FIELD OF THE INVENTION

The present invention relates generally to alkaloids and alkaloid biosynthesis. In particular, the invention pertains to the nucleic acids encoding loline alkaloid synthesis genes and the tailoring enzymes of loline alkaloid biosynthesis, and torecombinant vectors and host cells containing such genes, and to the recombinant production of alkaloids and uses thereof.

BACKGROUND OF THE INVENTION

Loline alkaloids (LA; saturated 1-aminopyrrolizidine alkaloids with an ether bridge, FIG. 1), are produced in a number of associations of grasses with endophytes of the genus Epichloe and their asexual descendants, Neotyphodium spp. In addition,LA are reported from the plants Adenocarpus spp. and Argyreia mollis of the families Fabaceae and Convolvulaceae, respectively. LA produced in grass-endophyte symbioses have strong insecticidal and feeding-deterrent properties (Riedell,et al., 1999, JEntomol. Sci. 26: 122 129; Wilkinson et al., 2000, Mol. Plant-Microbe Interact. 13: 1027 1033). Moreover, grasses infected by LA-producing endophytes, such as Neotyphodium coenophialum and N. uncinatum, have greater tolerance to drought conditions(Arechavaleta et al., 1989, Agron. J 81: 83 90; Bacon, 1993, Agric. Ecos. Environ. 44: 123 141 ) than grasses infected by closely related endophytes, such as N. lolii, that do not produce LA (Barker et al., 1997, Agric. Ecos. Environ. 44: 123 141;Cheplick et al., 2000, Mycol. Res. 97: 1083 1092.). Growth suppression (allelopathy) of neighboring plants by meadow fescue (Lolium pratense) infected with N. uncinatum may indicate a potential for additional beneficial roles of these alkaloids ingrass plant competitiveness and persistence.

LA can accumulate to extremely high levels in grass tissues, occasionally reaching more than 2% of the plant's dry mass (Craven et al., 2001, Sydowia 53: 44 73). These quantities far exceed the biomass of the fungus and the amounts of otheralkaloids, such as ergot alkaloids, indole-diterpenoids, and peramine, also produced in some of the endophyte-grass symbiota. However, despite their exceptional levels in the grass and importance of LA in grass survival, little is known about LAbiosynthesis. This is in contrast to some of the other endophyte-associated alkaloids, such as ergopeptines and indole-diterpenoids, for which much of the biosynthetic pathways have been elucidated and key enzymes identified.

It was previously unknown whether LA are of fungal or plant origin, or produced by both symbiotic partners together, but a recent study has established that N. uncinatum can produce LA in axenic culture (Blankenship et al., 2001, Phytochemistry58: 395 401). This finding presents opportunities to identify genes involved in LA biosynthesis. Knowledge of the LA biosynthesis genes would allow more detailed studies on the roles of LA in plant persistence, in particular on possible contributionsto abiotic stress tolerance, as well as the cloning and use of these genes to generate genetically engineered plants.

SUMMARY OF THE INVENTION

In one aspect, the present invention provides isolated nucleic acid compounds comprising at least a sequence identical or complementary to all or part of a coding sequence for the loline alkaloid biosynthetic gene cluster from Neotyphodiumuncinatum (SEQ ID NO. 15, and SEQ ID NO. 16). It appears that SEQ ID NO: 17 may be linked to the 5' end of SEQ ID NO: 16. Preferably, a part of said coding sequence is an open reading frame (ORF) selected from the group consisting of ORF1, ORF2, ORF3,ORF4, ORF5, ORF6, ORF7, ORF8, ORF9, ORF1', ORF2', ORF3', ORF4', ORF5', ORF6', ORF7', ORF8', ORF9' or ORF10'. More preferably, a part of said coding sequence is an ORF selected from the group consisting of ORF1, ORF2, ORF3, ORF4, ORF5, ORF6, ORF7, ORF8,ORF9, ORF1', ORF2', ORF3', ORF4', ORF5', ORF6', ORF7', and ORF8'.

In one embodiment, the present invention provides an isolated nucleic acid strand that encodes a loline alkaloid gene cluster or subunit thereof comprising a nucleotide sequence identical or complementary to, or an amino acid sequence encoded bya nucleotide sequence identical or complementary to, all or part of a coding sequence for loline alkaloid biosynthetic gene cluster of SEQ ID NO. 15 or SEQ ID NO. 16. Preferably, the gene cluster encodes a functional gene cluster and optionally,selected tailoring enzymes. The gene cluster may be derived from a single species or may be hybrid in nature. In certain embodiments, the gene cluster is a replacement gene cluster. The replacement gene cluster may be a variant, hybrid, mutant, analogor derivative thereof.

In another embodiment, the invention provides an isolated nucleic acid that encodes three or more ORFs comprising a sequence identical or complementary to all or part of a coding sequence for enzymes performing the biosynthesis of lolinealkaloids from Neotyphodium uncinatum. Preferably, the ORFs encode a functional gene cluster and optionally, selected tailoring enzymes. In certain embodiments, an ORF may be derived from a single species or may be hybrid in nature. In certainembodiments at least one of the ORFs is native to the loline alkaloid gene cluster of SEQ ID NO. 15 or SEQ ID NO. 16. In certain other embodiments, at least one of the ORFs is native to SEQ ID NO: 17. In still other embodiments, at least one ORF isderived from a non-loline alkaloid producing Neotyphodium strain, or is hybrid in nature. In yet other embodiments, at least one ORF is a variant, mutant, analog or derivative of the native coding sequence of SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO:17.

In still another embodiment, the present invention provides isolated nucleic acid compounds comprising three or more genes of the coding sequence for the biosynthesis of loline alkaloids. Preferably, the mixture of genes encode a functional genecluster and optionally, selected tailoring enzymes. In certain embodiments, a gene may be derived from a single species or may be hybrid in nature. In certain embodiments at least one gene is derived from a loline alkaloid biosynthetic gene cluster. In other embodiments, at least one gene is derived from a non-loline alkaloid producing Neotyphodium strain, or is hybrid in nature. Non-limiting exemplary non-Neotyphodium biosynthetic genes are preferably subunits of the Neotyphodium australiense,Neotyphodium huerfanum, Neotyphodium inebrians, Neotyphodium lolii, and Neotyphodium melicicola gene clusters. In yet other embodiments, at least one gene may be a variant, mutant, analog or derivative of the native coding sequence of SEQ ID NO: 15, SEQID NO: 16 or SEQ ID NO: 17. It is also preferred that the encoded activity of the gene is that of, for example and without limitation, an epoxidase, .alpha.-type pyridoxal phosphate (PLP) associated enzymes, including, by example, class-vaminotransferase, cytochromes P450, aspartate kinase allosteric amino acid binding domain, oxidoreductase, ornithine decarboxylase, .gamma.-type PLP enzyme, FAD-containing monooxygenase, and cyclohexanone oxidase.

In another aspect, the present invention provides recombinant expression vectors encoding a loline alkaloid gene cluster, or variants, hybrids, mutants, analogs or derivatives thereof. In certain embodiments, vectors encode one or more subunitof a loline alkaloid gene cluster, or variants, hybrids, mutants, analogs or derivatives thereof.

In another aspect, the present invention provides a host cell transformed with a recombinant expression vector described herein.

In still another aspect, the invention provides a method of preparing loline alkaloid, said method comprising introducing a recombinant vector that encodes a loline alkaloid gene cluster or subunit thereof into a host cell, culturing said hostcell under conditions such that loline alkaloid is produced or expressed, and isolating the loline alkaloid from the host cell. In one embodiment, the method is practiced with an E. coli host cell. The gene cluster may be a replacement gene cluster andpreferably a functional gene cluster. In certain embodiments, the invention provides methods for preparing new alkaloid-type compounds, preferably, loline-type alkaloids. The loline-type alkaloid produced may be loline alkaloid or loline alkaloidvariants, hybrids, mutants, analogs or derivatives thereof. Such alkaloids are useful as an insecticide.

These and other embodiments and aspects of the invention will be more fully understood after consideration of the attached Drawings and their brief description below, together with the detailed description, example, and claims that follow.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the structures of the loline alkaloids found in certain grass--Epichloe/Neotyphodium symbiota. N-Formylloline and N-acetylnorloline were abundant in N. uncinatum grown in LA-inducing medium.

FIG. 2 is an autoradiograph showing expression of transcripts isolated in the suppression subtractive hybridization in loline-producing (+) and suppressed (-) cultures. In each lane was loaded 0.5 .mu.g of total cDNA synthesized from total RNAand probed with subtracted cDNA; molecular sizes indicated (in kilobases) correspond to molecular marker (HindIII/EcoRI-cut .lamda..DNA) run on the same gel.

FIG. 3 is an autoradiograph showing expression of lolA and lolC genes in LA-producing (+) and suppressed (-) cultures. In each lane was loaded 0.5 .mu.g of total cDNA synthesized from total RNA. cDNAs were probed with a mixture of a labeled 523bp fragment from lolA and a labeled 1427 bp fragment from lolC. Identities of the hybridizing bands were confirmed in separate experiments with the individual probes (data not shown). Bottom panel shows expression of the tub2 as a control. Molecularsizes (in kilobases) are indicated, and correspond to bands of a DNA-size marker (HindIII/EcoRI-cut .lamda.DNA) run in the same gel.

FIG. 4 is a Southern blot of HindIII-digested genomic DNAs probed for lolA (panel A), lolC (panel B), and tub2 (panel C). Genomic DNAs were from N. lolii 138 (lane 1), E. festucae CBS 102477 (lane 2), E. festucae CBS 102475 (lane 3), and N.uncinatum CBS 102646 (lane 4). Numbers adjacent to each blot indicate band sizes (in kilobases) of the molecular marker run in the same gel. For LA phenotype of each species/isolate see Table 3.

FIG. 5 demonstrates the presence of the lolA and lolC genes in endophyte species and isolates differing in LA production. Shown are electropherograms with 2 .mu.l of PCR product loaded in each lane. The multiplex PCR generated a 523 bp productfrom lolA and a 461 bp product from lolC. The control PCR generated a 726 bp product from tub2. Numbers above each lane indicate species or isolate listed under the same number in Table 3; lanes B were PCR blanks run without added template DNA; lanes Mare molecular size markers (sizes indicated in bp).

FIG. 6 illustrates the N. uncinatum lol clusters 1 (LOL1) (upper bar) and 2 (LOL2) (lower bar). It appears that the lolF2 allele and lolM are linked to LOL2.

