyms for this protein listed on the ExPASy Molecular Biology Server include macrophage migration inhibitory factor, MIF, phenylpyruvate tautomerase, glycosylation-inhibiting factor, GIF, and the product of gene MMIF. The aminoacid sequence of BMS-PTX-837 is shown in FIG. 4B (GenBank Ident. No. 30583135; GenBank Annotation: macrophage migration inhibitory factor; BMS Frescobi Acc. No. (full) P166.sub.--25837).
BMS-PTX-837 was previously reported to be involved in the susceptibility of liver cells to drug induced injury (Bourdi, M.; Reilly, T. P.; Elkahloun, A. G.; George, J. W.; Pohl, L. R., 2002, Biochem. Biophys. Res. Commun. 294:225-230). However, the inventors are the first to recognize the usefulness of BMS-PTX-265, BMS-PTX-837, and the other biomarkers of the invention in predicting in vivo liver toxicity for a wide spectrum of test substances. In addition, the inventors are the firstto disclose methods of using BMS-PTX-265, BMS-PTX-837, BMS-PTX-447, BMS-PTX-749, BMS-PTX-607, BMS-PTX-808, BMS-PTX-860, BMS-PTX-254, BMS-PTX-225, BMS-PTX-(39) 147, BMS-PTX-459, BMS-PTX-120, BMS-PTX-062, BMS-PTX-260, and BMS-PTX-(29)147, or anycombination thereof, as biomarkers for in vitro screening for hepatotoxicity. More particularly, the inventors are the first to recognize the utility of BMS-PTX-265, BMS-PTX-837, and the other disclosed biomarkers for predicting in vivo idiosyncraticliver toxicity.
Example 8
Results for Verification of BMS-PTX-265 and BMS-PTX-837 by Immunological Assays
Antibodies for BMS-PTX-265 were obtained (Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.). Conditioned media samples used to identify the proteins were assayed by blotting to determine presence and relative concentrations of the proteins asa function of each treatment. This was done to verify the accuracy of the mass spectral data (Table 3) and to increase the precision of the quantitative measurements. The blotting experiments mirrored the mass spectral results (see Table 3 and FIG.5A). In addition, the increased quantitative precision of the blotting technique allowed use of a Student's t-test. This revealed a statistically significant (p<0.05) increase in levels of BMS-PTX-265 following treatment with each of the toxic PPARagonists (Troglitazone, Ciglitazone, and Farglitazar), as compared to the non-toxic treatments. None of the non-toxic PPAR agonists or the non-toxic HIV protease inhibitor produced false positive increases in BMS-PTX-265. A less statisticallysignificant increase in the levels of BMS-PTX-265 was observed after treatment with toxic HIV protease inhibitor Ritonavir (FIG. 5A).
An EIA (enzyme immunoassay) kit for BMS-PTX-837 was obtained (P/N CYT264, Chemicon International, Temecula, Calif.), and the manufacturer's protocol was followed. The same verification paradigm was used to confirm the mass spectral results forBMS-PTX-837 (Table 3). Blotting experiments produced the same pattern of response to the toxic and non-toxic compounds as seen with BMS-PTX-265 (FIG. 5B). The Student's t-test demonstrated that there was a statistically significant (p<0.05) increasein BMS-PTX-837 levels following treatment with each of the toxic drugs, as compared to the non-toxic drugs and vehicle. No false positive increases in BMS-PTX-837 were observed in connection with any of the non-toxic compounds. The toxic HIV proteaseinhibitor Ritonavir caused elevation of BMS-PTX-837 levels, but these were not found to be statistically significant.
Example 9
Results for Evaluation of Hepatotoxic-Specificity of BMS-PTX-265 and BMS-PTX-837
A larger panel of hepatotoxic and non-hepatotoxic compounds was assembled in order to evaluate the specificity of BMS-PTX-265 and BMS-PTX-837 as biomarkers for drug-induced hepatocellular toxicity. The aforementioned immunoassays for the twocandidate biomarkers were used for evaluation of this panel of drugs. This larger panel contained 20 total treatments (Table 2), including 19 drugs that were all dosed at 50 .mu.M, except perhexelene, which was dosed at 20 .mu.M due to supply limits. The original seven compounds, Rosiglitazone, Tesaglitazar, Troglitazone, Ciglitazone, Farglitazar, Indinavir, and Ritonavir, were again included in this new and larger panel for comparison to the previous experiments. The 12 new compounds introducedinto the experiment included 2 additional PPAR agonists (Ragaglitazar and Pioglitazone), 3 anti-inflammatory agents (Diclofenac, Ketoprofen, and Ibuprofen), 1 neurological drug (Trifluoperazine), 3 estrogenic hormones (Ethinyl Estradiol, Raloxifene, andTamoxifen), 1 anti-angina drug (Perhexilene), 1 muscle relaxant (Dantrolene), and 1 antihistamine (Terfenadine).
For each of the 19 drugs, a single concentration of administration was used to provide the most realistic scenario for future screening assays. In routine pre-clinic screening, little is typically known about the investigational drugs that arebeing tested. It was therefore important to design an assay that could predict the potential toxicity of various compounds prior to animal studies or human testing, without requiring knowledge of the final dose to be used. The ability to perform suchassays independent of dosage, or with very few doses, drove the selection of the concentration (50 .mu.M) for 18 of the 19 compounds tested.
The results of the duplicate experiments for the evaluation of BMS-PTX-265 are shown in FIG. 6A. As before, BMS-PTX-265 levels increased after treatment with the four original toxic compounds, Troglitazone, Ciglitazone, Farglitazar, andRitonavir. Each of the toxic compounds elicited a large increase in the concentration of BMS-PTX-265, and none of the non-toxic compounds produced a false positive response. Moreover, analysis of the additional 12 compounds showed that increasesBMS-PTX-265 levels could be used to correctly predict those drugs that elicit toxic responses in humans. The one exception was Dantrolene, which although hepatotoxic, did not induce a statistically significant increase in BMS-PTX-265 levels.
The mean value of BMS-PTX-265 levels (expressed in units of intensity relative to the vehicle) for the non-toxic compounds was 158 (SD (standard deviation) 34.6), while the mean value for the toxic compounds (omitting Dantrolene) was 1096 (SD65.1). This represents a ratio of approximately 1:7. The maximum value of a non-toxic compound (Diclofenac) was 262 (SD 18), while the minimum value for a toxic compound (Ritonavir) was 587 (SD 139). This represents a difference of 224%, which did notoverlap with any of the non-toxic compounds. The greatest observed difference was between Ragaglitazar (average value=82; SD 9; non-toxic) and Ciglitazone (average value=1317; SD 65; toxic), which represents a 1600% change. The average value of 416 (SD330) would predict a toxic response for Dantrolene, but the variation in the response makes this compound difficult to predict with a high degree of confidence based on BMS-PTX-265 levels.
BMS-PTX-837 levels were assessed in conditioned media exposed to the same 20 treatments. The results closely resembled those of the earlier experiments for BMS-PTX-265 (compare FIGS. 6A and 6B). The mean value of BMS-PTX-837 levels in theduplicate assays (expressed in units of intensity relative to the vehicle) for the non-toxic compounds was 118 (SD 8), while the mean value for the toxic compounds (omitting Dantrolene) was 584 (SD 79.5). This represents a difference of 495%. In thisassay, the maximum value of a non-toxic compound (Tesaglitazar) was 150 (SD 30), while the minimum value for a toxic compound (Ritonavir) was 198 (SD 25). This represents a difference of 132%, which is significant, but still less than the differenceobserved for BMS-PTX-265. The greatest observed difference was between Indinavir (average value=90; SD 6; non-toxic) and Raloxifene (average value=986; SD 243; toxic), representing a change of 1100%. In these experiments, Dantrolene produced an averagevalue of 149 (SD 29), which would predict a non-toxic response. Notably, less variability was observed in the results from this assay, as compared to the assay for BMS-PTX-265.
Example 10
Method of Assessing the Expression Profile of the Biomarker Polypeptides
Total RNA from tissues is isolated using the TriZol protocol (Invitrogen) and quantified by determining its absorbance at 260 nM. An assessment of the 18s and 28s ribosomal RNA bands is made by denaturing gel electrophoresis to determine RNAintegrity. The specific sequence to be measured is aligned with related genes found in GenBank to identity regions of significant sequence divergence to maximize primer and probe specificity. Gene-specific primers and probes are designed using the ABIprimer express software to amplify small amplicons (150 base pairs or less) to maximize the likelihood that the primers function at 100% efficiency. All primer/probe sequences are searched against Public Genbank databases to ensure target specificity. Primers and probes are obtained from ABI. Exemplary primer sequences for amplification of biomarker polynucleotides are shown in FIGS. 8A-8B.
To access the level of contaminating genomic DNA in the RNA, the RNA is divided into 2 aliquots and one half is treated with Rnase-free Dnase (Invitrogen). Samples from both the Dnase-treated and non-treated are then subjected to reversetranscription reactions with (RT+) and without (RT-) the presence of reverse transcriptase. TaqMan assays are carried out with gene-specific primers (see above) and the contribution of genomic DNA to the signal detected is evaluated by comparing thethreshold cycles obtained with the RT+/RT- non-Dnase treated RNA to that on the RT+/RT- Dnase treated RNA. The amount of signal contributed by genomic DNA in the Dnased RT- RNA must be less that 10% of that obtained with Dnased RT+ RNA. If this is notthe case, the RNA is not used in further experiments.
In the reverse transcription reaction, 100 ng of Dnase-treated total RNA is annealed to 2.5 .mu.M of the respective gene-specific reverse primers in the presence of 5.5 mM MgCl.sub.2 by heating the sample to 72.degree. C. for 2 min and thencooling to 55.degree. C. for 30 min. Next, 1.25 U/.mu.l of MuLv reverse transcriptase and 500 .mu.M of each dNTP is added to the reaction and the tube is incubated at 37.degree. C. for 30 min. The sample is then heated to 90.degree. C. for 5 min todenature enzyme. Quantitative sequence detection is carried out on an ABI PRISM 7700 by adding to the reverse transcribed reaction 2.5 .mu.M forward and reverse primers, 2.0 .mu.M of the TaqMan probe, 500 .mu.M of each dNTP, buffer, and 5 U AmpliTaqGold.TM.. The PCR reaction is then held at 94.degree. C. for 12 min, followed by 40 cycles of 94.degree. C. for 15 sec and 60.degree. C. for 30 sec. For data handling, the threshold cycle (Ct) of the lowest expressing tissue (the highest Ct value) isused as the baseline of expression and all other tissues are expressed as the relative abundance to that tissue by calculating the difference in Ct value between the baseline and the other tissues and using it as the exponent in 2.sup.(.DELTA.Ct)
Example 11
Methods of Validating the Hepatotaxity Biomarkers of the Present Invention In Vivo
Pre-Clinical Animal Models
All animal studies were conducted and serum samples collected by the Bristol-Myers Squibb Pharmaceutical Research Institute Departments of Drug Safety Evaluation in Syracuse, N.Y. in accordance with current Standard Operating Procedures and BMSAnimal Care and Use Committee guidelines.
Compound A--Mouse
In an intermittent-dose study in mice designed to examine potential toxicity of an immunomodulatory molecule, doses of 10 (low dose) or 50 mg/kg (high dose) were intravenously administered to groups of 12 mice, twice weekly for four weeks. Serumwas collected prestudy and at the end of the dosing period. In addition, a third group of mice was given vehicle alone (Dulbeccos's phosphate buffered saline). Western blot analyses and ELISAs were performed on 1 to 10 .mu.l of serum.
