Easy To Use Patents Search & Patent Lawyer Directory

At Patents you can conduct a Patent Search, File a Patent Application, find a Patent Attorney, or search available technology through our Patent Exchange. Patents are available using simple keyword or date criteria. If you are looking to hire a patent attorney, you've come to the right place. Protect your idea and hire a patent lawyer.

Searching:





Search by keyword, patent number, inventor, assignee, city or state:




Patent # Description
2018/0208952 GENETICALLY ENGINEERED BACTERIUM FOR THE PRODUCTION OF ISOBUTYLENE
The invention relates to a genetically engineered bacterium having an enzyme that converts 3-hydroxyisovaleryl-CoA to 3-hydroxyisovalerate and an enzyme that...
2018/0208951 PRODUCTION OF PROPANOLS, ALCOHOLS, AND POLYOLS IN CONSOLIDATED BIOPROCESSING ORGANISMS
The present in provides for novel metabolic pathways leading to propanol, alcohol or polyol formation in a consolidated bioprocessing system (CBP), where...
2018/0208950 METHODS OF FACILITATING THE BIOCONVERSION OF CRUDE BIODIESEL-DERIVED GLYCEROL BY MICROORGANISMS
The present disclosure generally pertains to a method of facilitating the bioconversion of glycerol by microorganisms. In one embodiment, biodiesel derived...
2018/0208949 PROCESS FOR ENZYMATIC HYDROLYSIS OF LIGNOCELLULOSIC MATERIAL AND FERMENTATION OF SUGARS
The invention relates to a process for the preparation of a sugar product from ligno-cellulosic material, comprising the following steps: a) optionally...
2018/0208948 DRIMENOL SYNTHASES I
The present invention relates to a method of producing drimenol and/or drimenol derivatives by contacting at least one polypeptide with farnesyl diphosphate....
2018/0208947 PROCESS FOR PRODUCING ALKANES USING MICROORGANISMS COMBINED WITH KOLBE SYNTHESIS
The present invention relates to a method of producing at least one alkane, the method comprising, --producing at least one carboxylic acid from a carbon...
2018/0208946 METHOD FOR PRODUCING FRAGRANT ALCOHOLS
This invention relates generally to methods and compositions for producing a sesquiterpene alcohol comprising contacting a sesquiterpene with a P450...
2018/0208945 GENOME EDITING SYSTEMS AND METHODS OF USE
Compositions and methods are provided for genome editing at a target site in the genome of a filamentous fungal cell. The methods and compositions disclosed...
2018/0208944 ADENOVIRAL VECTOR ENCODING HUMAN ATONAL HOMOLOG-1 (HATH1)
The invention is directed to a replication-deficient adenoviral vector comprising a nucleic acid sequence encoding a human atonal homolog-1 (Hath1) protein...
2018/0208943 ADENO-ASSOCIATED VIRUSES ENGINEERED FOR SELECTABLE TROPISM
Methods to prepare recombinant adeno-associated virus (AAV) capsids with altered tropism and compositions having AAVs with altered tropism are provided.
2018/0208942 NR2E1 MINI-PROMOTERS
Isolated polynucleotides comprising a NR2E1 mini-promoters are provided. The mini-promoter may be operably linked to an expressible sequence, e.g. reporter...
2018/0208941 Rice Mitochondrial Sterile Gene and Application Thereof
Provided is a rice mitochondrial sterile gene and the application thereof. A rice mitochondrial sterile gene and a coding sequence thereof are disclosed. A...
2018/0208940 Novel Insect Inhibitory Proteins
Pesticidal proteins exhibiting toxic activity against Coleopteran, Lepidopteran, Hemipteran, and Thysanopteran pest species are disclosed, and include, but are...
2018/0208939 MODIFIED PLANTS
The present invention relates to conferring enhanced pathogen resistance in wheat plants using targeted genome modification.
2018/0208938 Compositions and Methods for Protecting Plants Against Bacterial Infections
A method of creating a genetically altered plant and parts thereof with a chimeric protein comprising a first domain, a second domain, and a third domain,...
2018/0208937 HPPD VARIANTS AND METHODS OF USE
In the present invention, HPPD polypeptides and plants containing them showing a full tolerance against one or more HPPD inhibitor herbicides belonging to...
2018/0208936 BASE SEQUENCE FOR PROTEIN EXPRESSION AND METHOD FOR PRODUCING PROTEIN USING SAME