DETAILED DESCRIPTION OF THE INVENTION

Given the valuable agricultural properties of loline alkaloids, there is a need for methods and reagents for producing large quantities of loline-type alkaloids, for producing loline-type alkaloids in host cells that do not produce lolinealkaloids naturally, and for producing novel loline-type alkaloids not found in nature. The present invention provides the protein encoding nucleic acids and methods that produce loline-type alkaloids, with particular application to methods forproducing the loline alkaloids and variants, hybrids, mutants, analogs, derivatives and novel compounds related through structure or genetics to loline alkaloid.

The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, microbiology, molecular biology and recombinant DNA techniques within the skill of the art. Such techniques are explained fully inthe literature. See, e.g., Maniatis, et al. Molecular Cloning: A Laboratory Manual (Current Edition); DNA Cloning: A Practical Approach, vol. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., Current Edition); Nucleic Acid Hybridization(B. Hames & S. Higgins, eds., Current Edition); Transcription and Translation (B. Hames & S. Higgins, eds., Current Edition).

All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

Definitions

As used herein, the term "alkaloid-type compound" refers to a compound or molecule that is encoded by at least one native alkaloid subunit, or variant, hybrid, mutant, analog, or derivative thereof, including for example, without limitation,loline-type alkaloid.

As used herein, the term "allele" refers to one of two or more alternate forms of a gene occupying the same locus in a particular chromosome or linkage structure and differing from other alleles of the locus at one or more mutational sites. Non-limiting types of alleles include, neutral, amorphs, hypomorphs, hypermorphs, antimorphs, neomorphs, isoalleles and unstable alleles.

As used herein the term "coding sequence" or a sequence which "encodes" a particular protein, is a nucleic acid sequence which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo whenplaced under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, butis not limited to, cDNA from procaryotic or eucaryotic mRNA, genomic DNA sequences from procaryotic or eucaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the coding sequence.

As used herein the term DNA "control sequences" refers collectively to promoter sequences, ribosome binding sites, polyadenylation signals, transcription termination sequences, upstream regulatory domains, enhancers, and the like, whichcollectively provide for the transcription and translation of a coding sequence in a host cell. Not all of these control sequences need always be present in a recombinant vector so long as the desired gene is capable of being transcribed and translated.

As used herein the term "functional gene cluster" refers to a set of genes (e.g., three or more) or subunits of a biosynthesis gene cluster, which catalyzes the synthesis of an active or functional alkaloid.

As used herein the term "gene" refers to a segment of DNA or its complement that is involved in producing a polypeptide chain, including regions preceding (leader) and following (trailer) the coding sequence as well as intervening sequences(introns) between individual coding sequence (exons). A "loline alkaloid gene" refers to at least any of the ORFs of SEQ ID NO. 15 and SEQ ID NO. 16.

As used herein the term "gene cluster" refers to a set of (e.g., three or more) closely related genes that code for the same or similar proteins and which are usually grouped together on the same chromosome. A "loline alkaloid gene cluster"refers to a set of genes (e.g., three or more) encoded by at least any of the ORFs of SEQ ID NO. 15 or SEQ ID NO. 16.

As used herein the term "genetically engineered host cell" is meant a host cell where the native gene cluster or subunits thereof has/have been deleted using recombinant DNA techniques. Thus, the term would not encompass mutational eventsoccurring in nature. A "host cell" is a cell derived from a procaryotic microorganism or a eucaryotic cell line cultured as a unicellular entity, which can be, or has been, used as a recipient for recombinant vectors bearing the alkaloid gene clustersof the invention. The term includes the progeny of the original cell which has been transfected. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complementto the original parent, due to accidental or deliberate mutation. Progeny of the parental cell, which are sufficiently similar to the parent to be characterized by the relevant property, such as the presence of a nucleotide sequence encoding desiredbiosynthetic enzymes, are included in the definition, and are covered by the above terms.

As used herein the term "loline alkaloid analog" or "analog" refers to a compound or molecule that resembles a loline alkaloid and that contains one or more structural differences relative to the loline alkaloid. Preferably, the loline analoghas a desired activity of loline alkaloid although a loline analog may have enhanced or the same activity than products of the loline alkaloid gene cluster. For example, the degree of saturation of at least one bond in the loline alkaloid structure canbe changed (e.g., a single bond can be changed to a double or triple bond, or the converse), a bond can be removed, one or more carbon, oxygen or hydrogen atoms can be replaced with a different atom or a chemical moiety (e.g., a halogen, oxygen,nitrogen, sulfur, hydroxy, methoxy, alkyl, aryl, cycloalkyl, heterocycle, amine, amide, ketone, aldehyde, etc.) and the like. Also other peripheral groups, such as OH groups, methyl groups, O-methyl groups, halogene atoms etc. can be added, modified orremoved. Other types of derivatives of loline that would be encompassed by the term "loline alkaloid analog" are known in the art. Non-limiting examples are norloline, N-methylloline, N-formylloline, N-formylnorloline, N-acetylloline andN-acetylnorloline.

As used herein the term "loline alkaloid derivative" or "derivative" refers to a compound or molecule, that may be produced from loline in one or more steps or with few chemical or moiety modifications.

As used herein the term "loline-type alkaloid" refers to a compound or molecule that is encoded by one or more native gene of, or a variant, hybrid, mutant, analog or derivative thereof, at least SEQ ID NO. 15 or SEQ ID NO. 16.

As used herein, the term "modification enzyme" or "tailoring enzyme" refers to a protein or enzyme that is involved in modifying an alkaloid after its core has been synthesized by the necessary components to catalyze the production of an activeor functional alkaloid. Exemplary, modification enzymes involved in loline-type alkaloid synthesis include, without limitation, oxidoreductases, dioxygenases and N-methyltransferase.

As used herein, the term "modification step" or "tailoring step" refers to an action or actions taken by a protein or enzyme to modify an alkaloid after its core has been synthesized by the necessary components to catalyze the production of anactive or functional alkaloid.

As used herein the term "mutant" refers to a nucleic acid compound, protein, molecule, vector or cell resulting from mutation of the native wild type coding sequence or subunits thereof.

As used herein the term "mutation" refers to any change that alters a native coding sequence either by displacement, addition, deletion, insertion, cross-linking, or other destruction or substitution of one or more nucleotides of the nativecoding sequence. Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are also known to those skilled in the art.

As used herein the term "nucleic acid" sequence can include, but is not limited to, procaryotic sequences, eucaryotic mRNA, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences,and complements thereof. The term also captures sequences that include any of the known base analogs of DNA and RNA such as, but not limited to 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine,5-(carboxyhydroxylmethyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudo-uracil, 1-methylguanine,1-methylinosine, 2,2-dimethyl-guanine, 2-methyladenine, 2-methylguanine, 3-methyl-cytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxy-aminomethyl-2-thiouracil, beta-D-mannosylqueosine,5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,5-methyluracil, N-uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine. A transcription termination sequence will usually be located 3' to the coding sequence.

As used here the term "open reading frame" or "ORF" refers to a region of a nucleic acid molecule that contains a series of triplet bases coding for amino acids without any termination codons. An "open reading frame" includes any start codons.

As used herein the term "replacement gene cluster" is meant any set of genes (e.g., three or more), optionally including genes encoding modification or tailoring enzymes, capable of producing a functional gene cluster when under the direction ofone or more compatible control elements, as defined above, in a host cell transformed therewith. The term "replacement gene cluster" encompasses three or more genes encoding for the various proteins necessary to catalyze the production of an alkaloid. A "replacement gene cluster" need not include all of the genes found in the corresponding cluster in nature. Rather, the gene cluster need only encode, but is not limited to, the necessary components to catalyze the production of an active alkaloid. For example, if the gene cluster includes, for example, eight genes in its native state and only three of these genes are necessary to provide an active alkaloid, only these three genes need be present, and a variety of the non-necessary genes mayoptionally be present. The term, "replacement gene cluster" may also contain genes coding for modification or tailoring enzymes or tailoring enzymes to the core alkaloid catalyzed by the necessary components to catalyze the production of an active orfunctional alkaloid. Furthermore, a replacement gene cluster can include genes derived from a single species, or may be hybrid in nature with, e.g., a gene derived from a cluster for the synthesis of a particular alkaloid replaced with a correspondinggene from a cluster for the synthesis of another alkaloid. Hybrid clusters can include genes derived from different species. The genes included in the replacement gene cluster need not be the native genes, but can be variants, mutants or analogsthereof. Variants are prepared by methods known in the art (see Maniatis et al. Molecular Cloning: A Laboratory Manual (Current Edition)). Mutants or analogs may be prepared by the deletion, insertion or substitution of one or more nucleotides of thecoding sequence. Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are described in the literature. The genes included in the replacement gene cluster need not be on the same plasmid or if present on the same plasmid,can be controlled by the same or different control sequences.

As used herein, the term "subunit" refers to a part of a gene cluster including, for example, a module, domain, gene, or open reading frame, and parts thereof. A "subunit" may comprise for example, a gene or genes derived from a single speciesor may be hybrid in nature (e.g., a gene derived from a cluster for the synthesis of a particular alkaloid replaced with a corresponding gene from a cluster for the synthesis of another alkaloid.). A "subunit" may comprise variants, mutants, analogs orderivatives of the native gene(s). Variants, mutants, analogs or derivatives thereof may be prepared by techniques known to those of skill in the art, including, without limitation, the displacement, addition, deletion, insertion, cross-linking, orother destruction or substitution of one or more nucleotides of the coding sequence. Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are also known in to those skilled in the art.

As used herein the term "loline alkaloid variant" or "variant" refers to a nucleic acid sequence that hybridizes to an isolated nucleic acid sequence under high stringency conditions and has a desired or enhanced activity of the complement. Variants may include alleles, mutants, hybrids, derivatives, or analogs. Variants also include the polypeptides coded for by these hybridizable nucleic acids.