Compound B--Rat
In a single-dose study in rats designed to characterize toxicity of an exploratory cell cycle inhibitor, two groups of 20 female rats (Harlan Sprague Dawley, Frederick, Md.) were intravenously administered vehicle (2.1 mM L-tartaric acid in 0.9%NaCl) or compound at 22 mg/kg. This dose was predicted to cause significant, but non-lethal, toxicity over 32 hours. Serum was collected from each animal prior to treatment and from five rats per group at 8, 16, 24, and 32 hours post-treatment. Theprincipal toxicity observed was single cell necrosis of multiple organs including liver. Western blot analyses and ELISAs were performed on 1 to 10 .mu.l of serum.
Compound B--Dog
In a single-dose study designed to investigate toxicity of the same cell cycle inhibitor (Compound B) in dogs, one male and one female (Marshall Farms, North Rose, N.Y.) were intravenously administered 3.6 mg/kg of compound. In a previous study,this dose caused severe toxicity leading to death within 12 to 19 hours. Serum was collected from dogs predose and at 0.5, 1, 2, 3, 4, 5, 6, and 7 hours post dose. Serum was also collected from both dogs prior to euthanasia at 8 hours. As with the ratstudy of Compound B, the principal toxicity observed was necrosis of multiple organs including liver. A single microliter of serum from each dog was used for Western blot analyses.
Human Reference Plasma Samples
Reference human plasma samples were obtained in 1 ml frozen aliquots (Biological Specialty Corporation, Colmar, Pa.). These were maintained at -80.degree. C. and one microliter was used for Western blot analyses and determination of BMS-PTX-265levels. From each sample 10 .mu.l of serum was used in BMS-PTX-265 ELISAs.
BMS-PTX-265 Western Blotting
Aliquots of plasma were diluted 10-fold in sample buffer under reducing conditions (Nupage LDS, Invitrogen, Carlsbad, Calif.), boiled for 5 min. and resolved using 4-12% Bis Tris Gels and MES Buffer (Invitrogen). Following electrophoresis, theproteins were transferred to a PVDF membrane at 30 V for 1 hr, and the blots were subsequently blocked with 5% non-fat dry milk in phosphate buffered saline including 0.05% Tween-20 (Sigma) overnight at 4.degree. C. with gentle shaking. The blots wereprobed with rabbit anti-BMS-PTX-265 antibody (Santa Cruz, Calif.) for 2 hr at 23.degree. C. Following incubation with an anti-rabbit secondary antibody (1:5000 dilution, Sigma), the antibodies were visualized using enhanced chemiluminescent detection(ECL+, Amersham, Piscataway, N.J.) and imaged using a cooled charge-coupled device camera (Fluor S-Max, Bio-Rad, Hercules, Calif.). The signals from the blots were quantified using Quantity One software (Bio-Rad).
BMS-PTX-837 ELISA (Mouse and Rat Samples)
Mouse and rat BMS-PTX-837 were measured using a commercially available kit (Chemicon, Calif.) and the assay was performed per the manufacturers instructions. Samples or standards (5 .mu.l) were added to plates coated with rabbit-anti rodentBMS-PTX-837 and incubated with anti-BMS-PTX-837 conjugated to horseradish peroxidase. After a 30 min incubation with the TMB substrate at 37.degree. C., the reaction was stopped with one half volume of 2N Sulfuric acid and optical density read at 450nm (Rainbow Thermo Reader, Tecan, RTP, NC).
BMS-PTX-837 ELISA (Human Samples)
The levels of BMS-PTX-837 in the human plasma samples were measured with a ELISA sandwich assay using commercially available antibodies (R&D Systems, Minneapolis, Minn.). Briefly, each well of a 96-well microtiter plate was coated with 100 .mu.lof purified mouse monoclonal antibody at 2 ug/mL overnight at 25.degree. C. After washing with PBS+0.05% Tween 20, the plate was blocked with 250 ul of PBS+1% BSA and 5% sucrose. Standards were made (100 .mu.l of a serially diluted sample) and sampleswere then added to each well, incubated with a goat polyclonal anti-BMS-PTX-837 antibody conjugated to biotin (R&D Systems) and anti-Streptavidin-HRP. After washing four times with 200 uL of PBS+0.05% Tween 20, the mixture was incubated at 25.degree. C. for 30 min in the presence of 3,3,5,5-tetramethylbenzidine. The color reaction was terminated with one half volume 2N H.sub.2SO.sub.4 (J. T. Baker, Phillipsburg, N.J.) and the optical density read at 450 nm with wavelength correction set at 570 nm(Rainbow Thermo Reader).
BMS-PTX-265 ELISA
The protocol for BMS-PTX-265 evaluation used an isoform specific antibody as a capture and pan antibody conjugated to HRP as detection. Briefly, each well of a 96-well microtiter plate was coated with 100 .mu.l of purified rabbit antibody (SantaCruz, Calif.) at 1 ug/mL overnight at 25.degree. C. After washing with PBS/0.05% Tween 20, the plate was blocked with 250 ul of Superblock (Pierce). Serial dilutions of the standard (100 fold) and human plasma samples (20 fold dilution) were loadedonto the plates for 2 hrs at RT with shaking. The plates were washed and incubated with 100 ul of anti-BMS-PTX-265 conjugated to HRP (Santa Cruz, Calif.) at 1:1000 dilution in PBS/BSA diluent for 45 min. After washing four times with 200 uL of PBS+0.05%Tween 20, the substrate (3,3,5,5-tetramethylbenzidine) was incubated at 25.degree. C. for 15 min. The color reaction was terminated with one volume 2N Sulfuric Acid (J. T. Baker, Phillipsburg, N.J.) and the optical density read at 450 nm with wavelengthcorrection set at 570 nm (Rainbow Thermo Reader).
Generation of Recombinant BMS-PTX-265
An I.M.A.G.E. Consortium clone containing the full length coding sequence of BMS-PTX-265 was obtained (Invitrogen, Carlsbad, Calif.). After PCR and sequence verification, the complete coding sequence was cloned into a Gateway.TM. entry vector. The construct was created by performing the Gateway.TM. BP recombination reaction between the PCR product flanked by attB recombination sites and the pDONR201 donor vector containing attP recombination sites. The destination (expression) construct wasgenerated by using an LR recombination reaction between the entry construct above and the pDEST14 vector for native expression in bacteria. The entry construct contained the attL sites and the destination vector contains the attR. The result was adestination construct with the insert flanked by attB recombination sites (pDEST-BMS-PTX-265).
Purification of Recombinant BMS-PTX-265
An HPLC system (1100, Agilent, Wilmington, Del.) was used to purify BMS-PTX-265 from transfected E. coli whole cell lysates. Raw material (1 ml) was loaded onto Keystone Hypersil Biobasic C8 4.6.times.250 mm column. The flow rate was set to 1mL/min and the gradient was 0-45 min, 0-100% B; 45-50 min, 100% B; 50-51 min, 0% B; 51-60 min, 0% B. Mobile Phase A was 0.1% TFA, 0.2% IPA in H.sub.2O; Mobile Phase B was 0.1% TFA, 0.2% IPA in 95% Acetonitrile, 4.7% H.sub.2O. Fractions containingBMS-PTX-265 were identified by Western blot and then combined and lyophilized to reduce the volume 10 fold. The sample was dialyzed in 50 mM Tris buffer (Slide-A-Lyzer 7,000 MWCO, Pierce), overnight at 4.degree. C. Final volume was 7.5 mL and the finalconcentration of the sample was determined using BCA Protein Assay.
The entire disclosure of each document cited (including patents, patent applications, journal articles, abstracts, laboratory manuals, books, or other disclosures) in the Background of the Invention, Detailed Description, and Examples is herebyincorporated herein by reference. Further, the hard copy of the Sequence Listing submitted herewith and the corresponding Computer Readable Form are both incorporated herein by reference in their entireties.
As various changes can be made in the above-described subject matter without departing from the scope and spirit of the present invention, it is intended that all subject matter contained in the above description, or defined in the appendedclaims, be interpreted as descriptive and illustrative of the present invention. Many modifications and variations of the present invention are possible in light of the above teachings.