To provide a base sequence for protein expression that can increase the yield of protein such as diastatic enzyme by further activating a promoter of a...
2018/0208935 Sophorolipid Highly-Productive Mutant Strain
Provided is a microorganism having high sophorolipid production capability. Disclosed is a sophorolipid-producing yeast mutant strain, in which a polypeptide...
2018/0208934 BASE SEQUENCE FOR PROTEIN EXPRESSION AND METHOD FOR PRODUCING PROTEIN USING SAME
To provide a base sequence for protein expression that can increase the yield of protein such as diastatic enzyme by further activating a promoter of a...
2018/0208932 COMPOSITIONS AND METHODS FOR SILENCING HEPATITIS B VIRUS GENE EXPRESSION
The present invention provides compositions comprising therapeutic nucleic acids such as siRNA that target Hepatitis B virus (HBV) gene expression, lipid...
2018/0208931 Methods and Compositions for RNA-Directed Target DNA Modification and for RNA-Directed Modulation of Transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific...
2018/0208930 TREATMENT OF LIPID TRANSPORT AND METABOLISM GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT...
The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Lipid transport and metabolism gene, in...
2018/0208929 TREATMENT OF REPROGRAMMING FACTOR RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A...
The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Reprogramming factor, in particular, by...
2018/0208928 TOOLS AND METHODS USING MIRNA 182, 96 AND/OR 183 FOR TREATING PATHOLOGIES
The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for miRNA-182 (uuuggcaaugguagaacucacacu or...
2018/0208927 MULTI-TARGETED SINGLE ENTITY CONJUGATES
The present invention relates, in general to, compounds, compositions and methods useful for modulating gene expression of multiple target nucleic acids by a...
2018/0208926 ANTISENSE OLIGONUCLEOTIDE INHIBITING 2GPI EXPRESSION
The present invention aims to provide a novel nucleic acid capable of suppressing expression of .beta.2GPI, as well as a pharmaceutical composition for the...
2018/0208925 INHIBITION OF MICRORNA-134 FOR THE TREATMENT OF SEIZURE-RELATED DISORDERS AND NEUROLOGIC INJURIES
A method for preventing or treating epilepsy or status epilepticus, or a brain-related disorder characterized by precipitation of seizures, in an individual,...
2018/0208924 METHOD FOR INTRODUCING SITE-DIRECTED RNA MUTATION, TARGET EDITING GUIDE RNA USED IN THE METHOD AND TARGET...
A method for inducing a site-directed RNA mutation is provided. The method includes repairing an RNA mutation by converting target adenosine, which is located...
2018/0208923 METHOD FOR THE SELECTIVE SIZE-FRACTIONATED SEPARATION AND ISOLATION OF NUCLEIC ACID MIXTURES
The invention relates to a method for size-fractionated isolation of nucleic acids, characterized by the following steps: --a first binding buffer, which...
2018/0208922 ALLELE-SPECIFIC CAPTURE OF NUCLEIC ACIDS
A method for separating a target allele from a mixture of nucleic acids by (a) providing a mixture of nucleic acids in fluidic contact with a stabilized...
2018/0208921 Increasing Specificity for RNA-Guided Genome Editing
Methods for increasing specificity of RNA-guided genome editing, e.g., editing using CRISPR/Cas9 systems.
2018/0208920 MOLECULAR MACHINES
The present disclosure relates to isolated enzyme complexes comprising a tethered cofactor and at least two enzymes paired to catalyse an enzymatic reaction...
2018/0208919 MONOMERIC AND FUNCTIONAL ADENYLATE CYCLASE CyaA TOXIN
The present invention discloses a procedure to produce a monomeric and functional form of Bordetella sp, especially B. pertussis, CyaA toxin that can be stably...
2018/0208918 NUCLEIC ACID MOLECULES ENCODING AUTOACTIVATING TYPE I PANCREATIC PROELASTASE PROTEINS
The present invention relates to methods for the manufacture, purification, formulation, and use of biologically active recombinant elastase proteins....
2018/0208917 POLYPEPTIDES HAVING PULLULANASE ACTIVITY SUITABLE FOR USE IN LIQUEFACTION