Identification of lolA and lolC

Production of LA in N. uncinatum can be regulated by culture conditions, such as carbon and nitrogen source and pH in the culture medium, and is completely suppressed in a complex medium (Blankenship et al., 2001, Phytochemistry 58: 395 401),suggesting differential expression of genes involved in LA biosynthesis. Isolation of the genes up-regulated during LA production is a first step in identifying possible enzymes in the biosynthesis of the LA. Different methods are now available for theisolation of differentially expressed genes (Diatchenko et al., 1996, Proc. Natl. Acad. Sci. USA 93: 6025 6030; Liang and Pardee, 1992, Science 257: 967 971), incorporated herein. One such method, suppression subtractive hybridization (Diatchenko etal., 1996; Diatchenko et al., 1999, Meth. Enzymol. 303: 349 380) (incorporated herein), has been particularly useful for identifying differentially expressed genes. This technique was used herein to identify genes up-regulated in N. uncinatum duringLA production.

Culture conditions inducing or suppressing LA alkaloid accumulation in the fungus N. uncinatum (Blankenship et al., 2001) were used in combination with suppression subtractive hybridization for isolation of gene transcripts that are up-regulatedduring LA production. This approach was highly effective in enriching cDNAs differentially expressed in LA-producing cultures: subtracted cDNAs hybridized much more strongly with cDNAs from LA-producing cultures than with cDNAs from LA-suppressedcultures (See FIG. 2). However, a few weak hybridizing bands were present in the total cDNA from the suppressed cultures, which was expected because very low LA levels accumulated in the suppressed cultures. Success of the approach was furtherindicated by the identification of lolA and lolC, genes that were present only in the species and isolates that produced LA, and, in the case of lolC, related to a sequence previously found to cosegregate with the LA-producing phenotype in Mendeliananalysis of E. festucae (Wilkinson et al., 2000, Mol. Plant-Microbe Interact. 13: 1027 1033). The relationships of lolA and lolC to known biosynthetic enzymes further suggested that this approach identified transcripts of LA biosynthesis genes.

The subtracted cDNAs comprised approximately 6 7% of all transcripts present in LA-producing cultures. This estimation appears reliable, since the number of independent clones in the cDNA library from LA-producing cultures (4.1.times.10.sup.6pfu) greatly exceeds the number of clones (1.0.times.10.sup.6 pfu) estimated to be required for a library representing the complexity of the original mRNA population (Ausubel et al., 2001).

A relatively small number of the subtracted cDNAs and cDNA library clones were sequenced. Rather than conducting extensive sequencing, we focused on some of the cDNAs sequenced in this smaller survey, like lolA and lolC, giving significantsimilarity to known genes in amino acid biosynthesis/conversion, to further test their association with LA production. These cDNAs appeared promising candidates, since it has been hypothesized earlier that LA have polyamines as precursors, which in turnare products from amino acid metabolism.

Among cDNAs isolated by the subtraction five independent clones from two alleles of genes designated lolA were identified. However, N. uncinatum has at least two copies of lolA and lolC. The lolA alleles encode predicted proteins significantlysimilar to aspartate kinases, the first step in biosynthesis of methionine, threonine, and isoleucine from aspartate. In addition, one cDNA clone of a gene, lolC, with similarity to fungal enzymes in methionine biosynthesis was identified. Expressionof lolA and lolC was clearly up-regulated in the LA-producing cultures compared to expression in the suppressed cultures. Further evidence for involvement of lolA and lolC in LA production was the distribution of these genes among the Neotyphodium andEpichloe species surveyed, of which eight species produce LA, 12 do not, and one (E. festucae) is polymorphic for this phenotype. Restriction of lolA and lolC to LA-producing endophytes indicated that both genes are either involved or physically linkedto genes involved in the LA production phenotype. This observation, coupled with the observed up-regulation of lolA and lolC in the LA-producing cultures, lent support to an involvement of both genes in LA production.

Generation of knock-outs of lolA and/or lolC will provide further evidence of their roles in LA production. However, preliminary evidence indicates that N. uncinatum has at least two alleles of lolA and the possibility of more than one allele oflolC. Thus, different approaches will be necessary to generate complete knock-outs, one of which could be disruption of the putative lol genes in N. coenophialum for which procedures for knock-outs and double knock-outs have recently been developed.

The ORFs of the lolA alleles in N. uncinatum predicted proteins with lengths of approximately 210 amino acids, much shorter than the sizes of known aspartate kinases (for example, aspartate kinase of Sc. pombe, GenBank accession T39822, has alength of 519 amino acids). Potential reasons for this disparity could include truncation in the RT-PCR due to incomplete extension by the reverse transcriptase, or incorrect annealing of the 5' and 3' end-specific cDNA primers to internal genesequences. cDNA-based northern analysis (see FIG. 3), indicated a strong band of the expected size for an mRNA encoding 210 amino acids, whereas incomplete extension would probably have resulted in multiple bands or smear in the total cDNA. Moreover,despite being very close in size, the two allelic lolA cDNAs varied in the lengths of their 5' and 3' terminal sequences (not shown). Because of this difference, truncation due to incorrect primer annealing also appears unlikely, leaving the possibilitythat the lolA gene encodes a protein much shorter than known aspartate kinases. The predicted lolA amino acid sequences have similarity only to the C-terminal region of aspartate kinase, but not to the N-terminal regions, containing regions forsubstrate affinity and the active center (Arevalo-Rodriguez et al., 1999). A search of the PROSITE database further indicated that the predicted lolA sequences do not have an N-terminal consensus sequence typical of aspartate kinases. The C-terminalregion of aspartate kinases, to which the predicted lolA products have similarity, is thought to be involved in allosteric response of the enzyme (Arevalo-Rodriguez et al., 1999). It is thus possible that the predicted lolA proteins may have a bindingsite for an allosteric modulator similar to the modulators acting on aspartate kinase, which are normally allosterically regulated by the amino acids lysine, threonine, or isoleucine.

Multiple steps have been identified for the biosynthesis of the more common plant pyrrolizidines, the senecio alkaloids. Senecio alkaloids are synthesized from polyamines, such as putrescine (derived from decarboxylated ornithine) andspermidine. In part because of their structural similarities with senecio alkaloids, a pathway from polyamines has been proposed for LA (Bush et al., 1993). Relative positions of carbon and nitrogen atoms in the 1-aminopyrrolizidine structure (see FIG.1) would be consistent with spermidine or a related compound as precursor, and spermidine is ultimately derived from the amino acids ornithine and methionine. Aspartate kinase and homocysteine synthase (or related enzymes) are steps in biosynthesis ofmethionine, which in turn is a precursor to decarboxylated S-adenosylmethionine, the source of the aminopropyl moiety of spermidine. The association of lolA and lolC with LA production indeed suggests possible LA-biosynthesis from aspartate viamethionine. However, the substantial differences between predicted lolA and known aspartate kinases may cast doubt on this possibility. Nevertheless, we have observed specific incorporation of 4-[.sup.13C]-Asp into LA, indicating that aspartate is aprecursor, although the exact sequence of biosynthetic steps remains to be established. Moreover, lolC also had similarity to an enzyme in the biosynthesis of rhizobitoxine, a bacterial product which enhances nodulation. The activity of this enzymeencompasses formation of serinol and dihydrorhizobitoxine biosynthesis, thus synthesis of compounds different from methionine precursors, further indicating that LA biosynthesis could differ from common amino acid and/or polyamine biosynthesis.

Another cDNA obtained with the subtraction had similarity to a putative zinc-finger transcription factor. Interestingly, in fungi such as Fusarium sporotrichioides and Em. nidulans, transcriptional regulators can be part of secondary metabolitepathway clusters, raising the possibility that a specific transcriptional regulator also exists for LA genes. The probable transcription factor found here has similarities to C2H2 zinc-finger transcription factors. A C2H2-like transcription factor wasfound to be involved in the control of genes in the biosynthesis of trichothecene, a secondary metabolite produced by F. sporotrichioides. In our study, however, detection of the C2H2-like gene did not correlate with LA production in endophytes. Therefore, it likely that this putative transcription factor might be specifically expressed in N. uncinatum under the culture condition used to induce LA production, but may not be a specific regulator for LA biosynthesis genes. Another possibility,however, is that this factor regulates LA genes in N. uncinatum, but different factors regulate the orthologous genes in other endophyte species. In fact, loline alkaloids are not produced by other endophyte species in these culture conditions despitethe presence of lolA and lolC, and despite their production of LA when symbiotic with plants. Therefore, the possibility of a unique regulator of LA synthesis in N. uncinatum warrants further investigation.

Other genes up-regulated during LA production that gave significant matches with known genes or sequences were a putative homing endonuclease, generally associated with unusual DNA splicing and incorporation events, and significant matches ofcDNAs to sequences in the Neurospora crassa genome. However, for none of these genes do we currently have direct evidence for involvement in LA production. One sequence identified in four clones (P3, K8, C37, D5) was also detectable (by Southern blot)in at least one non-producer, E. festucae CBS 102477, but not in the LA producers N. coenophialum ATCC 90664 and E. festucae CBS 102475 (data not shown), suggesting that this gene is not involved in LA production.

Further Investigations into Biosynthesis of the Loline Alkaloids.

Very little is known about the regulation of secondary metabolism in grass endophytes and many other fungi. The approach used here is a crucial step towards elucidating the biosynthesis of LA, allowing the isolation of genomic copies of N.uncinatum genes closely associated with LA production. Secondary metabolite pathway genes are frequently clustered in fungal genomes (Keller and Hohn, 1997, Fung. Genet. Biol. 21: 17 29; Seo et al., 2001, Fung. Genet. Biol. 34: 155 165; Tudzynskiet al., 1999, Mol. Gen. Genet. 261: 133 141). The finding of genes associated with LA production now permits investigations of potential clustering of LA genes in genomes of LA-producing endophytes.

EXAMPLE 1

All chemicals (including antibiotics) and reagents used in the experiments described in the examples below were obtained from Sigma Corp. (St. Louis, Mo., USA), unless indicated otherwise. Growth media were from Difco Laboratories (Detroit,Mich., USA). Agarose for DNA and RNA gel electrophoreses was supplied by Bio Whittaker Molecular Applications (Rockland, Me., USA). For routine PCR of templates <1.0 kb, AmpliTaq Gold (Applied Biosystems, Foster City, Calif., USA) was used. PCRsfor cDNA synthesis, suppression subtractive hybridization, and templates >1.0 kb were performed with the Advantage cDNA PCR Kit (Clontech, Palo Alto, Calif., USA).

Fungal Cultures and Analyses of Loline Alkaloids.