>
76 RT Homo sapiens spLys Asn Glu Leu Val Gln Lys Ala Lys Leu Ala Glu Gln Ala Arg Tyr Asp Asp Met Ala Ala Cys Met Lys Ser Val Thr Glu Gln 2 Gly Ala Glu Leu Ser Asn Glu Glu Arg Asn Leu Leu Ser Val Ala Tyr 35 4s Asn Val Val Gly Ala Arg Arg Ser SerTrp Arg Val Val Ser Ser 5 Ile Glu Gln Lys Thr Glu Gly Ala Glu Lys Lys Gln Gln Met Ala Arg 65 7 Glu Tyr Arg Glu Lys Ile Glu Thr Glu Leu Arg Asp Ile Cys Asn Asp 85 9l Leu Ser Leu Leu Glu Lys Phe Leu Ile Pro Asn Ala Ser Gln Ala Ser Lys Val Phe Tyr Leu Lys Met Lys Gly Asp Tyr Tyr Arg Tyr Ala Glu Val Ala Ala Gly Asp Asp Lys Lys Gly Ile Val Asp Gln Gln Gln Ala Tyr Gln Glu Ala Phe Glu Ile Ser Lys Lys Glu Met Gln Pro Thr HisPro Ile Arg Leu Gly Leu Ala Leu Asn Phe Ser Val Tyr Tyr Glu Ile Leu Asn Ser Pro Glu Lys Ala Cys Ser Leu Ala Thr Ala Phe Asp Glu Ala Ile Ala Glu Leu Asp Thr Leu Ser Glu 2Ser Tyr Lys Asp Ser Thr Leu Ile MetGln Leu Leu Arg Asp Asn 222hr Leu Trp Thr Ser Asp Thr Gln Gly Asp Glu Ala Glu Ala Gly 225 234ly Gly Glu Asn 245 2 Homo sapiens 2 Met Pro Met Phe Ile Val Asn Thr Asn Val Pro Arg Ala Ser Val Pro Gly Phe LeuSer Glu Leu Thr Gln Gln Leu Ala Gln Ala Thr Gly 2 Lys Pro Pro Gln Tyr Ile Ala Val His Val Val Pro Asp Gln Leu Met 35 4a Phe Gly Gly Ser Ser Glu Pro Cys Ala Leu Cys Ser Leu His Ser 5 Ile Gly Lys Ile Gly Gly Ala Gln Asn Arg Ser Tyr SerLys Leu Leu 65 7 Cys Gly Leu Leu Ala Glu Arg Leu Arg Ile Ser Pro Asp Arg Val Tyr 85 9e Asn Tyr Tyr Asp Met Asn Ala Ala Asn Val Gly Trp Asn Asn Ser Phe Ala 32 PRT Homo sapiens 3 Met Ala Thr Leu Lys Asp Gln Leu Ile TyrAsn Leu Leu Lys Glu Glu Thr Pro Gln Asn Lys Ile Thr Val Val Gly Val Gly Ala Val Gly 2 Met Ala Cys Ala Ile Ser Ile Leu Met Lys Asp Leu Ala Asp Glu Leu 35 4a Leu Val Asp Val Ile Glu Asp Lys Leu Lys Gly Glu Met Met Asp 5Leu Gln His Gly Ser Leu Phe Leu Arg Thr Pro Lys Ile Val Ser Gly 65 7 Lys Asp Tyr Asn Val Thr Ala Asn Ser Lys Leu Val Ile Ile Thr Ala 85 9y Ala Arg Gln Gln Glu Gly Glu Ser Arg Leu Asn Leu Val Gln Arg Val Asn Ile Phe Lys PheIle Ile Pro Asn Val Val Lys Tyr Ser Asn Cys Lys Leu Leu Ile Val Ser Asn Pro Val Asp Ile Leu Thr Val Ala Trp Lys Ile Ser Gly Phe Pro Lys Asn Arg Val Ile Gly Ser Gly Cys Asn Leu Asp Ser Ala Arg Phe Arg TyrLeu Met Gly Glu Leu Gly Val His Pro Leu Ser Cys His Gly Trp Val Leu Gly Glu Gly Asp Ser Ser Val Pro Val Trp Ser Gly Met Asn Val Ala Gly 2Ser Leu Lys Thr Leu His Pro Asp Leu Gly Thr Asp Lys Asp Lys 222ln Trp Lys Glu Val His Lys Gln Val Val Glu Ser Ala Tyr Glu 225 234le Lys Leu Lys Gly Tyr Thr Ser Trp Ala Ile Gly Leu Ser Val 245 25la Asp Leu Ala Glu Ser Ile Met Lys Asn Leu Arg Arg Val His Pro 267er Thr MetIle Lys Gly Leu Tyr Gly Ile Lys Asp Asp Val Phe 275 28eu Ser Val Pro Cys Ile Leu Gly Gln Asn Gly Ile Ser Asp Leu Val 29Val Thr Leu Thr Ser Glu Glu Glu Ala Arg Leu Lys Lys Ser Ala 33Asp Thr Leu Trp Gly Ile Gln Lys GluLeu Gln Phe 325 33 PRT Homo sapiens 4 Met Ala Ser Lys Arg Ala Leu Val Ile Leu Ala Lys Gly Ala Glu Glu Glu Thr Val Ile Pro Val Asp Val Met Arg Arg Ala Gly Ile Lys 2 Val Thr Val Ala Gly Leu Ala Gly Lys Asp Pro Val Gln Cys SerArg 35 4p Val Val Ile Cys Pro Asp Ala Ser Leu Glu Asp Ala Lys Lys Glu 5 Gly Pro Tyr Asp Val Val Val Leu Pro Gly Gly Asn Leu Gly Ala Gln 65 7 Asn Leu Ser Glu Ser Ala Ala Val Lys Glu Ile Leu Lys Glu Gln Glu 85 9n Arg Lys Gly LeuIle Ala Ala Ile Cys Ala Gly Pro Thr Ala Leu Ala His Glu Ile Gly Phe Gly Ser Lys Val Thr Thr His Pro Leu Lys Asp Lys Met Met Asn Gly Gly His Tyr Thr Tyr Ser Glu Asn Val Glu Lys Asp Gly Leu Ile Leu Thr SerArg Gly Pro Gly Thr Ser Phe Glu Phe Ala Leu Ala Ile Val Glu Ala Leu Asn Gly Lys Glu Ala Ala Gln Val Lys Ala Pro Leu Val Leu Lys Asp 5 337 PRT Homo sapiens 5 Met Ser Ser Ser Pro Val Lys Arg Gln Arg Met Glu Ser AlaLeu Asp Leu Lys Gln Phe Thr Thr Val Val Ala Asp Thr Gly Asp Phe His 2 Ala Ile Asp Glu Tyr Lys Pro Gln Asp Ala Thr Thr Asn Pro Ser Leu 35 4e Leu Ala Ala Ala Gln Met Pro Ala Tyr Gln Glu Leu Val Glu Glu 5 Ala Ile Ala TyrGly Arg Lys Leu Gly Gly Ser Gln Glu Asp Gln Ile 65 7 Lys Asn Ala Ile Asp Lys Leu Phe Val Leu Phe Gly Ala Glu Ile Leu 85 9s Lys Ile Pro Gly Arg Val Ser Thr Glu Val Asp Ala Arg Leu Ser Asp Lys Asp Ala Met Val Ala Arg Ala ArgArg Leu Ile Glu Leu Lys Glu Ala Gly Ile Ser Lys Asp Arg Ile Leu Ile Lys Leu Ser Thr Trp Glu Gly Ile Gln Ala Gly Lys Glu Leu Glu Glu Gln His Gly Ile His Cys Asn Met Thr Leu Leu Phe Ser Phe Ala Gln Ala Val Cys Ala Glu Ala Gly Val Thr Leu Ile Ser Pro Phe Val Gly Arg Leu Asp Trp His Val Ala Asn Thr Asp Lys Lys Ser Tyr Glu Pro 2Glu Asp Pro Gly Val Lys Ser Val Thr Lys Ile Tyr Asn Tyr Tyr 222ys PheSer Tyr Lys Thr Ile Val Met Gly Ala Ser Phe Arg Asn 225 234ly Glu Ile Lys Ala Leu Ala Gly Cys Asp Phe Leu Thr Ile Ser 245 25ro Lys Leu Leu Gly Glu Leu Leu Gln Asp Asn Ala Lys Leu Val Pro 267eu Ser Ala Lys Ala Ala GlnAla Ser Asp Leu Glu Lys Ile His 275 28eu Asp Glu Lys Ser Phe Arg Trp Leu His Asn Glu Asp Gln Met Ala 29Glu Lys Leu Ser Asp Gly Ile Arg Lys Phe Ala Ala Asp Ala Val 33Lys Leu Glu Arg Met Leu Thr Glu Arg Met Phe Asn AlaGlu Asn Gly 325 33ys 6 6Homo sapiens 6 Met Pro Glu Ile Val Asp Thr Cys Ser Leu Ala Ser Pro Ala Ser Val Arg Thr Lys His Leu His Leu Arg Cys Ser Val Asp Phe Thr Arg 2 Arg Thr Leu Thr Gly Thr Ala Ala Leu Thr Val Gln SerGln Glu Asp 35 4n Leu Arg Ser Leu Val Leu Asp Thr Lys Asp Leu Thr Ile Glu Lys 5 Val Val Ile Asn Gly Gln Glu Val Lys Tyr Ala Leu Gly Glu Arg Gln 65 7 Ser Tyr Lys Gly Ser Pro Met Glu Ile Ser Leu Pro Ile Ala Leu Ser 85 9s Asn GlnGlu Ile Val Ile Glu Ile Ser Phe Glu Thr Ser Pro Lys Ser Ala Leu Gln Trp Leu Thr Pro Glu Gln Thr Ser Gly Lys Glu Pro Tyr Leu Phe Ser Gln Cys Gln Ala Ile His Cys Arg Ala Ile Pro Cys Gln Asp Thr Pro Ser ValLys Leu Thr Tyr Thr Ala Glu Val Ser Val Pro Lys Glu Leu Val Ala Leu Met Ser Ala Ile Arg Asp Glu Thr Pro Asp Pro Glu Asp Pro Ser Arg Lys Ile Tyr Lys Phe Gln Lys Val Pro Ile Pro Cys Tyr Leu Ile Ala Leu ValVal Gly 2Leu Glu Ser Arg Gln Ile Gly Pro Arg Thr Leu Val Trp Ser Glu 222lu Gln Val Glu Lys Ser Ala Tyr Glu Phe Ser Glu Thr Glu Ser 225 234eu Lys Ile Ala Glu Asp Leu Gly Gly Pro Tyr Val Trp Gly Gln 245 25yr Asp Leu Leu Val Leu Pro Pro Ser Phe Pro Tyr Gly Gly Met Glu 267ro Cys Leu Thr Phe Val Thr Pro Thr Leu Leu Ala Gly Asp Lys 275 28er Leu Ser Asn Val Ile Ala His Glu Ile Ser His Ser Trp Thr Gly 29Leu Val Thr Asn LysThr Trp Asp His Phe Trp Leu Asn Glu Gly 33His Thr Val Tyr Leu Glu Arg His Ile Cys Gly Arg Leu Phe Gly Glu 325 33ys Phe Arg His Phe Asn Ala Leu Gly Gly Trp Gly Glu Leu Gln Asn 345al Lys Thr Phe Gly Glu Thr His Pro PheThr Lys Leu Val Val 355 36sp Leu Thr Asp Ile Asp Pro Asp Val Ala Tyr Ser Ser Val Pro Tyr 378ys Gly Phe Ala Leu Leu Phe Tyr Leu Glu Gln Leu Leu Gly Gly 385 39Glu Ile Phe Leu Gly Phe Leu Lys Ala Tyr Val Glu Lys Phe Ser44Lys Ser Ile Thr Thr Asp Asp Trp Lys Asp Phe Leu Tyr Ser Tyr 423ys Asp Lys Val Asp Val Leu Asn Gln Val Asp Trp Asn Ala Trp 435 44eu Tyr Ser Pro Gly Leu Pro Pro Ile Lys Pro Asn Tyr Asp Met Thr 456hr AsnAla Cys Ile Ala Leu Ser Gln Arg Trp Ile Thr Ala Lys 465 478sp Asp Leu Asn Ser Phe Asn Ala Thr Asp Leu Lys Asp Leu Ser 485 49er His Gln Leu Asn Glu Phe Leu Ala Gln Thr Leu Gln Arg Ala Pro 55Pro Leu Gly His Ile Lys ArgMet Gln Glu Val Tyr Asn Phe Asn 5525 Ala Ile Asn Asn Ser Glu Ile Arg Phe Arg Trp Leu Arg Leu Cys Ile 534er Lys Trp Glu Asp Ala Ile Pro Leu Ala Leu Lys Met Ala Thr 545 556ln Gly Arg Met Lys Phe Thr Arg Pro