The present invention relates to a variant pullulanase, wherein the pullulanase comprises at least the following combination of substitutions:...
2018/0208916 ALPHA-AMYLASE VARIANTS AND POLYNUCLEOTIDES ENCODING SAME
The present invention relates to an alpha-amylase variant, comprising a substitution at one or more positions corresponding to positions 59, 129, 177, 179,...
2018/0208915 NOVEL ENDOS MUTANT ENZYME
The present invention provides an EndoS mutant enzyme having an amino acid sequence of EndoS D233Q and further having a particular additional mutation and...
2018/0208914 LENTIVIRUS AND NON-INTEGRATING LENTIVIRUS AS VIRAL VECTOR TO DELIVER CRISPR THERAPEUTIC
A composition for treating a lysogenic virus, including a lentiviral vector encoding isolated nucleic acid encoding two or more gene editors chosen from gene...
2018/0208913 Manufacture of Active Highly Phosphorylated Human Lysosomal Sulfatase Enzymes and Uses Thereof
This invention provides compositions of active highly phosphorylated lysosomal sulfatase enzymes, their pharmaceutical compositions, methods of producing and...
2018/0208912 Cell Penetrating Peptide, Conjugate Comprising Same, and Composition Comprising Conjugate
The present invention relates to a conjugate of cell penetrating peptide and an active ingredient; and its use. Specifically, a conjugate including a cell...
2018/0208911 POLYMERIZING ENZYMES FOR SEQUENCING REACTIONS
Compositions comprising modified recombinant polymerizing enzymes are provided, along with nucleic acid molecules encoding the modified polymerizing enzymes....
2018/0208910 Enzymatic Synthesis of L-Nucleic Acids
The present invention is related to a method for adding one or more L-nucleotides to the 3' end of a first L-nucleic acid, wherein the method comprises the...
2018/0208909 MICROORGANISM FOR PRODUCING PUTRESCINE OR ORNITHINE AND METHOD FOR PRODUCING PUTRESCINE OR ORNITHINE BY USING SAME
Disclosed is a modified microorganism producing putrescine or ornithine, and a method for producing putrescine or ornithine using the same.
2018/0208908 LIGHT-DRIVEN SYSTEM AND METHODS FOR CHEMICAL MODIFICATION OF AN ORGANIC SUBSTRATE
The present disclosure relates to alight-driven system which is able to chemically modify an organic substrate with high efficiency and in a cost-effective...
2018/0208907 METHOD FOR RAPID GENERATION OF AN INFECTIOUS RNA VIRUS
The present invention relates to a method for rapid generation of an infectious RNA virus that completely eliminates the need of constructing a full-length c...
2018/0208906 ATTENUATION OF HUMAN RESPIRATORY SYNCYTIAL VIRUS BY GENOME SCALE CODON-PAIR DEOPTIMIZATION
Described herein are RSV polynucleotide sequences that make use of multiple codons that are containing silent nucleotide substitutions engineered in multiple...
2018/0208905 ORF7 DEFICIENT VARICELLA VIRUS, VACCINE COMPRISING THE VIRUS AND USE THEREOF
Provided are an ORF7 deficient varicella virus, an vaccine comprising the virus and use thereof, as well as a method for the production the virus.
2018/0208904 HOST REGULATORY FACTOR THAT ENHANCES REPLICATION AND/OR PROPAGATION OF VACCINIA VIRUS
It is an object of the present invention to provide utilization of a UCA1 gene that is a host regulatory factor that enhances replication and/or propagation of...
2018/0208903 GENERATION OF AIRWAY EPITHELIAL ORGANOIDS FROM HUMAN PLURIPOTENT STEM CELLS
The technology described herein relates to methods and kits for directed differentation of primordial NKX2-1+ lung progenitors along proximal differentiation...
2018/0208902 METHOD FOR CULTURING PLURIPOTENT STEM CELLS, METHOD FOR MANUFACTURING CULTURE VESSEL, CULTURE VESSEL, AND...
Provided are a method for culturing pluripotent stem cells including a culturing process of bringing pluripotent stem cells into contact with a polypeptide...
← Previous | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 | Next →

File A Patent Application

  • Protect your idea -- Don't let someone else file first. Learn more.

  • 3 Easy Steps -- Complete Form, application Review, and File. See our process.

  • Attorney Review -- Have your application reviewed by a Patent Attorney. See what's included.