Mycelium of Neotyphodium uncinatum (voucher specimen CBS 102646 at Centraalbureau Voor Schimmelcultures, Utrecht, The Netherlands) was isolated from grass leaf tissues [meadow fescue (Lolium pratense=Festuca pratensis), plant 167 in our plantcollection] on potato dextrose agar as previously described (Blankenship et al., 2001). The following procedures were carried out as described by Blankenship et al. (2001) with modifications. After 21 days of growth at 22.degree. C. on PDA plates, 10fungal colonies were transferred to, and homogenized in, 20 ml of LA-inducing medium (Blankenship et al., 2001) with 15 mM asparagine and 20 mM sucrose as the nitrogen and carbon sources, respectively. Ten ml of the homogenate was added to a 500-mlErlenmeyer flask with 100 ml of fresh LA-inducing medium, and the culture incubated at 22.degree. C. with rotary shaking (100 rpm). After five days of growth, mycelium was harvested in 50-ml tubes (Falcon, distributed by Becton Dickinson Labware,Lincoln Park, N.J., USA) by centrifugation (2000.times.g rcf), and the mycelium homogenized in 20 ml LA-inducing medium as described. To initiate main cultures for LA production, 1 ml of homogenized mycelium was added to 25 ml of LA-inducing medium andcultures were incubated as described above. To suppress LA production in cultures, but maintain growth conditions similar to the minimal medium, potato dextrose broth was added to give half-strength final concentration in the medium, and asparagine andsucrose were added to 7.5 mM and 10 mM final concentration, respectively. Except for this variation in medium composition, all growth conditions and source of inoculum for LA-suppressed cultures were the same as for LA-induced cultures. Cultures of N.uncinatum were grown under the conditions inducing or suppressing LA accumulation, and harvested during early accumulation when LA levels in the producing medium were <20 .mu.g ml.sup.-1. (Levels in similar cultures later reached >1000 .mu.gml.sup.-1 in producing, but <10 .mu.g ml.sup.-1 in suppressed cultures.)

LA extraction from freeze-dried culture filtrates or plant tissues, and quantitation by gas chromatography (GC) analysis, were performed as described by Blankenship et al. (2001).

RNA Extraction, DNase Treatment, and Analysis.

Mycelium was harvested by vacuum filtration through Whatman No. 1 filter paper (Whatman International Ltd, Maidstone, England, UK) and total RNA was extracted from 0.2 0.3 g (fresh weight) mycelium with the RNeasy Plant Minikit (Qiagen Inc,Valencia, Calif., USA). Co-purified DNA was removed with the DNA-free.TM. kit (Ambion, Austin, Tex., USA) by treating the extracts (50 .mu.l) with 2 units of DNaseI for 30 min at 37.degree. C., whereupon DNase activity was stopped with DNaseInactivation Reagent (Ambion). Purified RNA was quantified by measuring absorbance at 260 nm and 280 nm in a Genequant spectrophotometer (Amersham Pharmacia Biotech, Piscataway, N.J., USA). Integrity of the total RNA was checked by electrophoresis in1.2% formaldehyde agarose gels.

cDNA Synthesis and Suppression Subtractive Hybridization.

Total RNA was extracted from LA-producing and LA-suppressed cultures. However, low mycelial biomass resulted in low RNA yields. To obtain enough cDNA for subtractive hybridization and expression analysis (cDNA-based Northems; Endege et al.,1999, BioTechniques 26: 542 548), cDNA was synthesized and amplified with the SMART.TM. PCR cDNA Synthesis Kit (Clontech). Three .mu.l of RNA solution (300 ng/.mu.l) was reverse transcribed with Superscript.TM. II following the instructions of themanufacturer (Gibco BRL, Grand Island, N.Y., USA). The reverse-transcription reaction was diluted with TE buffer to a total volume of 50 .mu.l. Amplification of cDNA by long-distance PCR was carried out according to the protocol of the SMART.TM. PCRcDNA Synthesis Kit (Clontech) in a GeneAmp PCR System 2400 thermocycler (Perkin Elmer Inc., Boston, Mass.). One .mu.l of the diluted reverse-transcription reaction was used, and the number of PCR cycles required for optimum amplification of cDNA wasdetermined according to the manufacturer's protocol (Clontech). The amplification step allows bulking up on cDNA, while likely maintaining the complexity of the original RNA population.

Suppression subtractive hybridization (Diatchenko et al., 1996; Diatchenko et al., 1999) was performed with the PCR-Select.TM. cDNA Subtraction Kit (Clontech) essentially as described in the Clontech PCR-Select.TM. manual. The PCR-Selectprocedure consists of RsaI digestion of cDNA, ligation of digested tester DNA (containing differentially expressed genes of interest) to two adaptors (1 and 2R, specified in the manual), and two rounds of hybridization with driver DNA used to subtractout cDNAs not differentially expressed in the tester, followed by amplification of the subtracted cDNA by PCR with primers specific to the adaptors. Primary PCR is followed by secondary PCR with nested primers. Only DNA fragments carrying differentadaptors at each end tend to amplify exponentially.

cDNA previously amplified with the cDNA Synthesis Kit was purified and digested with RsaI. The digested cDNA was cleaned up with the PCR Purification Kit (Qiagen), eluted into 50 .mu.l of elution buffer, and ethanol precipitated, and adaptorsligated to the tester DNA. In the first hybridization, 13 ng of adaptor-ligated tester was mixed with 147 ng of driver in two separate reactions (each reaction with adaptor 1 and 2R, respectively) and, after denaturation (98.degree. C. for 1.5 min),were allowed to anneal for 9 hr at 68.degree. C. After this first hybridization, the two reactions were combined in the presence of 98 ng of denatured fresh driver and a second hybridization performed for 16 hr at 68.degree. C. Amplification oftester-tester hybrids was performed as described in PCR Purification Kit manual. Efficiency of the ligation to the adaptors and of the subtraction was tested and confirmed as called for in the protocol, using two primers (5'-GTTGATCTCCAAGATCCGTGAGG-3'(SEQ ID NO. 1) and 5'-GTTTCGTCCGAGTTCTCGAC-3') (SEQ ID NO. 2) specific to the .beta.-tubulin gene (tub2).

Upon completion of suppression subtractive PCR, a portion of the product mixture was ligated into pCR.RTM.4Blunt-TOPO.RTM., using the Zero Blunt TOPO PCR Cloning Kit (Invitrogen, Carlsbad, Calif., USA), and electroporated into TOP10 cellsprovided with the kit, to obtain a subtracted expressed sequence tag (EST) bank. Another portion was used to generate hybridization probe PCR-labeled with digoxigenin (DIG) following the protocol of the manufacturer (Roche-Boehringer, Indianapolis,Ind., USA).

cDNA Library Construction.

cDNA synthesis and library construction were performed with the SMART.TM. cDNA Library Construction Kit (Clontech) according to the manufacturer's instructions. First-strand cDNA was synthesized with the same amount of RNA as used in the cDNAsynthesis for the subtraction, and 2 .mu.l undiluted first-strand reaction was used as template to amplify the cDNA. The amplified cDNA was digested with SfiI, size fractionated for removal of low-molecular-size (<0.1 kb) cDNA, and ligated into.lamda.TriplEx2 vector (Clontech). cDNA ligated into vector was added to .lamda. phage Gigapack III Gold packaging extract (Stratagene, La Jolla, Calif., USA), and titered in E. coli strain XL1-Blue as specified by the manufacturer. For cDNA libraryamplification, overnight cultures of XL1-Blue were inoculated with an amount of packaged phage suspension to yield 1.0.times.10.sup.5 pfu per 150 mm plate (Falcon); in total, 15 plates were prepared, so the amplified library was derived from1.5.times.10.sup.6 primary clones. After incubation overnight at 37.degree. C., to each plate was added 12 ml of .lamda. dilution buffer (100 mM NaCl, 10 mM MgSO.sub.4, 35 mM Tris-HCl, pH 7.5, 0.01% gelatin), followed by 20 hr incubation at 4.degree. C. The phage suspensions were then titered for each plate. Since differences in titer between plates would affect representation of cDNA clones in the final amplified library, the appropriate volume of each suspension was determined so that, whencombined, each plate contributed equally to the total number of pfu in the pooled library. After pooling, the titer of the amplified library was 5.4.times.10.sup.9 pfu ml.sup.-1.

Southern Blot and PCR Analysis of Genomic DNA.

Fungal genomic DNA was isolated by the method of Al-Samarrai & Schmid, 2000, Lett. Appl. Microbiol. 30: 53 56. Because Neotyphodium occultans does not grow autonomously in culture, DNA from the Lolium multiflorum-N. occultans symbiotum wasisolated by the method of Doyle and Doyle, 1990, Focus 12: 13 15 for PCR analysis.

Probes for Southern-blot, dot-blot and cDNA-based northern-blot hybridizations were labeled with DIG as described above. Total subtracted cDNA was labeled by using the primary PCR product in the subtraction as template and the nested PCR primerssupplied with the PCR-Select.TM. cDNA Subtraction Kit (Clontech). Probe for lolA was a labeled 523 bp fragment generated by PCR using primers lolA-5' (5'-GTCTGGCGAATTCTACAGACACG-3') (SEQ ID NO. 3) and lolA-3' (5'-GATGGCCATGTGAGGAAAGAG-3') (SEQ ID NO.4). A labeled 1427 bp fragment of the lolC gene was generated by PCR with primers lolC-5' (5'-CGGTGCGCGTCTTCTAAACTTGAC-3') (SEQ ID NO. 5) and lolC-3' (5'-GAATCTTTCCGATGCAAGGCTTACG-3') (SEQ ID NO. 6).

cDNA-based northerns were performed with complete cDNA, which was gel fractionated and Southern blotted to Hybond.TM.-N+ nylon membranes (Amersham Pharmacia Biotech). Southern blotting of DNA by alkaline transfer, as well as dot blotting ontoHybond.TM.-N+ nylon membranes (Amersham Pharmacia Biotech) and DNA hybridizations were accomplished with standard protocols (Ausubel et al., 2001). Membranes were washed with 0.1.times.SSC, 0.1% SDS, once for 15 min at room temperature, then for 20 minand again for 30 min at 75.degree. C. (membranes with cDNA) or at 65.degree. C. (membranes with genomic DNA). Chemiluminescent detection of probes hybridized to DNA with anti-DIG antibodies was performed according to the protocol of the supplier(Roche-Boehringer). To visualize labeled probes hybridizing to DNA, membranes were exposed to Hyperfilm.TM. ECL.TM. Chemiluminescence film (Amersham Pharmacia Biotech).