Leu Phe LysAsp Leu Ala 565 57la Phe Asp Lys Ser His Asp Gln Ala Val Arg Thr Tyr Gln Glu His 589la Ser Met His Pro Val Thr Ala Met Leu Val Gly Lys Asp Leu 595 6Lys Val Asp 62 PRT Homo sapiens 7 Met Ala Thr Lys Ile Asp Lys Glu AlaCys Arg Ala Ala Tyr Asn Leu Arg Asp Asp Gly Ser Ala Val Ile Trp Val Thr Phe Lys Tyr Asp 2 Gly Ser Thr Ile Val Pro Gly Glu Gln Gly Ala Glu Tyr Gln His Phe 35 4e Gln Gln Cys Thr Asp Asp Val Arg Leu Phe Ala Phe Val Arg Phe 5 Thr Thr Gly Asp Ala Met Ser Lys Arg Ser Lys Phe Ala Leu Ile Thr 65 7 Trp Ile Gly Glu Asn Val Ser Gly Leu Gln Arg Ala Lys Thr Gly Thr 85 9p Lys Thr Leu Val Lys Glu Val Val Gln Asn Phe Ala Lys Glu Phe Ile Ser Asp Arg LysGlu Leu Glu Glu Asp Phe Ile Lys Ser Glu Lys Lys Ala Gly Gly Ala Asn Tyr Asp Ala Gln Thr Glu 89 PRT Homo sapiens 8 Met Glu Asn Gly Tyr Thr Tyr Glu Asp Tyr Lys Asn Thr Ala Glu Trp Leu Ser His Thr Lys His Arg ProGln Val Ala Ile Ile Cys Gly 2 Ser Gly Leu Gly Gly Leu Thr Asp Lys Leu Thr Gln Ala Gln Ile Phe 35 4p Tyr Gly Glu Ile Pro Asn Phe Pro Arg Ser Thr Val Pro Gly His 5 Ala Gly Arg Leu Val Phe Gly Phe Leu Asn Gly Arg Ala Cys Val Met 65 7 Met Gln Gly Arg Phe His Met Tyr Glu Gly Tyr Pro Leu Trp Lys Val 85 9r Phe Pro Val Arg Val Phe His Leu Leu Gly Val Asp Thr Leu Val Thr Asn Ala Ala Gly Gly Leu Asn Pro Lys Phe Glu Val Gly Asp Met Leu Ile Arg AspHis Ile Asn Leu Pro Gly Phe Ser Gly Gln Pro Leu Arg Gly Pro Asn Asp Glu Arg Phe Gly Asp Arg Phe Pro Ala Met Ser Asp Ala Tyr Asp Arg Thr Met Arg Gln Arg Ala Leu Ser Trp Lys Gln Met Gly Glu Gln Arg Glu LeuGln Glu Gly Thr Tyr Met Val Ala Gly Pro Ser Phe Glu Thr Val Ala Glu Cys Arg Val 2Gln Lys Leu Gly Ala Asp Ala Val Gly Met Ser Thr Val Pro Glu 222le Val Ala Arg His Cys Gly Leu Arg Val Phe Gly Phe Ser Leu 225234hr Asn Lys Val Ile Met Asp Tyr Glu Ser Leu Glu Lys Ala Asn 245 25is Glu Glu Val Leu Ala Ala Gly Lys Gln Ala Ala Gln Lys Leu Glu 267he Val Ser Ile Leu Met Ala Ser Ile Pro Leu Pro Asp Lys Ala 275 28er 9 Homo sapiens 9 Met Ala Arg Tyr Glu Glu Val Ser Val Ser Gly Phe Glu Glu Phe His Ala Val Glu Gln His Asn Gly Lys Thr Ile Phe Ala Tyr Phe Thr 2 Gly Ser Lys Asp Ala Gly Gly Lys Ser Trp Cys Pro Asp Cys Val Gln 35 4a Glu Pro Val ValArg Glu Gly Leu Lys His Ile Ser Glu Gly Cys 5 Val Phe Ile Tyr Cys Gln Val Gly Glu Lys Pro Tyr Trp Lys Asp Pro 65 7 Asn Asn Asp Phe Arg Lys Asn Leu Lys Val Thr Ala Val Pro Thr Leu 85 9u Lys Tyr Gly Thr Pro Gln Lys Leu Val Glu Ser GluCys Leu Gln Asn Leu Val Glu Met Leu Phe Ser Glu Asp PRT Homo sapiens Glu Ser Lys Gly Ala Ser Ser Cys Arg Leu Leu Phe Cys Leu Leu Ser Ala Thr Val Phe Arg Pro Gly Leu Gly Trp Tyr Thr Val Asn 2 SerAla Tyr Gly Asp Thr Ile
Ile Ile Pro Cys Arg Leu Asp Val Pro 35 4n Asn Leu Met Phe Gly Lys Trp Lys Tyr Glu Lys Pro Asp Gly Ser 5 Pro Val Phe Ile Ala Phe Arg Ser Ser Thr Lys Lys Ser Val Gln Tyr 65 7 Asp Asp Val Pro Glu Tyr Lys Asp Arg Leu Asn Leu SerGlu Asn Tyr 85 9r Leu Ser Ile Ser Asn Ala Arg Ile Ser Asp Glu Lys Arg Phe Val Met Leu Val Thr Glu Asp Asn Val Phe Glu Ala Pro Thr Ile Val Val Phe Lys Gln Pro Ser Lys Pro Glu Ile Val Ser Lys Ala Leu Leu Glu Thr Glu Gln Leu Lys Lys Leu Gly Asp Cys Ile Ser Glu Asp Ser Tyr Pro Asp Gly Asn Ile Thr Trp Tyr Arg Asn Gly Lys Val His Pro Leu Glu Gly Ala Val Val Ile Ile Phe Lys Lys Glu Met Pro Val Thr Gln LeuTyr Thr Met Thr Ser Thr Leu Glu Tyr Lys 2Thr Lys Ala Asp Ile Gln Met Pro Phe Thr Cys Ser Val Thr Tyr 222ly Pro Ser Gly Gln Lys Thr Ile His Ser Glu Gln Ala Val Phe 225 234le Tyr Tyr Pro Thr Glu Gln Val Thr IleGln Val Leu Pro Pro 245 25ys Asn Ala Ile Lys Glu Gly Asp Asn Ile Thr Leu Lys Cys Leu Gly 267ly Asn Pro Pro Pro Glu Glu Phe Leu Phe Tyr Leu Pro Gly Gln 275 28ro Glu Gly Ile Arg Ser Ser Asn Thr Tyr Thr Leu Met Asp Val Arg 29Asn Ala Thr Gly Asp Tyr Lys Cys Ser Leu Ile Asp Lys Lys Ser 33Met Ile Ala Ser Thr Ala Ile Thr Val His Tyr Leu Asp Leu Ser Leu 325 33sn Pro Ser Gly Glu Val Thr Arg Gln Ile Gly Asp Ala Leu Pro Val 345ys ThrIle Ser Ala Ser Arg Asn Ala Thr Val Val Trp Met Lys 355 36sp Asn Ile Arg Leu Arg Ser Ser Pro Ser Phe Ser Ser Leu His Tyr 378sp Ala Gly Asn Tyr Val Cys Glu Thr Ala Leu Gln Glu Val Glu 385 39Leu Lys Lys Arg Glu Ser LeuThr Leu Ile Val Glu Gly Lys Pro 44Ile Lys Met Thr Lys Lys Thr Asp Pro Ser Gly Leu Ser Lys Thr 423le Cys His Val Glu Gly Phe Pro Lys Pro Ala Ile Gln Trp Thr 435 44le Thr Gly Ser Gly Ser Val Ile Asn Gln Thr Glu Glu SerPro Tyr 456sn Gly Arg Tyr Tyr Ser Lys Ile Ile Ile Ser Pro Glu Glu Asn 465 478hr Leu Thr Cys Thr Ala Glu Asn Gln Leu Glu Arg Thr Val Asn 485 49er Leu Asn Val Ser Ala Ile Ser Ile Pro Glu His Asp Glu Ala Asp 55Ile Ser Asp Glu Asn Arg Glu Lys Val Asn Asp Gln Ala Lys Leu 5525 Ile Val Gly Ile Val Val Gly Leu Leu Leu Ala Ala Leu Val Ala Gly 534al Tyr Trp Leu Tyr Met Lys Lys Ser Lys Thr Ala Ser Lys His 545 556sn Lys Asp LeuGly Asn Met Glu Glu Asn Lys Lys Leu Glu Glu 565 57sn Asn His Lys Thr Glu Ala 58omo sapiens Ala Pro Lys Arg Gln Ser Pro Leu Pro Pro Gln Lys Lys Lys Pro Pro Pro Pro Ala Leu Gly Pro Glu Glu Thr Ser Ala Ser Ala Gly2 Leu Pro Lys Lys Gly Glu Lys Glu Gln Gln Glu Ala Ile Glu His Ile 35 4p Glu Val Gln Asn Glu Ile Asp Arg Leu Asn Glu Gln Ala Ser Glu 5 Glu Ile Leu Lys Val Glu Gln Lys Tyr Asn Lys Leu Arg Gln Pro Phe 65 7 Phe Gln Lys Arg Ser GluLeu Ile Ala Lys Ile Pro Asn Phe Trp Val 85 9r Thr Phe Val Asn His Pro Gln Val Ser Ala Leu Leu Gly Glu Glu Glu Glu Ala Leu His Tyr Leu Thr Arg Val Glu Val Thr Glu Phe Asp Ile Lys Ser Gly Tyr Arg Ile Asp Phe Tyr PheAsp Glu Asn Tyr Phe Glu Asn Lys Val Leu Ser Lys Glu Phe His Leu Asn Glu Ser Gly Asp Pro Ser Ser Lys Ser Thr Glu Ile Lys Trp Lys Ser Gly Asp Leu Thr Lys Arg Ser Ser Gln Thr Gln Asn Lys Ala Ser Arg Arg Gln His Glu Glu Pro Glu Ser Phe Phe Thr Trp Phe Thr Asp 2Ser Asp Ala Gly Ala Asp Glu Leu Gly Glu Val Ile Lys Asp Asp 222rp Pro Asn Pro Leu Gln Tyr Tyr Leu Val Pro Asp Met Asp Asp 225 234lu Gly GluGly Glu Glu Asp Asp Asp Asp Asp Glu Glu Glu Glu 245 25ly Leu Glu Asp Ile Asp Glu Glu Gly Asp Glu Asp Glu Gly Glu Glu 267lu Asp Asp Asp Glu Gly Glu Glu Gly Glu Glu Asp Glu Gly Glu 275 28sp Asp 293 PRT Homo sapiens Val Cys Val Phe Pro Ser Gln Cys Ala Glu Leu Ser Ala Ser Pro Ser Pro Ala Pro Gly Leu Pro Arg His Ser Arg Leu His Ala Leu 2 Leu Gly Leu Ala Met Pro Val Asp Leu Ser Lys Trp Ser Gly Pro Leu 35 4r Leu Gln Glu Val Asp Glu Gln ProGln His Pro Leu His Val Thr 5 Tyr Ala Gly Ala Ala Val Asp Glu Leu Gly Lys Val Leu Thr Pro Thr 65 7 Gln Val Lys Asn Arg Pro Thr Ser Ile Ser Trp Asp Gly Leu Asp Ser 85 9y Lys Leu Tyr Thr Leu Val Leu Thr Asp Pro Asp Ala Pro Ser Arg Asp Pro Lys Tyr Arg Glu Trp His His Phe Leu Val Val Asn Met Gly Asn Asp Ile Ser Ser Gly Thr Val Leu Ser Asp Tyr Val Gly Gly Pro Pro Lys Gly Thr Gly Leu His Arg Tyr Val Trp Leu Val Tyr Glu GlnAsp Arg Pro Leu Lys Cys Asp Glu Pro Ile Leu Ser Asn Ser Gly Asp His Arg Gly Lys Phe Lys Val Ala Ser Phe Arg Lys Tyr Glu Leu Arg Ala Pro Val Ala Gly Thr Cys Tyr Gln Ala Glu 2Asp Asp Tyr Val Pro Lys Leu TyrGlu Gln Leu Ser Gly Lys 2224 PRT Homo sapiens Ser Ala Ala Glu Ala Gly Gly Val Phe His Arg Ala Arg Gly Arg Leu Ala Ala Phe Pro Ala Glu Lys Glu Ser Glu Trp Lys Gly Pro 2 Phe Tyr Phe Ile Leu Gly Ala Asp Pro Gln PheGly Leu Ile Lys Ala 35 4p Ser Thr Gly Asp Cys Asp Asn Gly Gly Asp Glu Trp Glu Gln Glu 5 Ile Arg Leu Thr Glu Gln Ala Val Gln Ala Ile Asn Lys Leu Asn Pro 65 7 Lys Pro Lys Phe Phe Val Leu Cys Gly Asp Leu