PCR screening for lolA was performed on endophyte genomic DNA with primers lolA-3' and lolA-5'. PCR screening for lolC employed primers lolC-3'a (5'-GGTCTAGTATTACGTTGCCAGGG-3') (SEQ ID NO. 7) and lolC-5'a (5'-GTTGCCCACGGTGCGCGTCTTC-3') (SEQ IDNO. 8). PCR was performed with 35 cycles of 95.degree. C. for 30 s, 62.degree. C. for 30 s, and 72.degree. C. for 1 min. As a positive control for DNA integrity in this screening, a tub2 gene fragment was amplified by PCR with primers5'-TGGTCAACCAGCTCAGCACC-3' (SEQ ID NO. 9) and 5'-GAGAAAATGCGTGAGATTGT-3' (SEQ ID NO. 10) (Byrd et al., 1990), with 35 cycles of 95.degree. C. for 30 s, 55.degree. C. for 30 s, and 72.degree. C. for 1 min.

cDNA Library Screening and Conversion of Phage to Plasmid Clones.

Screening of the cDNA library was essentially as described by Ausubel et al. (2001). Phage were plated in a lawn of E. coli XL1-Blue, and phage lifts were on Hybond.TM.-N+ nylon membranes (Amersham Pharmacia Biotech). To convert clones in.lamda.TriplEx2 to plasmid form, plaques were added to E. coli strain BM25.8 (which expresses Cre-recombinase) as per the supplier's protocols (Clontech). Single, isolated colonies were selected on LB agar with ampicillin, picked and grown in LB withampicillin, and plasmids isolated by a rapid alkaline procedure (Ahn et al., 2000, BioTechniques 29: 266 368). To verify that a plasmid carried the desired insert, 3 .mu.l of each plasmid was spotted onto a nylon membrane for dot blotting, and themembrane hybridized to the probe initially used to identify the .lamda.-phage clone.

Plasmid DNA Isolation, Sequencing, and Database Search of cDNAs.

Plasmid DNA was isolated from bacterial cells by the rapid alkaline miniprep procedure (Ahn et al., 2000). Plasmid inserts were sequenced with primers L-triplEx 5' (5'-TCCGAGATCTGGACGAGC-3') (SEQ ID NO. 11) and L-triplEx 3'(5'-TAATACGACTCACTATAGGG-3') (SEQ ID NO. 12), specific to vector regions flanking the cDNA inserts. DNA cloned into TOPO vector (Invitrogen) was sequenced with M13-reverse (5'-CAGGAAACAGCTATGAC-3') (SEQ ID NO. 13) and M13-forward(5'-GTAAAACGACGGCCAG-3') (SEQ ID NO. 14) primers. Sequencing of DNA was performed with the BigDye Terminator Cycle Sequence Kit (Applied Biosystems) on an ABI 310 automated sequencer (Applied Biosystems) or, for high-throughput sequencing, the CEQ2000XLDNA Analysis System (Beckman-Coulter, Fullerton, Calif., USA) with the CEQ.TM. DTCS--Quick Start Kit (Beckman-Coulter). DNA sequences obtained were entered into the basic local alignment search tool (BLAST; Altschul et al., 1997) programs at theNational Center for Biotechnology Information site (NCBI; http://www.ncbi.nlm.nih.gov/BLAST/) to search the nonredundant nucleic acid (nr) database, and at the Whitehead Institute site (http://www-genome.wi.mit.edu/annotation/fungi/neurospora/) to searchthe Neurospora crassa database for similar sequences. Matches with known DNA/protein sequences in these databases were considered significant at E.ltoreq.10.sup.-4. Predicted protein sequences were analyzed for occurrence of biologically significantsites by searching the database of protein families and domains (PROSITE) at ExPASy (Expert Protein Analysis System; http://ca.expasy.org/).

EXAMPLE 2

Transcripts Up-Regulated in Loline Alkaloid-Producing Cultures.

To gauge the success of the suppression subtractive hybridization, and to get an overview of the number and sizes of cDNAs potentially enriched by the subtraction, cDNA-based northern analysis on total cDNA from the cultures were conducted (FIG.2). The subtracted cDNAs hybridized much more strongly with total cDNA from the LA-producing cultures than to total cDNA from the suppressed cultures, demonstrating enrichment of cDNAs up-regulated in the LA-producing cultures. Multiple sizes of cDNAshybridized with the subtracted cDNAs, indicating up-regulated expression of several different genes in the LA-producing cultures.

The .lamda.TriplEx2 library created with complete cDNA from LA-producing cultures contained a total of 4.1.times.10.sup.6 primary pfu. From this, 1.5.times.10.sup.6 primary pfu, likely representing the complete cDNA population obtained from theLA-producing cultures, were amplified to 5.4.times.10.sup.9 pfu ml.sup.-1.

The number of recombinant clones (=likely containing cDNA inserts) in the unamplified library was assessed by blue-white screening of the plated library at 3.3.times.10.sup.6 pfu (>80% of all primary library clones). To determine thepercentage of library clones that contained transcripts up-regulated in the LA-producing cultures, phage lifts were probed with total subtracted cDNA. Approximately 5.3% of all clones (about 6.6% of the presumed recombinant clones) hybridized with thesubtracted cDNA (data not shown).

EXAMPLE 3

Several Subtracted cDNA Similarities with Database Sequences.

Twenty clones from the subtracted EST bank, and six library clones hybridizing to total subtracted cDNA were sequenced. In the suppression subtractive method incomplete suppression can result from amplification of tester-tester hybrids whichhave only one of the two adaptors at each end. However, all ESTs sequenced from the bank of subtracted cDNAs had the two different adaptors at their ends, indicating that contaminating background due to non-specific amplification of tester was very low.

Sequences of subtracted cDNA clones, as well as inserts in library clones that hybridized to subtracted cDNAs, were used to query databases by various BLAST algorithms. For several subtracted cDNAs (Table 1) and cDNAs from the .lamda.-library(Table 2), matches to known protein sequences in NCBI, or sequences in the Ns. crassa database were identified. Five library and subtracted clones had significant similarity to the C-terminal amino acid regions of aspartate kinases (Tables 1 & 2). Twoof the library clones with similarity to aspartate kinase were identical to each other in sequence (P2 and P16). However, a third library clone (P17) differed from the other two (94% identity), but had 100% sequence identity with two subtracted clones(B8 and C5). The detected variation in sequence among the clones suggested more than one form of this gene in N. uncinatum. The presence of two genomic alleles of the AspK-related gene in N. uncinatum was verified by PCR with primers withallele-specific nucleotides at their 3'-ends (data not shown). Because other results of this study (described below) strongly associate these sequences with LA production, we will hereafter designate the corresponding genes as lolA alleles; the twoallelic sequences have been submitted to GenBank (accessions AF439396 and AF439395).

The predicted proteins (209 and 210 aa) encoded by lolA alleles were smaller than known aspartate kinases (which usually exceed 500 aa) and had similarity only to the C-terminal regions of aspartate kinases. This was indicated by proteinsequence alignments with known aspartate kinases that gave the most significant matches in BLAST. These proteins, from Schizosaccharomyces pombe and Saccharomyces cerevisiae (GenBank accessions T39822 and P10869), aligned with a region starting at aminoacid position 47 and ending at amino acid 204 of the predicted lolA proteins and had 25 26% identity to lolA, but only within a region of the known aspartate kinases starting at about amino acid 351 and ending at amino acid 495. PROSITE searches withthe predicted amino acid sequences of the two lolA alleles indicated that both lacked the aspartate kinase signature, defined by PROSITE as [LIVM]-x-K-[FY]-G-G-[ST]-[SC]-[LIVM], a conserved region located near the N-terminal end of aspartate kinases.

One subtracted clone, D6 (Table 1), gave highly significant matches with fungal (Ns. crassa, Emericella nidulans, and S. cerevisiae) genes for O-acetylhomoserine-(thiol)lyase (homocysteine synthase), and the related enzymes, cystathionine.gamma.-synthase and cystathionine .beta.-lyase, all of which are .gamma.-type pyridoxal phosphate-containing enzymes in sulfur-containing amino acid biosynthesis and interconversion pathways. Additionally, significant similarity was found with anenzyme in the biosynthesis of the bacterial compound rhizobitoxine. The molecular size of the transcript (between 1.5 to 2 kb, FIG. 3) predicted a protein similar in size to known homocysteine synthases, which are 430 450 amino acids (Sienko et al.,1998). A related sequence was recently identified at a locus associated with LA production in Epichloe festucae (Wilkinson et al., 2000; Spiering et al., 2000). Because these data and further evidence presented below associated this sequence with LAproduction, the corresponding gene was designated lolC (GenBank accessions AF461175, AF461176).

TABLE-US-00001 TABLE 1 Matches of subtracted cDNA clones with sequences in non-redundant (nr) and Neurospora crassa database BLAST searches. Clones.sup.1 Length in bp nr matches, identify (%), and E values Ns. crassa matches, identity (%), andE values K8, C37, D5 468 --.sup.2 -- B8, C5.sup.3 633 Sc. pombe.sup.4 aspartate kinase gene, 24%, 5e-07 -- N17, C7 1521 -- -- C2, D1 724 Kruppel-like C2H2 zinc finger transcription various contigs (1.246; 1.392; 1.622; 1.686; 1.151), 35 52%, factors,44%, 7e-08 4e-20 to 1e-05 C1, C3 283 -- -- E21 388 -- -- A6 370 -- -- A7 379 -- -- A8 554 -- Contig 1.291 (57.61 57.83 kb), 56%, C8 430 Sc. pombe hypothetical protein, 42%, 2e-05 Contig 2.503 (15.96 16.19 kb)., 38%, 7e-07 D2 472 -- -- D3 269 -- -- D4694 rRNA intron-encoded homing endonuclease, various contigs (2.820; 2.798; 2.816; 2.793; 2.790; 2.943; 86%; 2e-11 2.796, 2.843; 2.831; 2.957), 46 53%, 4e-10 to 3e-08 D6.sup.5 374 homocysteine synthase/O- Contig 2.65, 54%, 3e-24; Contig 2.688, 34%, 3e-11acetylhomoserinesulfhydrolase, 53%, 1e-22; related enzymes in methionine/cysteine biosynthesis, <1e-07); RtxA, enzyme in rhizobitoxine biosynthesis, 37%, 1e-10 .sup.1Listed in order of frequency from most common to least common. .sup.2-- = Nosignificant match. .sup.3lolA clones. .sup.4Schizosccharomyces pombe. .sup.5lolC clone.

TABLE-US-00002 TABLE 2 cDNA library clones hybridizing to total subtracted cDNA. Length of nucleotide Length of putative Identical in sequence BLAST matches, identify (%), and E Clone/s sequence [bp] ORF [aa] to subtracted clones/s values P2,P16.sup.6 838, 880.sup.7 210 none aspartate kinase (Sc. pombe) 25%, 3e-07 P3 446 35 K8, C37, D5 --.sup.8 P15 725 111 none Ns. crassa contig 1.1526 (36.73 36.96 kb), 36%, 5e-10 P17 774 209 B8, C5 aspartate kinase (Sc. pombe), 24%, 5e: 07 P18 449 30none .sup.6lolA clones .sup.7Difference in length of 3' untranslated region. .sup.8-- = No significant match.

EXAMPLE 4

Association of the lolA and lolC Genes with Loline Production.

Genomic sequences of lolC and one allele of lolA (clone P1.7) were obtained by using primers based on the cDNA of the lolA gene and genomic sequence of the lolC gene from E. festucae (data not shown). This information was used to design primersfor specific probes and detection of lolA and lolC sequences in cDNA-based northern analysis of complete cDNAs from LA-producing and suppressed cultures (FIG. 3). Both sequences were expressed in the LA-producing cultures. Strong hybridizing bands weredetected from the complete cDNA from LA-producing cultures, whereas faint bands were obtained from the complete cDNA from the suppressed cultures.

LA production is a trait specific to endophyte species (Christensen et al., 1993; Siegel et al., 1990; TePaske and Powell, 1993) or even isolates within species (Wilkinson et al., 2000). Consequently, we reasoned that genes associated with LAproduction would be present in all LA-producing endophytes, but might be absent from endophytes that do not produce LA. For many endophyte species and isolates available from our collection the LA phenotypes were known from the literature (Table 3), andthese were confirmed by GC analyses of plants symbiotic with these endophytes. Additional species or isolates included in this survey were similarly assessed for LA production (Table 4). In Southern-blot analysis of genomic DNAs from two LA producersand two nonproducers, lolA and lolC sequences hybridized only with DNA from the endophytes that produce LA (FIG. 4). The probes used to detect lolA and lolC did not have sites for the restriction enzyme used in the genomic digests, so for each putativeallele one hybridizing band was expected. In N. uncinatum, two bands were observed from the genomic DNA probed with lolA, indicating at least two alleles of this gene; hybridization with lolC gave only one band, suggesting only one allele of this genewas present, but the possibility that this single band represented multiple alleles of lolC could not be excluded. In E. festucae, hybridization with the two probes gave one strong hybridizing band for each, suggesting one allele of each gene. Theadditional, fainter hybridizing bands present on the blots corresponded to some bands on the ethidium bromide-stained gel (not shown) and were, therefore, likely due to non-specific binding of the probes to mitochondrial or repetitive genomic DNA.

Diagnostic PCR was used with primers specific to the lolA and lolC genes for detection of these sequences in all species and isolates listed in Table 3. Detection of the lolA and lolC genes in endophytes was strictly associated with theLA-producing phenotype (FIG. 5). In addition, the two genes were detected in N. chisosum (ATCC 64037).

The high expression of lolA and lolC in LA-producing cultures of N. uncinatum, and the strict correlation of LA production with presence of the two genes in the different endophytes, lent strong support to involvement of the lolA and lolC genesin LA production.

TABLE-US-00003 TABLE 3 LA phenotype of endophyte species and isolates used in this study. Indicated are the respective grass hosts which were used in the determination of the LA, and from which the endophytes in this study were originallyisolated. Loline Species/isolate.sup.9 Grass host phenotype.sup.10 Reference.sup.11 1).sup.12 Epichloe festucae CBS 102477 Festucae rubra - 1 2) E. festucae CBS 102475 N/A.sup.13 + 2 3) E. typhina 8 Lolium perenne - 3 4) Neotyphodiurn aotearoae CBS109345 Echinopogon ovatus + 4 5) N. aotearoae ATCC MYA-1231 E. ovatus + 4 6) N. australiense CBS 109346 E. ovatus - 4 7) M coenophiolum ATCC 90664 Lolium arundinaceum + 3 8) N. huerfanum ATCC 604040 Festuca arizonica - 3 9) N. inebrians 818 Achnatheruminebrians - 5 10) N. lolii 138 L. perenne - 3 11) N. melicicola CBS 109342 Melica decumbens - 4 12) N. occultans 999 Lolium multiflorum + 6 13) N. siegelii ATCC 74483 Lolium pratense + 7 14) Neotyphodium sp. 55 Poa autumnalis + 3 15) Neotyphodium sp. 87 Festuca paradoxa - 3 16) Neotyphodium sp. LpTG-2 Lp1 L. perenne - 8 17) Neotyphodium sp. 269 Hordeum bogdanii - 4 18) Neotyphodium sp. 270 Hordeum brevisubulatum - 4 19) Neotyphodium sp. 361 Hordelymus europaeus - 9 20) Neotyphodium sp. FaTG-3Tf18 L. arundinaceum + 4 21) Neotyphodium sp. FaTG-2 Tf14 L. arundinaceum - 4 22) Neotyphodium sp. 4096 Achnatherum robustum - 4 23) N. uncinatum CBS 102646 L. pratense + 7 .sup.9CBS = Centraalbureau voor Schimmelcultures, Fungal Biodiversity Center,Utrecht, The Netherlands (http://www.cbs.knaw.nl), ATCC = American Type Culture Collection, Manassas, Virginia, USA (http://www.atec.org). Other designations are from the referenced papers or are laboratory isolate numbers. .sup.10= "+" =loline-producing, "-" = loline non-producing. .sup.11References are (1) Leuchtmann and Schardl (1998), (2) Wilkinson et al. (2000), (3) Siegel et al. (1990), (4) this study (see Table 4), (5) Miles et al. (1996), (6) TePaske and Powell (1993), (7)Craven et al. (2001), (8) Christensen et al, (1993), (9) Leuchtmann et al., (2000). .sup.12Numbers before each isolate correspond to the numbers indicated above gel lanes in FIG. 6. .sup.13N/A = not applicable. Isolate derived by mating E. festucaeCBS102477 with an E. festucae isolate CBS 102474 from Lolium giganteum.

TABLE-US-00004 TABLE 4 LA in plants with endophyte species for which the LA phenotype was previously unknown. Species/isolate.sup.14 Host grass Lolines.sup.15 Neotyphodium aotearoae Echinopogon ovatus 1780 CBS 109345 N. aotearoae ATCC MYA-1231E. ovatus 2120 N. australiense CBS 109346 E. ovatus nd N. melicicola CBS 109342 Melica decumbens nd Neotyphodium sp. FaTG-3 Tf18 Lolium arundinaceum 670 Neotyphodium sp. FaTG-2 Tf14 L. arundinaceum nd Neotyphodium sp. 269 Hordeum bogdanii ndNeotyphodium sp. 270 Hordeum brevisubulatum nd Neotyphodium sp. 270 Stipa robusta nd .sup.14CBS = Centraalbureau voor Schimmelcultures, Fungal Biodiversity Center, Utrecht, The Netherlands (http://www.cbs.knaw.nl), ATCC = American Type CultureCollection, Manassas, Virginia, USA (http://www.atcc.org). Other designations are from the referenced papers or are laboratory isolate numbers. .sup.15Reported is the sum of N-formyl and N-acetyl lolines in .mu.g g.sup.-1 dry weight plant tissue. nd =not detected (limit of dection = 10 .mu.g g.sup.-1).

EXAMPLE 5

Additional Subtracted cDNAs Matching Known Genes and Genomic Sequences.

As shown in Tables 1 & 2, several other cDNAs isolated by the subtraction method also gave highly significant matches in BLAST searches of the nr and Ns. crassa databases. Matches included a zinc-finger transcription factor, a hypotheticalprotein in S cerevisiae, and a homing endonuclease. Additionally, matches with Ns. crassa sequences were identified for putative ORFs of one hybridizing library clone, P15, and one subtracted clone, A8.

A survey of the distribution of the putative zinc-finger transcription factor among eight endophytes differing in LA production (four LA producers and four non-producers) was performed by diagnostic PCR. There was no association of this putativezinc-finger transcription factor gene with LA production; its presence was detected only in two isolates, one LA-producer (N. uncinatum) and one non-producer (N. huerfanum) (data not shown).

As further indicated in Tables 1 & 2, a number of sequences from library and subtracted clones gave no significant matches with known genes in the nr database and sequences in the Ns. crassa genome. For one subtracted clone, N17, thefull-length cDNA sequence was obtained by PCR, using an aliquot of the amplified cDNA library and gene and vector-specific primers. A predicted ORF of 363 amino acids was found within the N17 cDNA (data not shown), but this amino acid sequence did notgive significant matches with any genes or sequences in the nr and Ns. crassa databases or known protein patterns in the PROSITE database.

EXAMPLE 6

Identification of the LOL1 and LOL2 Gene Clusters

Central to the present invention is the identification of the loline alkaloid gene clusters LOL1 (SEQ ID NO. 15), and LOL2 (SEQ ID NO. 16) which apparently may also include lolF2 and lolM (SEQ ID NO: 17). The association in Neotyphodiumuncinatum of lolA and lolC was tested by long-distance-PCR. The 8.2 kb product contained the expected sequences of both, plus two additional open reading frames between them. We then walked outward from this fragment by vectorette-mediated PCR, and inthe process identified two gene clusters (LOL1 and LOL2 in FIG. 6).

In addition to lolC and lolA, at least 8 (LOL1) or 7 (LOL2) ORFs were inferred within LOL1 and LOL2 by using a program with an algorithm for prediction of fungal genes. PCR analyses/Southern hybridization on a cDNA library/total cDNA from N.uncinatum showed expression of the ORFs lolM, lolF, lolC, lolO, lolA, and lolE, indicating that these contain active genes. The details of the gene predictions and coordinates, i.e., location of the exons in the ORFs of LOL1 and LOL2 are given below. LOL1 and LOL2 differ in sequence (LOL1 has .about.95% nucleotide sequence identity to LOL2), thus represent two truly distinct genomic regions. Altogether, ten genes were inferred in the gene clusters, with most of the genes shared between the clusters. PCR and Southern-blot analyses indicated that all ten genes were unique to the loline alkaloid producers among the isolates surveyed in Table 3 (Fung. Genet. Biol. Spiering et al.). Nine of the genes, lolE, lolT, lolP, lolU, lolA, lolO, lolD, lolCand lolF, were found in two allelic forms.