Ile His Ala Met Pro 85 9yLys Pro Trp Arg Thr Glu Gln Thr Glu Asp Leu Lys Arg Val Leu Ala Val Asp Arg Ala Ile Pro Leu Val Leu Val Ser Gly Asn His Ile Gly Asn Thr Pro Thr Ala Glu Thr Val Glu Glu Phe Cys Arg Trp Gly Tyr Asp Tyr PheSer Phe Trp Val Gly Gly Val Leu Phe Leu Val Leu Asn Ser Gln Phe Tyr Glu Asn Pro Ser Lys Cys Pro Ser Lys Gln Ala Gln Asp Gln Trp Leu Asp Glu Gln Leu Ser Ile Ala Gln Arg His Cys Gln His Ala Ile Val Phe GlnHis Ile Pro Leu 2Leu Glu Ser Ile Asp Glu Asp Asp Asp Tyr Tyr Phe Asn Leu Ser 222er Thr Arg Lys Lys Leu Ala Asp Lys Phe Ile His Ala Gly Val 225 234al Val Phe Ser Gly His Tyr His Arg Asn Ala Gly Gly Thr Tyr 24525ln Asn Leu Asp Met Val Val Ser Ser Ala Ile Gly Cys Gln Leu Gly 267sp Pro His Gly Leu Arg Val Val Val Val Thr Ala Glu Lys Ile 275 28al His Arg Tyr Tyr Ser Leu Asp Glu Leu Ser Glu Lys Gly Ile Glu 29Asp Leu MetAsp Leu Ile Lys Lys Lys 3PRT Homo sapiens Ser Leu Pro Ala Leu Glu Tyr Val Ser Gly Leu Gly Ala Ala Arg Arg Trp Leu Gly Ser Ala Ile Met Asp Val Leu Ala Glu Ala Asn 2 Gly Thr Phe Ala Leu Asn Leu Leu Lys Thr Leu GlyLys Asp Asn Ser 35 4s Asn Val Phe Phe Ser Pro Met Ser Met Ser Cys Ala Leu Ala Met 5 Val Tyr Met Gly Ala Lys Gly Asn Thr Ala Ala Gln Met Ala Gln Ile 65 7 Leu Ser Phe Asn Lys Ser Gly Gly Gly Gly Asp Ile His Gln Gly Phe 85 9n SerLeu Leu Thr Glu Val Asn Lys Thr Gly Thr Gln Tyr Leu Leu Met Ala Asn Arg Leu Phe Gly Glu Lys Ser Cys Asp Phe Leu Ser Phe Arg Asp Ser Cys Gln Lys Phe Tyr Gln Ala Glu Met Glu Glu Asp Phe Ile Ser Ala Val GluLys Ser Arg Lys His Ile Asn Thr Trp Val Ala Glu Lys Thr Glu Gly Lys Ile Ala Glu Leu Leu Ser Pro Ser Val Asp Pro Leu Thr Arg Leu Val Leu Val Asn Ala Val Tyr Arg Gly Asn Trp Asp Glu Gln Phe Asp Lys Glu AsnThr Glu Glu 2Leu Phe Lys Val Ser Lys Asn Glu Glu Lys Pro Val Gln Met Met 222ys Gln Ser Thr Phe Lys Lys Thr Tyr Ile Gly Glu Ile Phe Thr 225 234le Leu Val Leu Pro Tyr Val Gly Lys Glu Leu Asn Met Ile Ile 245 25et Leu Pro Asp Glu Thr Thr Asp Leu Arg Thr Val Glu Lys Glu Leu 267yr Glu Lys Phe Val Glu Trp Thr Arg Leu Asp Met Met Asp Glu 275 28lu Glu Val Glu Val Ser Leu Pro Arg Phe Lys Leu Glu Glu Ser Tyr 29Met Glu Ser ValLeu Arg Asn Leu Gly Met Thr Asp Ala Phe Glu 33Leu Gly Lys Ala Asp Phe Ser Gly Met Ser Gln Thr Asp Leu Ser Leu 325 33er Lys Val Val His Lys Ser Phe Val Glu Val Asn Glu Glu Gly Thr 345la Ala Ala Ala Thr Ala Ala Ile MetMet Met Arg Cys Ala Arg 355 36he Val Pro Arg Phe Cys Ala Asp His Pro Phe Leu Phe Phe Ile Gln 378er Lys Thr Asn Gly Ile Leu Phe Cys Gly Arg Phe Ser Ser Pro 385 3934 PRT Homo sapiens Ser Ile Leu Lys Ile His Ala ArgGlu Ile Phe Asp Ser Arg Gly Pro Thr Val Glu Val Asp Leu Phe Thr Ser Lys Gly Leu Phe Arg 2 Ala Ala Val Pro Ser Gly Ala Ser Thr Gly Ile Tyr Glu Ala Leu Glu 35 4u Arg Asp Asn Asp Lys Thr Arg Tyr Met Gly Lys Gly Val Ser Lys 5 Ala Val Glu His Ile Asn Lys Thr Ile Ala Pro Ala Leu Val Ser Lys 65 7 Lys Leu Asn Val Thr Glu Gln Glu Lys Ile Asp Lys Leu Met Ile Glu 85 9t Asp Gly Thr Glu Asn Lys Ser Lys Phe Gly Ala Asn Ala Ile Leu Val Ser Leu Ala ValCys Lys Ala Gly Ala Val Glu Lys Gly Val Leu Tyr Arg His Ile Ala Asp Leu Ala Gly Asn Ser Glu Val Ile Pro Val Pro Ala Phe Asn Val Ile Asn Gly Gly Ser His Ala Gly Asn Lys Leu Ala Met Gln Glu Phe Met Ile LeuPro Val Gly Ala Ala Phe Arg Glu Ala Met Arg Ile Gly Ala Glu Val Tyr His Asn Leu Asn Val Ile Lys Glu Lys Tyr Gly Lys Asp Ala Thr Asn Val Gly 2Glu Gly Gly Phe Ala Pro Asn Ile Leu Glu Asn Lys Glu Gly Leu 222eu Leu Lys Thr Ala Ile Gly Lys Ala Gly Tyr Thr Asp Lys Val 225 234le Gly Met Asp Val Ala Ala Ser Glu Phe Phe Arg Ser Gly Lys 245 25yr Asp Leu Asp Phe Lys Ser Pro Asp Asp Pro Ser Arg Tyr Ile Ser 267sp GlnLeu Ala Asp Leu Tyr Lys Ser Phe Ile Lys Asp Tyr Pro 275 28al Val Ser Ile Glu Asp Pro Phe Asp Gln Asp Asp Trp Gly Ala Trp 29Lys Phe Thr Ala Ser Ala Gly Ile Gln Val Val Gly Asp Asp Leu 33Thr Val Thr Asn Pro Lys Arg IleAla Lys Ala Val Asn Glu Lys Ser 325 33ys Asn Cys Leu Leu Leu Lys Val Asn Gln Ile Gly Ser Val Thr Glu 345eu Gln Ala Cys Lys Leu Ala Gln Ala Asn Gly Trp Gly Val Met 355 36al Ser His Arg Ser Gly Glu Thr Glu Asp Thr Phe Ile AlaAsp Leu 378al Gly Leu Cys Thr Gly Gln Ile Lys Thr Gly Ala Pro Cys Arg 385 39Glu Arg Leu Ala Lys Tyr Asn Gln Leu Leu Arg Ile Glu Glu Glu 44Gly Ser Lys Ala Lys Phe Ala Gly Arg Asn Phe Arg Asn Pro Leu 423ys NA Homo sapiens ctgagc gatatgatga 2 DNA Homo sapiens tcgagc catctgctgt 2 DNA Homo sapiens agttca cccattaagc 2 DNA Homo sapiens ctctca accacctgct 2 DNA Homo sapiens 2ccgtgatgtggtcat 2 DNA Homo sapiens 2gagcc aacagagcag 2 DNA Homo sapiens 22 ggctgtgact tcctcaccat 2 DNA Homo sapiens 23 gtgcaaccaa cggaaagact 2 DNA Homo sapiens 24 actgcttgga ggaccagaga 2 DNA Homo sapiens 25 ccaggcattccaatcaactt 2 DNA Homo sapiens 26 ccgtcatctg ggtgactttt 2 DNA Homo sapiens 27 acctccttca ccagggtctt 2 DNA Homo sapiens 28 gaggcagagg gctctcagta 2 DNA Homo sapiens 29 agccaaagac tcgaagtcca 2 DNA Homo sapiens 3ggctgaagcacatta 2 DNA Homo sapiens 3tggcc tgaagacact 2 DNA Homo sapiens 32 cgcaatgcaa caggagacta
2 DNA Homo sapiens 33 ggctagatcg aagcctgatg 2 DNA Homo sapiens 34 gcaagaagcg attgaacaca 2 DNA Homo sapiens 35 gcagtgcctc ttcatcttcc 2 DNA Homo sapiens 36 atagacccac cagcatttcg 2 DNA Homo sapiens 37 actgtgccactgctgatgtc 2 DNA Homo sapiens 38 gaccagctca tggccttc omo sapiens 39 gagttgttcc agcccacatt 2 DNA Homo sapiens 4aaagg aaagcgaatg 2 DNA Homo sapiens 4ttggg tttggggttc 2 DNA Homo sapiens 42 ccaaatcttggtgcttccat 2 DNA Homo sapiens 43 agctcgaagg catcagtcat 2 DNA Homo sapiens 44 tgatgatcga gatggatgga 2 DNA Homo sapiens 45 cgccattgat gacattgaac 23 DNA Homo sapiens 46 ttagcccgac cgacagcccg tgaggatcag ctgagagccg cggttagcttagctcagaca 6atcgt tattccccga cactcagctc tgagcagcca tggacaagag cgagctagtg aaagcca agctggccga gcaggcagag cgctacgacg acatggcagc cgctatgaag gtcactg agggtgacat tgaactgtcg aacgaggagc gcaacctgct ctcggtggct 24gaacg tggtgggtgcccgtcgctca tcctggaggg tcgtctccag catcgagcag 3tggagg gtagcgacaa aaagcagcaa atggtcaagg aatatcggga aaagatcgag 36gctga aggagatctg caatgacgta ctggttcttc tggacaagta tctcatcccc 42gaccc cggctgaaag cagagtcttc tatctgaaaa tgaaaggcga ttgctttcgc48agcag aggtggctgt gggagaggag aaaaactcta tcattggcaa ttcgcaggag 54caagg atgcgtttga aat 563 47 348 DNA Homo sapiens 47 atgccgatgt tcatcgtaaa caccaacgtg ccccgcgcct ccgtgccgga cgggttcctc 6gctca cccagcagct ggcgcaggcc accggcaagc ccccccagtacatcgcggtg gtggtcc cggaccagct catggccttc ggcggctcca gcgagccgtg cgcgctctgc ctgcaca gcatcggcaa gatcggcggc gcgcagaacc gctcctacag caagctgctg 24cctgc tggccgagcg cctgcgcatc agcccggaca gggtctacat caactattac 3tgaacg cggccaatgtgggctggaac aactccacct tcgcctag 348 48 A Homo sapiens 48 ggcacgaggg agagagaacc tggagcaggc cggctgccac cttctgggct cctggggccc 6accac aagcgctgag atgcgtctgg agagccagag ggcctgcctg aaggaatcac agcctgt ccgtccacca ggagtgggga gatgcccccatccagtcctg gaggacccgc tcctgct gctcccgggg atggagcaag gccaaggctg cgggaggctg ggagccctgc 24ccatc cctcctgcac cagcgctgtc cctgcacatc ttggcagggg cacgattccg 3tcattg ccacgcgccc ccgacgaccg cccgacgtgc attcccgatt ccttttggtt 36tccaatatggcaact ctaaaggatc agctgattta taatcttcta aaggaagaac 42cccca gaataagatt acagttgttg gggttggtgc tgttggcatg gcctgtgcca 48atctt aatgaaggac ttggcagatg aacttgctct tgttgatgtc atcgaagaca 54aaggg agagatgatg gatctccaac atggcagcct tttccttagaacaccaaaga 6ctctgg caaagactat aatgtaactg caaactccaa gctggtcatt atcacggctg 66cgtca gcaagaggga gaaagccgtc ttaatttggt ccagcgtaac gtgaacatct 72ttcat cattcctaat gttgtaaaat acagcccgaa ctgcaagttg cttattgttt 78ccagt ggatatcttgacctacgtgg cttggaagat aagtggtttt cccaaaaacc 84attgg aagtggttgc aatctggatt cagcccgatt ccgttacctg atgggggaaa 9gggagt tcacccatta agctgtcatg ggtgggtcct tggggaacat ggagattcca 96cctgt atggagtgga atgaatgttg ctggtgtctc tctgaagact ctgcacccagttagggac tgataaagat aaggaacagt ggaaagaggt tcacaagcag gtggttgaga gcttatga ggtgatcaaa ctcaaaggct acacatcctg ggctattgga ctctctgtag gatttggc agagagtata atgaagaatc ttaggcgggt gcacccagtt tccaccatga aagggtct ttacggaata aaggatgatgtcttccttag tgttccttgc attttgggac aatggaat ctcagacctt gtgaaggtga ctctgacttc tgaggaagag gcccgtttga aagagtgc agatacactt tgggggatcc aaaaggagct gcaattttaa agtcttctga tcatatca tttcactgtc taggctacaa caggattcta ggtggaggtt gtgcatgttg ctttttat ctgatctgtg attaaagcag taatatttta agatggactg ggaaaaacat actcctga agttagaaat aagaatggtt tgtaaaatcc acagctatat cctgatgctg tggtatta atcttgtgta gtcttcaact ggttagtgtg aaatagttct gccacctctg gcaccact gccaatgctg tacgtactgcatttgcccct tgagccaggt ggatgtttac tgtgttat ataacttcct ggctccttca ctgaacatgc ctagtccaac attttttccc tgagtcac atcctgggat ccagtgtata aatccaatat catgtcttgt gcataattct caaaggat cttattttgt gaactatatc agtagtgtac attaccatat aatgtaaaaa tctacata caaacaatgc aaccaactat ccaagtgtta taccaactaa aacccccaat accttgaa cagtgaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aa 57omo sapiens 49 atggcttcca aaagagctct ggtcatcctg gctaaaggag cagaggaaat ggagacggtc 6tgtag atgtcatgag gcgagctggg attaaggtca ccgttgcagg cctggctgga gacccag tacagtgtag ccgtgatgtg gtcatttgtc ctgatgccag ccttgaagat aaaaaag agggaccata tgatgtggtg gttctaccag gaggtaatct gggcgcacag 24atctg agtctgctgc tgtgaaggag atactgaaggagcaggaaaa ccggaagggc 3tagccg ccatctgtgc aggtcctact gctctgttgg ctcatgaaat aggttttgga 36agtta caacacaccc tcttgctaaa gacaaaatga tgaatggagg tcattacacc 42tgaga atcgtgtgga aaaagacggc ctgattctta caagccgggg gcctgggacc 48cgagtttgcgcttgc aattgttgaa gccctgaatg gcaaggaggt ggcggctcaa 54ggctc cacttgttct taaagactag 57Homo sapiens 5gagct cacccgtgaa gcgtcagagg atggagtccg cgctggacca gctcaagcag 6caccg tggtggccga cacgggcgac ttccacgcca tcgacgagtacaagccccag gctacca ccaacccgtc cctgatcctg gccgcagcac agatgcccgc ttaccaggag gtggagg aggcgattgc ctatggccgg aagctgggcg ggtcacaaga ggaccagatt 24tgcta ttgataaact ttttgtgttg tttggagcag aaatactaaa gaagattccg 3gagtat ccacagaagtagacgcaagg ctctcctttg ataaagatgc gatggtggcc 36caggc ggctcatcga gctctacaag gaagctggga tcagcaagga ccgaattctt 42gctgt catcaacctg ggaaggaatt caggctggaa aggagctcga ggagcagcac 48ccact gcaacatgac gttactcttc tccttcgccc aggctgtggc ctgtgccgag54tgtga ccctcatctc cccatttgtt gggcgcatcc ttgattggca tgtggcaaac 6acaaga aatcctatga gcccctggaa gaccctgggg taaagagtgt cactaaaatc 66ctact acaagaagtt tagctacaaa accattgtca tgggcgcctc cttccgcaac 72cgaga tcaaagcact ggccggctgtgacttcctca ccatctcacc caagctcctg 78gctgc tgcaggacaa cgccaagctg gtgcctgtgc tctcagccaa ggcggcccaa 84tgacc tggaaaaaat ccacctggat gagaagtctt tccgttggtt gcacaacgag 9agatgg ctgtggagaa gctctctgac gggatccgca agtttgccgc tgatgcagtg 96ggagc ggatgctgac agaacgaatg ttcaatgcag agaatggaaa gtag A Homo sapiens 5cgaga tagtggatac ctgttcgttg gcctctccgg cttccgtctg ccggaccaag 6gcacc tgcgctgcag cgtcgacttt actcgccgga cgctgaccgg gactgctgct acggtcc agtctcaggaggacaatctg cgcagcctgg ttttggatac aaaggacctt atagaaa aagtagtgat caatggacaa gaagtcaaat atgctcttgg agaaagacaa 24caagg gatcgccaat ggaaatctct cttcctatcg ctttgagcaa aaatcaagaa 3ttatag aaatttcttt tgagacctct ccaaaatctt ctgctctcca gtggctcact36acaga cttctgggaa ggaacaccca tatctcttta gtcagtgcca ggccatccac 42agcaa tccttccttg tcaggacact ccttctgtga aattaaccta tactgcagag 48tgtcc ctaaagaact ggtggcactt atgagtgcta ttcgtgatgg agaaacacct 54agaag acccaagcag gaaaatatacaaattcatcc aaaaagttcc aataccctgc 6tgattg ctttagttgt tggagcttta gaaagcaggc aaattggccc aagaactttg 66gtctg agaaagagca ggtggaaaag tctgcttatg agttttctga gactgaatct 72taaaa tagcagaaga tctgggagga ccgtatgtat ggggacagta tgacctattg 78gccac catccttccc ttatggtggc atggagaatc cttgccttac ttttgtaact 84tctac tggcaggcga caagtcactc tccaatgtca ttgcacatga aatatctcat 9ggacag ggaatctagt gaccaacaaa acttgggatc acttttggtt aaatgaggga 96tgtgt acttggaacg ccacatttgc ggacgattgtttggtgaaaa gttcagacat taatgctc tgggaggatg gggagaacta cagaattcgg taaagacatt tggggagaca tcctttca ccaaacttgt ggttgatctg acagatatag accctgatgt agcttattct agttccct atgagaaggg ctttgcttta cttttttacc ttgaacaact gcttggagga agagattttcctaggatt cttaaaagct tatgttgaga agttttccta taagagcata tactgatg actggaagga tttcctgtat tcctatttta aagataaggt tgatgttctc tcaagttg attggaatgc ctggctctac tctcctggac tgcctcccat aaagcccaat tgatatga ctctgacaaa tgcttgtatt gccttaagtcaaagatggat tactgccaaa agatgatt taaattcatt caatgccaca gacctgaagg atctctcttc tcatcaattg tgagtttt tagcacagac gctccagagg gcacctcttc cattggggca cataaagcga gcaagagg tgtacaactt caatgccatt aacaattctg aaatacgatt cagatggctg gctctgcattcaatccaa gtgggaggac gcaattcctt tggcgctaaa gatggcaact acaaggaa gaatgaagtt tacccggccc ttattcaagg atcttgctgc ctttgacaaa ccatgatc aagctgtccg aacctaccaa gagcacaaag caagcatgca tcccgtgact aatgctgg tggggaaaga cttaaaagtg gattaa 429DNA Homo sapiens 52 atggccacca agatcgacaa agaggcttgc cgggcggcgt acaacctggt gcgcgacgac 6ggccg tcatctgggt gacttttaaa tatgacggct ccaccatcgt ccccggcgag ggagcgg agtaccagca cttcatccag cagtgcacag atgacgtccg gttgtttgcc gtgcgct tcaccaccggggatgccatg agcaagaggt ccaagtttgc cctcatcacg 24cggtg agaacgtcag cgggctgcag cgcgccaaaa ccgggacgga caagaccctg 3aggagg tcgtacagaa tttcgctaag gagtttgtga tcagtgatcg gaaggagctg 36agatt tcatcaagag cgagctgaag aaggcggggg gagccaatta cgacgcccag42gtaa 429 53 87omo sapiens 53 atggagaacg gatacaccta tgaagattat aagaacactg cagaatggct tctgtctcat 6gcacc gacctcaagt tgcaataatc tgtggttctg gattaggagg tctgactgat ttaactc aggcccagat ctttgactac agtgaaatcc ccaactttcc tcgaagtaca ccaggtc atgctggccg actggtgttt gggttcctga atggcagggc ctgtgtgatg 24gggca ggttccacat gtatgaaggg tacccactct ggaaggtgac attcccagtg 3ttttcc accttctggg tgtggacacc ctggtagtca ccaatgcagc aggagggctg 36caagt ttgaggttgg agatatcatg ctgatccgtgaccatatcaa cctacctggt 42tggtc agaaccctct cagagggccc aatgatgaaa ggtttggaga tcgtttccct 48gtctg atgcctacga ccggactatg aggcagaggg ctctcagtac ctggaaacaa 54ggagc aacgtgagct acaggaaggc acctatgtga tggtggcagg ccccagcttt 6ctgtggcagaatgtcg tgtgctgcag aagctgggag cagacgctgt tggcatgagt 66accag aagttatcgt tgcacggcac tgtggacttc gagtctttgg cttctcactc 72taaca aggtcatcat ggattatgaa agcctggaga aggccaacca tgaagaagtc 78agctg gcaaacaagc tgcacagaaa ttggaacagt ttgtctccattcttatggcc 84tccac tccctgacaa agccagttga 872 DNA Homo sapiens 54 atggcccgct atgaggaggt gagcgtgtcc ggcttcgagg agttccaccg ggccgtggaa 6caatg gcaagaccat tttcgcctac tttacgggtt ctaaggacgc cggggggaaa tggtgcc ccgactgcgt gcaggctgaaccagtcgtac gagaggggct gaagcacatt gaaggat gtgtgttcat ctactgccaa gtaggagaaa agccttattg gaaagatcca 24tgact tcagaaaaaa cttgaaagta acagcagtgc ctacactact taagtatgga 3ctcaaa aactggtaga atctgagtgt cttcaggcca acctggtgga aatgttgttc 36agatt aa 372 55 2539 DNA Homo sapiens 55 cgggacgacg ccccctcctg cggcgtggac tccgtcagtg gcccaccaag aaggaggagg 6ggaat ccaagggggc cagttcctgc cgtctgctct tctgcctctt gatctccgcc gtcttca ggccaggcct tggatggtat actgtaaatt cagcatatgg agataccatt atacctt gccgacttga cgtacctcag aatctcatgt ttggcaaatg gaaatatgaa 24cgatg gctccccagt atttattgcc ttcagatcct ctacaaagaa aagtgtgcag 3acgatg taccagaata caaagacaga ttgaacctct cagaaaacta cactttgtct 36taatg caaggatcag