The amino acid sequences deduced from the LOL gene ORFs gave highly significant matches (E<10.sup.-5; except lolU and lolM for which E>0.01) with known enzyme sequences in the protein databases curated by the National Center ofBiotechnology Information (http://www.ncbi.nlm.nih.gov; NCBI). The gene functions predicted by Genbank searches of the databases at NCBI, and gene orientations within the clusters, thereby indicate that LOL2 contains eight genes (i.e., lolE, lolT, lolP,lolU, lolA, lolO, lolD, and lolC) representing alleles of genes present in LOL1. LOL1 contains an additional gene, named lolF, hitherto not found in LOL2. The genomic location of the additional ORFs, lolF2 and lolM, relative to the two LOL clusters ispresently unknown, but we postulate that lolF2 and lolM are located close to LOL2. lolF2 and sequence adjacent to it has .about.93% identity to lolF (and sequence adjacent to it) in cluster LOL1.

The LOL1 gene cluster spans about a 25.3 kB region and consists of 9 ORFs. Open reading frames of LOL1 are indicated relative to nucleotide numbers annotated to SEQ ID NO: 15; mRNA sequences of each gene are given by joined exons determined bycDNA sequencing or predicted by the fgenesh (Neurospora) gene prediction program at "Softberry", http://www.softberry.com/berry.phtml?topic=gfind); gene orientations are indicated by "+" (forward strand) and "-" (reverse strand).

ORF1 of LOL1 is lolE: +strand, join 23457 24195, 24275 24306 (predicted by fgenesh at Softberry).

ORF2 of LOL1 is lolT: -strand, join 23003 22916, 22838 22916, 22420 22246, 22170 21486 (predicted by fgenesh at Softberry).

ORF3 of LOL1 is lolP: +strand, join 19245 19554, 19639 20225, 20287 20694, 20818 20846, 20919 21045 (predicted by fgenesh at Softberry).

ORF4 is lolU: -strand, join 17377 17023, 16832 15889 (predicted by fgenesh at Softberry).

ORF5 of LOL1 is lolA: +strand, join 14951 15476, 15545 15648 (determined by sequencing of lolA cDNA).

ORF6 of LOL1 is lolO: -strand, join 13961 13770, 13781 13677 (predicted by fgenesh at Softberry).

ORF7 of LOL1 is lolD: +strand, join 10462 10588, 10945 11115, 11194 11757, 12211 12240, 12376 12383 (predicted by fgenesh at Softberry).

ORF8 of LOL1 is lolC: +strand, join 6903 7000, 7063 7114, 7199 7282, 7364 7723, 7810 8364, 8435 8709 (determined by sequencing of lolC cDNA).

ORF 9 of LOL1 is lolF: -strand, join 5095 5028, 4960 3509, 3448 3346 (predicted by fgenesh at Softberry).

The LOL2 gene cluster spans about a 16.4 kB region and consists of at least 8 ORFs. It appears that LOL2 may include lolF2 and lolM (SEQ ID NO: 17) linked to the 5' end of SEQ ID NO: 16, in which case the LOL2 gene cluster would span about a 24kB region, consisting of 10 ORFs (i.e., ORF1' through ORF10'). ORFs of LOL2 are indicated relative to nucleotide numbers annotated to SEQ ID NO: 16; mRNA sequences of each gene are given by joined exons determined by cDNA sequencing or predicted by thefgenesh (Neurospora) gene prediction program at "Softberry", http://www.softberry.com/berry.phtml?topic=gfind); gene orientations are indicated by "+" (forward strand) and "-" (reverse strand).

ORF1' of LOL2 is lolE: +strand, join 15210 15946, 16026 16057 (predicted by fgenesh at Softberry).

ORF2' of LOL2 is lolT: -strand, join 14753 14666, 14588 13997, 13920 13206 (predicted by fgenesh at Softberry).

ORF3' of LOL2 is lolP: +strand, join 11163 11257, 11551 11762, 11836 11925, 12000 12541 (predicted by fgenesh at Softberry).

ORF4' of LOL2 is lolU: -strand, join 10438 9597, 9531 8916 (predicted by fgenesh at Softberry).

ORF5' of LOL2 is lolA: +strand, join 8006 8534, 8603 8706 (predicted by sequencing of lolA cDNA).

ORF6' of LOL2 is lolO: -strand, join 7190 6999, 6907 6011 (predicted by fgenesh at Softberry).

ORF7' of LOL2 is lolD: +strand, join 3867 3993, 4103 4525, 4616 5026, 5118 5143 (predicted by fgenesh at Softberry).

ORF8' of LOL2 is lolC: +strand, join 873 970, 1033 1084, 1167 1250, 1334 1693, 1782 2335, 2406 2679 (predicted by sequencing of lolC cDNA).

It also appears that LOL2 may include lolF2, an allele of lolF, and lolM, probably linked to the 5' end of LOL2 (SEQ ID NO: 16). The ORFs of lolF2 and lolM are indicated relative to nucleotide numbers annotated to sequence of SEQ ID NO: 17; mRNAsequences of each gene are given by joined exons predicted by the fgenesh (Neurospora) gene prediction program at "Softberry", http://www.softberry .com/berry.phtml?topic=gfind); gene orientations are indicated by "+" (forward strand) and "-" (reversestrand).

ORF9' is lolF2: -strand, join 5804 4342, 4281 4207, 3905 3821 (predicted by fgenesh at Softberry).

ORF10' is lolM: -strand, join 1689 1525, 1430 1332, 1231 1174, 1085 1021 (predicted by fgenesh at Softberry).

EXAMPLE 7

Functional Assignment of the Loline Alkaloid Gene Clusters

Most of the predicted gene products show highly significant BLAST matches (E le-7) with known biosynthetic enzymes and motifs. The closest BLAST matches and/or motifs of the ten genes follow in the order that they occur in the clusters: lolEgave a match to epoxidases; lolT and lolT2 matched the diagnostic domain of .alpha.-type pyridoxal phosphate (PLP)-associated enzymes, including class-v aminotransferases; lolP matched cytochromes P450, with closest relationship to pisatin demethylasefrom Nectria haematococca; lolU gave no significant match or diagnostic motif; lolA closely matched the Asp kinase allosteric amino acid binding domain; lolO matched nonheme-Fe oxidoreductases, especially isopenicillin N synthase; lolD matched ornithinedecarboxylase (an .alpha.-type PLP enzyme); lolC appeared to be a .gamma.-type PLP enzyme; lolF and lolF2 appeared to encode an FAD-containing monooxygenase with closest match to cyclohexanone oxidase; lolM had no significant BLAST match or motif.

EXAMPLE 8

Hybridizable Variants

The nucleic acids of the present invention comprise at least a nucleotide sequence of all or part of SEQ ID NO: 15 or SEQ ID NO: 16 or variants thereof. It also appears that SEQ ID NO: 17 or variants thereof may be part of the LOL2 gene clusterlinked to the 5' end of SEQ ID NO: 16, and therefore, nucleic acid sequences that hybridize to all or part of SEQ ID NO: 17 are also encompassed by the present invention. Variants of the present invention encode isolated nucleic acids that at leasthybridize to all or part of SEQ ID NO. 15 or SEQ ID NO. 16 or the complements thereof under hybridization conditions of, at, or between, low and high stringency conditions, and have insecticidal activity. Low stringency conditions are generally about3.times.SCC at about 45.degree. C. to about 65.degree. C., and high stringency conditions are generally about 0.1.times.SSC, 0.1% SDS at about 65.degree. to 68.degree. C. Preferably, the hybridization conditions are highly stringent at 0.1.times.SSC,0.1% SDS at 65.degree. C. Variants are made by methods known to one of ordinary skill in the art and as set forth in Maniatis et al. Molecular Cloning: A Laboratory Manual (Current Edition). Preferably, the hybridized nucleic acids code for apolypeptide that has one or more or all of the physical and/or biological properties of loline alkaloids, such as insecticidal activity and feeding deterrent properties.

EXAMPLE 9

Host-Vector System

Identification and cloning of the loline alkaloid gene clusters is useful for the development of a host-vector system for the efficient recombination production of both novel and known alkaloids. The coding sequences which collectively encode aloline-type alkaloid gene cluster, including variants, hybrids, mutants, analogs or derivatives of the loline alkaloid gene cluster, can be inserted into one or more expression vectors, using methods known to those of skill in the art. The replacementgene cluster need not correspond to the complete native loline alkaloid gene cluster, but need only encode a functional gene cluster to catalyze production of an alkaloid.

The recombinant vector(s) of the present invention includes replacement gene clusters derived from a single gene cluster, or may comprise hybrid replacement gene clusters with, e.g., a gene of one cluster replaced by the corresponding gene fromanother gene cluster. For example, the oxidoreductase of LOL1 may be replaced with the oxidoreductase of LOL2 without an effect on the product structure. Accordingly, these genes may be freely interchangeable in the constructs described herein. Thus,the replacement clusters of the present invention can be derived from any combination of alkaloid gene sets, which ultimately function to produce an identifiable alkaloid.

Expression vectors also include control sequences operably linked to the desired alkaloid coding sequence. Suitable expression systems for use with the present invention include systems, which function in eucaryotic and procaryotic host cells. However, procaryotic systems are preferred, and in particular, systems compatible with Neotyphodium, Epichloe, Adenocarpus and Argyreia mollis species are of particular interest. Control elements for use in such systems include promoters, optionallycontaining operator sequences, and ribosome binding sites. Particularly useful promoters include control sequences derived from alkaloid gene clusters. However, other bacterial promoters, such as those derived from sugar metabolizing enzymes, such asgalactose, lactose (lac) and maltose, will also find use in the present constructs. Additional examples include promoter sequences derived from biosynthetic enzymes such as tryptophan (trp), the beta-lactamase (bla) promoter system, bacteriophage lambdaPL, and T5. In addition, synthetic promoters, such as the tac promoter, which do not occur in nature also function in bacterial host cells.