tgatgaaaag agatttgtgtgcatgctagt aactgaggac 42gtttg aggcacctac aatagtcaag gtgttcaagc aaccatctaa acctgaaatt 48caaag cactgtttct cgaaacagag cagctaaaaa agttgggtga ctgcatttca 54cagtt atccagatgg caatatcaca tggtacagga atggaaaagt gctacatccc 6aaggagcggtggtcat aatttttaaa aaggaaatgg acccagtgac tcagctctat 66gactt ccaccctgga gtacaagaca accaaggctg acatacaaat gccattcacc 72ggtga catattatgg accatctggc cagaaaacaa ttcattctga acaggcagta 78tattt actatcctac agagcaggtg acaatacaag tgctgccaccaaaaaatgcc 84agaag gggataacat cactcttaaa tgcttaggga atggcaaccc tcccccagag 9ttttgt tttacttacc aggacagccc gaaggaataa gaagctcaaa tacttacaca 96ggatg tgaggcgcaa tgcaacagga gactacaagt gttccctgat agacaaaaaa catgattg cttcaacagccatcacagtt cactatttgg atttgtcctt aaacccaagt agaagtga ctagacagat tggtgatgcc ctacccgtgt catgcacaat atctgctagc gaatgcaa ctgtggtatg gatgaaagat aacatcaggc ttcgatctag cccgtcattt tagtcttc attatcagga tgctggaaac tatgtctgcg aaactgctctgcaggaggtt aggactaa agaaaagaga gtcattgact ctcattgtag aaggcaaacc tcaaataaaa gacaaaga aaactgatcc cagtggacta tctaaaacaa taatctgcca tgtggaaggt tccaaagc cagccattca gtggacaatt actggcagtg gaagcgtcat aaaccaaaca ggaatctc cttatattaatggcaggtat tatagtaaaa ttatcatttc ccctgaagag tgttacat taacttgcac agcagaaaac caactggaga gaacagtaaa ctccttgaat ctctgcta taagtattcc agaacacgat gaggcagacg agataagtga tgaaaacaga aaaggtga atgaccaggc aaaactaatt gtgggaatcg ttgttggtctcctccttgct ccttgttg ctggtgtcgt ctactggctg tacatgaaga agtcaaagac tgcatcaaaa tgtaaaca aggacctcgg taatatggaa gaaaacaaaa agttagaaga aaacaatcac aactgaag cctaagagag aaactgtcct agttgtccag agataaaaat catatagacc ttgaagca tgaacgtggattgtatttaa gacataaaca aagacattga cagcaattca gttcaagt attaagcagt tcattctacc aagctgtcac aggttttcag agaattatct agtaaaac aaatgaaatt taattacaaa caataagaac aagttttggc agccatgata 2ggtcata tgttgtgttt ggttcaattt tttttccgta aatgtctgcactgaggattt 2tttggtt tgccttttat gtaaattttt tacgtagcta tttttataca ctgtaagctt 2tctggga gttgctgtta atctgatgta taatgtaatg tttttatttc aattgtttat 222taatc tgagcaggta catttctgat tctgattgct atcagcaatg ccccaaactt 228taagc acctaaaacccaaaggtggc agcttgtgaa gattggggac actcatattg 234attaa aaactgtgat ttttatcaca agggagggga ggccgagagt cagactgata 24ccatag gagccgactc tttgatatgc caccagcgaa ctctcagaaa taaatcacag 246tatag acacacatac ataatggtac tcccaaactg acaattttacctattctgaa 252cataa aacagaatt 2539 56 A Homo sapiens 56 cccggctggg acttccctaa cagcatggcc cctaaacgcc agtctccact cccgcctcaa 6gaaac caagaccacc tcctgctctg ggaccggagg agacatcggc ctctgcaggc ccgaaga agggagaaaa agaacagcaa gaagcgattgaacacattga tgaagtacaa gaaatag acagacttaa tgaacaagcc agtgaggaga ttttgaaagt agaacagaaa 24caaac tccgccaacc attttttcag aagaggtcag aattgatcgc caaaatccca 3tttggg taacaacatt tgtcaaccat ccacaagtgt ctgcactgct tggggaggaa 36agaggcactgcatta tttgaccaga gttgaagtga cagaatttga agatattaaa 42ttaca gaatagattt ttattttgat gaaaatcctt actttgaaaa taaagttctc 48agaat ttcatctgaa tgagagtggt gatccatctt cgaagtccac cgaaatcaaa 54atctg gaaaggattt gacgaaacgt tcgagtcaaa cgcagaataaagccagcagg 6ggcagc atgaggaacc agagagcttc tttacctggt ttactgacca ttctgatgca 66tgatg agttaggaga ggtcatcaaa gatgatattt ggccaaaccc attacagtac 72ggttc ccgatatgga tgatgaagaa ggagaaggag aagaagatga tgatgatgat 78ggagg aaggattagaagatattgac gaagaagggg atgaggatga aggtgaagaa 84agatg atgatgaagg ggaggaagga gaggaggatg aaggagaaga tgactaaata 9actgat ggattccaac cttccttttt ttaaattttc tccagtccct gggagcaagt 96tcttt tttttttttt tttttttttt ccctcttgtg ctcagtcgcc ctgttcttgatctctttt ctctactcca tggttctcaa tttatttggg gggaaatacc ttgagcagaa caatggga aaagagtctc tacccctttc tgttcgaagt tcatttttat cccttcctgt gaacaaaa actgtatgga atcaacacca ccgagctctg tgggaaaaaa gaaaaacctg ccctttgc tctgctggaa gctggagggtgctaggcccc tgtgtagtag tgtatagaat 564 DNA Homo sapiens 57 atgccggtgg acctcagcaa gtggtccggg cccttgagcc tgcaagaagt ggacgagcag 6gcacc cgctgcatgt cacctacgcc ggggcggcgg tggacgagct gggcaaagtg acgccca cccaggttaa gaatagacccaccagcattt cgtgggatgg tcttgattca aagctct acaccttggt cctgacagac ccggatgctc ccagcaggaa ggatcccaaa 24agaat ggcatcattt cctggtggtc aacatgaagg gcaatgacat cagcagtggc 3tcctct ccgattatgt gggctcgggg cctcccaagg gcacaggcct ccaccgctat 36gctgg tttacgagca ggacaggccg ctaaagtgtg acgagcccat cctcagcaac 42tggag accaccgtgg caaattcaag gtggcgtcct tccgtaaaaa gtatgagctc 48cccgg tggctggcac gtgttaccag gccgagtggg atgactatgt gcccaaactg 54gcagc tgtctgggaa gtag 564 58 945 DNAHomo sapiens 58 atgtcggctg cagaggcggg gggtgttttc cacagagcca ggggcaggac cctggccgcg 6cgcag aaaaggaaag cgaatggaaa ggcccattct acttcatcct gggcgcagac cagtttg ggctgatcaa ggcctggtcc actggggact gtgacaatgg cggtgacgaa gaacagg agatccgtctaactgagcaa gccgtccagg ccatcaacaa gctgaacccc 24caaat tcttcgttct gtgcggcgac ctcatccacg ccatgccagg gaagccgtgg 3cggagc agacggagga cctgaagcga gtgcttaggg cagtggacag ggccatccca 36ccttg tcagcggcaa ccatgacatt ggcaacaccc ccacggccga gaccgtcgag42ctgcc ggacttgggg atatgactac ttcagcttct gggtcggggg cgtcctgttc 48cctca actcccagtt ctacgagaac ccctccaaat gccccagcct gaagcaggct 54ccagt ggctggacga gcagctgagc atcgcgaggc agcggcactg ccagcatgcc 6tcttcc agcacatccc gctgttcctggagagcatcg acgaggacga cgactactac 66cctca gcaagtccac tcggaagaag ttggcagaca agttcatcca cgcaggtgtc 72cgtgt tctcaggcca ctaccacagg aatgccgggg gtacctacca
gaacctcgac 78ggtgt catctgccat tggatgccag ctgggcagag acccccacgg gctccgagtc 84ggtca ccgccgagaa aattgttcac cgatactaca gtctagatga gctgagtgag 9gaatag aagacgatct catggatttg atcaagaaaa aatga 945 59 A Homo sapiens 59ggcacgaggg attctccggg atattaccgg agacggagtg ttttattatt agcctttctt 6gacat ttccatttga attacaagtc ctttaggctg ggcgtggtgc atggctgtaa cagcacc ttgggaggct gaggcaggaa gatcacttga ggccaggcgt tggagagcag gggcaag gtggcaagaa ccttgtctct acaaaaaaaaaagcgtctgc catcatggat 24cgcag aagcaaatgg cacctttgcc ttaaaccttt tgaaaacgct gggtaaagac 3cgaaga atgtgttttt ctcacccatg agcatgtcct gtgccctggc catggtctac 36ggcaa agggaaacac cgctgcacag atggcccaga tactttcttt caataaaagt 42tggtggagacatcca ccagggcttc cagtctcttc tcaccgaagt gaacaagact 48gcagt acttgcttag ggtggccaac aggctctttg gggaaaagtc ttgtgatttc 54atctt ttagagattc ctgccaaaaa ttctaccaag cagagatgga ggagcttgac 6tcagcg ccgtagagaa gtccagaaaa cacataaaca cctgggtagctgaaaagaca 66taaaa ttgcggagtt gctctctccg ggctcagtgg atccattgac aaggctggtt 72gaatg ctgtctattt cagaggaaac tgggatgaac agtttgacaa ggagaacacc 78gagac tgtttaaagt cagcaagaat gaggagaaac ctgtgcaaat gatgtttaag 84tactt ttaagaagacctatatagga gaaatattta cccaaatctt ggtgcttcca 9ttggca aggaactgaa tatgatcatc atgcttccgg acgagaccac tgacttgaga 96ggaga aagaactcac ttacgagaag ttcgtagaat ggacgaggct ggacatgatg tgaagagg aggtggaagt gtccctcccg cggtttaaac tagaggaaag ctacgacatggagtgtcc tgcgcaacct gggcatgact gatgccttcg agctgggcaa ggcagacttc tggaatgt cccagacaga cctgtctctg tccaaggtcg tgcacaagtc ttttgtggag caatgagg aaggcacgga ggctgcagcc gccacagctg ccatcatgat gatgcggtgt cagattcg tcccccgctt ctgcgccgaccaccccttcc ttttcttcat ccagcacagc gaccaacg ggattctctt ctgcggccgc ttttcctctc cgtgaggaca gggcagtctt tgtgcagc ccctctcctc tctgtcccct gacactccac agtgtgcctg caacccaagt ccttatcc gtgcagtggt ggcagttcag aaataaaggg cccatttgtg ggatgccgca caaaaaaa aaaaaaaaaa aaa A Homo sapiens 6gatct cgccggcttt acgttcacct cggtgtctgc agcaccctcc gcttcctctc 6cgacg agacccagtg gctagaagtt caccatgtct attctcaaga tccatgccag gatcttt gactctcgcg ggaatcccac tgttgaggtt gatctcttcacctcaaaagg cttcaga gctgctgtgc ccagtggtgc ttcaactggt atctatgagg ccctagagct 24acaat gataagactc gctatatggg gaagggtgtc tcaaaggctg ttgagcacat 3aaaact attgcgcctg ccctggttag caagaaactg aacgtcacag aacaagagaa 36acaaa ctgatgatcgagatggatgg aacagaaaat aaatctaagt ttggtgcgaa 42ttctg ggggtgtccc ttgccgtctg caaagctggt gccgttgaga agggggtccc 48accgc cacatcgctg acttggctgg caactctgaa gtcatcctgc cagtcccggc 54atgtc atcaatggcg gttctcatgc tggcaacaag ctggccatgc aggagttcat6ctccca gtcggtgcag caaacttcag ggaagccatg cgcattggag cagaggttta 66acctg aagaatgtca tcaaggagaa atatgggaaa gatgccacca atgtggggga 72gcggg tttgctccca acatcctgga gaataaagaa ggcctggagc tgctgaagac 78ttggg aaagctggct acactgataaggtggtcatc ggcatggacg tagcggcctc 84tcttc aggtctggga agtatgacct ggacttcaag tctcccgatg accccagcag 9atctcg cctgaccagc tggctgacct gtacaagtcc ttcatcaagg actacccagt 96ctatc gaagatccct ttgaccagga tgactgggga gcttggcaga agttcacagc gtgcagga atccaggtag tgggggatga tctcacagtg accaacccaa agaggatcgc aggccgtg aacgagaagt cctgcaactg cctcctgctc aaagtcaacc agattggctc tgaccgag tctcttcagg cgtgcaagct ggcccaggcc aatggttggg gcgtcatggt ctcatcgt tcgggggaga ctgaagataccttcatcgct gacctggttg tggggctgtg ctgggcag atcaagactg gtgccccttg ccgatctgag cgcttggcca agtacaacca tcctcaga attgaagagg agctgggcag caaggctaag tttgccggca ggaacttcag accccttg gccaagtaag ctgtgggcag gcaagccttc ggtcacctgt tggctacaca cccctccc ctcgtgtcag ctcaggcagc tcgaggcccc cgaccaacac ttgcaggggt ctgctagt tagcgcccca ccgccgtgga gttcgtaccg cttccttaga acttctacag gccaagct ccctggagcc ctgttggcag ctctagcttt tgcagtcgtg taatgggccc gtcattgt ttttctcgcc tcactttccaccaagtgtct agagtcatgt gagcctcgtg atctccgg ggtggccaca ggctagatcc ccggtggttt tgtgctcaaa ataaaaagcc agtgaccc atgag 245 PRT Mus musculus 6sp Lys Asn Glu Leu Val Gln Lys Ala Lys Leu Ala Glu Gln Ala Arg Tyr Asp AspMet Ala Ala Cys Met Lys Ser Val Thr Glu Gln 2 Gly Ala Glu Leu Ser Asn Glu Glu Arg Asn Leu Leu Ser Val Ala Tyr 35 4s Asn Val Val Gly Ala Arg Arg Ser Ser Trp Arg Val Val Ser Ser 5 Ile Glu Gln Lys Thr Glu Gly Ala Glu Lys Lys Gln Gln MetAla Arg 65 7 Glu Tyr Arg Glu Lys Ile Glu Thr Glu Leu Arg Asp Ile Cys Asn Asp 85 9l Leu Ser Leu Leu Glu Lys Phe Leu Ile Pro Asn Ala Ser Gln Pro Ser Lys Val Phe Tyr Leu Lys Met Lys Gly Asp Tyr Tyr Arg Tyr AlaGlu Val Ala Ala Gly Asp Asp Lys Lys Gly Ile Val Asp Gln Gln Gln Ala Tyr Gln Glu Ala Phe Glu Ile Ser Lys Lys Glu Met Gln Pro Thr His Pro Ile Arg Leu Gly Leu Ala Leu Asn Phe Ser Val Tyr Tyr Glu Ile Leu AsnSer Pro Glu Lys Ala Cys Ser Leu Ala Thr Ala Phe Asp Glu Ala Ile Ala Glu Leu Asp Thr Leu Ser Glu 2Ser Tyr Lys Asp Ser Thr Leu Ile Met Gln Leu Leu Arg Asp Asn 222hr Leu Trp Thr Ser Asp Thr Gln Gly Asp Glu AlaGlu Ala Gly 225 234ly Gly Glu Asn 245 62 Mus musculus 62 Met Pro Met Phe Ile Val Asn Thr Asn Val Pro Arg Ala Ser Val Pro Gly Phe Leu Ser Glu Leu Thr Gln Gln Leu Ala Gln Ala Thr Gly 2 Lys Pro Ala Gln Tyr Ile AlaVal His Val Val Pro Asp Gln Leu Met 35 4r Phe Ser Gly Thr Asn Asp Pro Cys Ala Leu Cys Ser Leu His Ser 5 Ile Gly Lys Ile Gly Gly Ala Gln Asn Arg Asn Tyr Ser Lys Leu Leu 65 7 Cys Gly Leu Leu Ser Asp Arg Leu His Ile Ser Pro Asp Arg ValTyr 85 9e Asn Tyr Tyr Asp Met Asn Ala Ala Asn Val Gly Trp Asn Gly Ser Phe Ala 245 PRT Rattus norvegicus 63 Met Asp Lys Asn Glu Leu Val Gln Lys Ala Lys Leu Ala Glu Gln Ala Arg Tyr Asp Asp Met Ala Ala Cys Met LysSer Val Thr Glu Gln 2 Gly Ala Glu Leu Ser Asn Glu Glu Arg Asn Leu Leu Ser Val Ala Tyr 35 4s Asn Val Val Gly Ala Arg Arg Ser Ser Trp Arg Val Val Ser Ser 5 Ile Glu Gln Lys Thr Glu Gly Ala Glu Lys Lys Gln Gln Met Ala Arg 65 7 GluTyr Arg Glu Lys Ile Glu Thr Glu Leu Arg Asp Ile Cys Asn Asp 85 9l Leu Ser Leu Leu Glu Lys Phe Leu Ile Pro Asn Ala Ser Gln Pro Ser Lys Val Phe Tyr Leu Lys Met Lys Gly Asp Tyr Tyr Arg Tyr Ala Glu Val Ala Ala Gly AspAsp Lys Lys Gly Ile Val Asp Gln Gln Gln Ala Tyr Gln Glu Ala Phe Glu Ile Ser Lys Lys Glu Met Gln Pro Thr His Pro Ile Arg Leu Gly Leu Ala Leu Asn Phe Ser Val Tyr Tyr Glu Ile Leu Asn Ser Pro Glu Lys Ala CysSer Leu Ala Thr Ala Phe Asp Glu Ala Ile Ala Glu Leu Asp Thr Leu Ser Glu 2Ser Tyr Lys Asp Ser Thr Leu Ile Met Gln Leu Leu Arg Asp Asn 222hr Leu Trp Thr Ser Asp Thr Gln Gly Asp Glu Ala Glu Ala Gly 225 234ly Gly Glu Asn 245 64 Rattus norvegicus 64 Met Pro Met Phe Ile Val Asn Thr Asn Val Pro Arg Ala Ser Val Pro Gly Phe Leu Ser Glu Leu Thr Gln Gln Leu Ala Gln Ala Thr Gly 2 Lys Pro Ala Gln Tyr Ile Ala Val His Val Val ProAsp Gln Leu Met 35 4r Phe Arg Gly Thr Ser Asp Pro Cys Ala Leu Cys Ser Leu His Ser 5 Ile Gly Lys Ile Gly Gly Ala Gln Asn Arg Asn Tyr Ser Lys Leu Leu 65 7 Cys Gly Leu Leu Ser Asp Arg Leu His Ile Ser Pro Asp Arg Val Tyr 85 9e AsnTyr Tyr Asp Met Asn Ala Ala Asn Val Gly Trp Asn Gly Ser Phe Ala 738 DNA Mus musculus 65 atggataaaa atgagctggt gcagaaggcc aagctggccg agcaggcaga gcgatatgat 6ggcag cctgcatgaa gtctgtcact gagcagggag ctgagctgtc gaatgaggag aaccttc tctctgttgc ttataaaaac gttgtaggag cccgtaggtc atcgtggagg gtctcaa gtattgagca gaagacggaa ggtgctgaga aaaagcagca gatggctcga 24cagag agaagatcga gacggagctg cgtgacatct gcaacgatgt actgtctctt 3aaaagt tcttgatccc caatgcttcg caaccagaaagcaaagtctt ctatttgaaa 36gggtg actactaccg ttacttggcc gaggttgctg ctggtgatga caagaaagga 42ggacc agtcacagca agcataccaa gaagcatttg aaatcagcaa aaaggagatg 48gacac accccatcag actgggtctg gccctcaact tctctgtgtt ctattacgag 54gaactccccagagaa agcctgctct cttgcaaaaa cagctttcga tgaagccatt 6aacttg atacattaag tgaagagtcg tacaaagaca gcacgctaat aatgcagtta 66agaca acttaacatt gtggacatcg gatacccaag gagatgaagc agaagcagga 72agggg aaaattaa 738 66 348 DNA Mus musculus 66atgcctatgt tcatcgtgaa caccaatgtt ccccgcgcct ccgtgccaga ggggtttctg 6gctca cccagcagct ggcgcaggcc accggcaagc ccgcacagta catcgcagtg gtggtcc cggaccagct catgactttt agcggcacga acgatccctg cgccctctgc ctgcaca gcatcggcaa gatcggtggt gcccagaaccgcaactacag taagctgctg 24cctgc tgtccgatcg cctgcacatc agcccggacc gggtctacat caactattac 3tgaacg ctgccaacgt gggctggaac ggttccacct tcgcttga 348 67 738 DNA Rattus norvegicus 67 atggataaaa atgagctggt gcagaaggcc aagctggccg agcaggcaga gcgatacgat 6ggcag cctgcatgaa gtctgtcact gagcaaggag ccgagctgtc taacgaggag aaccttc tctctgttgc ttataaaaac gttgtaggag cccgtaggtc atcttggagg gtctcga gtattgagca gaagacggaa ggtgctgaga aaaagcagca gatggctcga 24cagag agaagatcga gacggagctg agggacatctgcaacgacgt actgtctctt 3aaaagt tcttgatccc caatgcttcg cagccagaaa gcaaagtctt ctatttgaaa 36gggtg actactaccg ctacttggct gaggttgctg ctggtgatga caagaaagga 42ggacc agtcacagca agcataccaa gaagcatttg aaatcagcaa aaaggagatg 48gacacaccccatcag actgggtctg gccctcaact tctctgtgtt ctactatgag 54gaact ccccagagaa agcctgctct cttgcaaaaa cagcttttga tgaagccatt 6aacttg atacattaag tgaagagtcg tacaaagaca gcacgctaat aatgcagtta 66agaca acttgacatt gtggacatcg gatacccaag gagacgaagcagaagcggga 72agggg aaaattaa 738 68 348 DNA Rattus norvegicus 68 atgcctatgt tcatcgtgaa caccaatgtt ccccgcgcct ccgtgccaga ggggtttctc 6gctca cccagcagct ggcgcaggcc accggcaagc cggcacagta catcgcagtg gtggtcc cggaccagct catgactttt agaggcacgagcgacccctg cgccctctgc ctgcaca gcatcggcaa gatcggtggc gcccagaacc gcaactacag caagctgctg 24cctgc tgtccgatcg cctgcacatc agcccggacc gggtctacat caactattac 3tgaacg cagccaacgt gggctggaac ggttccacct tcgcttga 348 69 2us musculus 69agcaggcaga gcgatatgat 2 DNA Mus musculus 7atctg ctgctttttc 2 DNA Mus musculus 7agagg ggtttctgt us musculus 72 aggccacaca gcagcttact 2 DNA Rattus norvegicus 73 ttgagcagaa gacggaaggt 2 DNA Rattusnorvegicus 74 cctcagccaa gtagcggtag 2 DNA Rattus norvegicus 75 gtgccagagg ggtttctctc 2 DNA Rattus norvegicus 76 cagcagcttg ctgtagttgc 2BR>* * * * *