Other regulatory sequences may also be desirable which allow for regulation of expression of the replacement gene cluster relative to the growth of the host cell. Regulatory sequences are known to those of skill in the art, and examples includethose which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Other types of regulatory elements may also be present in the vector, for example,enhancer sequences.

Selectable markers can also be included in the recombinant expression vectors. A variety of markers are known which are useful in selecting for transformed cell lines and generally comprise a gene whose expression confers a selectable phenotypeon transformed cells when the cells are grown in an appropriate selective medium. Such markers include, for example, genes which confer antibiotic resistance or sensitivity to the plasmid.

The various subunits of gene clusters of interest can be cloned into one or more recombinant vectors as individual cassettes, with separate control elements, or under the control of, e.g., a single promoter. These subunits can include flankingrestriction sites to allow for the easy deletion and insertion of other subunits so that hybrid gene clusters can be generated. The design of such unique restriction sites is known to those of skill in the art and can be accomplished using thetechniques described above, such as site-directed mutagenesis and PCR.

Further, the vectors, which collectively encode a replacement gene cluster can be inserted in to one or more host cell, using methods known to those of skill in the art. As such, the present invention also provides host cells which have theirnaturally occurring gene substantially deleted, transformed with vectors encoding a replacement gene cluster or parts thereof, for the production of active alkaloids. The invention provides for the production of significant quantities of product at anappropriate stage of the growth cycle. The alkaloids so produced can be used as insecticidal and feeding-deterrent agents to protect plants. The ability to recombinantly produce alkaloids also provides a powerful tool for characterizing biosyntheticenzymes and the mechanism of their actions.

More particularly, host cells for the recombinant production of the subject alkaloids can be derived from any organism with the capability of harboring a recombinant gene cluster. Thus, the genetically engineered host cells of the presentinvention can be derived from either procaryotic or eucaryotic organisms. Preferably, the host may be E. coli. However, more preferred host cells are those constructed from the Neotyphodium species, among others, will provide convenient host cells forthe subject invention.

The above-described host cells are genetically engineered by deleting the naturally occurring loline alkaloid genes or genes encoding tailoring enzymes therefrom, using standard techniques, such as by homologous or heterologous recombination. One or more recombinant vector, collectively encoding a replacement gene cluster of the present invention, is then introduced into a host cell. The vector(s) can include native or hybrid combinations of loline alkaloid gene cluster subunits, or mutants,analogs, or derivatives thereof. Methods for introducing the recombinant vectors of the present invention into suitable host cells are known to those of skill in the art and typically include the use of CaCl.sub.2 or other agents, such as divalentcations and DMSO. DNA can also be introduced into bacterial cells by electroporation. Once the genes or gene clusters are expressed, the alkaloid producing colonies can be identified and isolated using known techniques. The produced alkaloids can thenbe further characterized, e.g. by NMR and mass spectroscopy.

Although illustrative embodiments of the present invention have been described in detail, it is to be understood that the present invention is not limited to those precise embodiments, and that various changes and modifications can be effectedtherein by one skilled in the art without departing from the scope and spirit of the invention as defined by the appended claims.

>

DNA Unknown Artificial primer sequence tctcc aagatccgtg agg 23 2 2nknown Artificial primer sequence 2 gtttcgtccg agttctcgac 2DNA Unknown Artificial primer sequence 3 gtctggcgaa ttctacagac acg 23 4 2nknown Artificial primer sequence 4 gatggccatg tgaggaaaga g 2DNA Unknown Artificial primer sequence5 cggtgcgcgt cttctaaact tgac 24 6 25 DNA Unknown Artificial primer sequence 6 gaatctttcc gatgcaaggc ttacg 25 7 23 DNA Unknown Artificial primer sequence 7 ggtctagtat tacgttgcca ggg 23 8 22 DNA Unknown Artificial primer sequence 8 gttgcccacg gtgcgcgtct tc22 9 2nknown Artificial primer sequence 9 tggtcaacca gctcagcacc 2 DNA Unknown Artificial primer sequence aaatgc gtgagattgt 2 DNA Unknown Artificial primer sequence agatct ggacgagc nknown Artificial primersequence acgact cactataggg 2 DNA Unknown Artificial primer sequence aaacag ctatgac 6 DNA Unknown Artificial primer sequence aacgac ggccag 5346 DNA Neotyphodium uncinatum ttatat taaatagtgc ttattatctagattaaataa tcctatacta tttatctaat 6tatta ctaatattag ggtatatagc tatacttttt cttaaggagt tttactatat tttcctt tcttacttag gctataacta taatttttag tttagtaagt tactttatta tatttat ttaattatag tattttacta aattaggagc tatctactac cctagactag 24aataa aatatttttt ctattctaac taggtaaatt actaaatatt atctaatttc 3agtagc ttagtaacta ttaaaggtag cttaattaaa tagtgcctat atcttaaagc 36tctac cttatctaaa gtaatttttc ctaagttaaa gaagttagga tccctattct 42tctaa ctatatataa atatatatgt taagtgctatctaaagctat ttatattata 48agaat tttctcttaa gtaaaccctt tttaatttat aaagcttaag attaaatact 54agtgc tttataaata taattagact aggttatagt agttctctat tctattaggt 6cttaga taataaagta taatacttct atagctagta ataggtttcc ttaattattt 66tatataaaattaagg tctttaagtt atcccctagt gttttctatt taaccctaat 72atatt aaactaaagg agtatcttat ccttagactc attttaagtt tataatatag 78atttt aactacttat taaagcttta agttaatatc ttacttaagt atcttacact 84aactt aggtatacct attaccttta tctttacttt aaaatctttaataaagttag 9attatc ccctataaac tactaaatat tgatttttta aattttttta ggggttatta 96agcca atgcatctaa taaaataaga taataataat tactagcaat acctagctag taataatt aacttataac taatcttaac tatagtaata aataaaaccc taatagaaac gctttaag gttataaatatagggggggc tataaggtta gattaaagtt tgtaataaac tatagcta cgttagcgca agatatagtc atagttcgcg accgcagtca aactcaaatt ttcgataa actactaaat attataccta ttttatatag taataaggga tatctaatac tattattt ctctaagaag ctttataaag gtctttatat taaggcccctaaggggttta tatagtct ttctattatt aggatctttt cctaagtagt ttttaaatta ggtttatact actagtaa ctattttaga attaattaat ttctaactag gaactagagt actaggtaat aaattctt agagatcctt taggtaactt agctacttac taggccttac tttacttagt tttaaaat aaaataaggtaaggttaaat atagaattag ctaagagtgc ttttaattaa tattagaa aagtaatagc ttaactaaat atctaaatac ttataagact ttactaaaaa ggttttta gtagtgtaat atttatagtt ataagtaagc tataagtaaa ggctattgat tttaaaat tttttggggg ttattagtta tagctaatgc atctaataaaataagataac taattact agtaatacct agctagtata ataattaact tataactaat cttaactata aataaata aaaccctaat agaaataagc tttaaggtta taaatatagg gggggctata gttagatt aaagtttgta ataaagtttg tggctgcgtt agcgcaagat atagtcatag tgcgaccg tagttaaactcaaattcgtt cgagttttta agtaaaggct ataagtataa atatagct ctttataata agctataaga ttctaatact tagctaaata actataaaat 2taataag tcttaagatt aaatagttta taacactagg tagcgcttcc tatcttaggt 2tatattt agagatctct agtaaggggt taatagctta gctagtgtttatagaatata 2taggatt agttactatc ttcctctata gttttatata atataatttc ctcttcttaa 222cttaa ctctctaagc ctagctagcc ttatattaat actatagcct cctttaggta 228ctagg ctattaattt atattatact atagggaaaa taaaataaag gggttttata 234tagct tagtaatagctaaagaattt agctagaaat acccttctaa ttaatcttag 24aagtaa gttaattaga gagtctaagg tccttagggt tttaaaacct atttctctac 246ttatt aagtaaaaaa taatacccta aaagacataa tactagccta tagttatagg 252atagc atttacttac actaaagggg ttaattaact taatagtagcaattataata 258taaat ctatctctat atatagggat agattagatt agattaaata atctattaga 264aatgc ctttttaatt aaatcagggg aaaatagtct tattaattta tcttattaaa 27atataa tagtagctat agtaacacta ggccttaaag tcaaaaatct agagttagtt 276taatt tatactaaagaaatctagct ataggtagtc cctttataga ttaaataatc 282atcta gataactaat atcgttatcc cttaatgtgt tatccattcc tttaatccct 288ttatc atcacgatcg cgtgttttgt gggcgcgcgt atcatagcac acagtacttc 294gattt ggactaacgt ggtatgcgca tttagtggcc ctaggacgtatggtgccgga 3ttgtagg ctatccgtcc tagcctaacc tatctaggca ttggtctagc aacaggctta 3gggctag ctaagatgta gatatgtaca agatgctatc aaactgctat tgtgtttgcc 3aaggtta ctagcagatg ccaccgacgg aaacgatgcc cattttcttc tggcacagaa 3gagacgt attgggtgtttgtcaatacc agagtctgat cagtggaaca tggaaaatcg 324acaaa atctgcctag ccgtcatcca aaaaaaaaaa aaccaattgc tacttgcgtc 33cctgaa gagtgtatcg actcgatata cgacagaaag tggcttcaca gaagacccgt 336ctaca tgccacgctt gaaacccctc caggttgttg gccagacagttttccagctc 342gatac agaatcaacc ccccaaccct gatcagtttg ttagagcagt ccacagaaca 348acaag agcccttgtg caacctacca agttttctct tccttgttag cctcagctgt 354tgctt ttgcgtgcat gtgtatggta gagtgtcttg tcccaaagta ggctcatctt 36tcccac tggcagtgggatttggaagt cgcctcgagt tgacaaatgc ccgcctgttg 366ttgcg atgatttcgc acaaccactc tacctgaacg gtgatgaccg cgggggagtt 372gaagt gtagggcact ggggtccata gaggatgacc atgttgggga atgaatgaat 378ttccg agatgcgact cgacaccatc ggaccaggca tcttctaaacggatgccatt 384ctctg atatgaagac tcctgagccc gcttgcctcg tcgccaaacc cggtggcaag 39atggct tcgcattcaa ctgtctgccc atgaacgcgg atacctgtct ctgtaattaa 396tttgc tggttgctga tgtcaataac cttcacatgg ggttggtcca taacctcgta 4atcctct tccaaacagggtcgcttgat accaaaggca aaagatggaa tttgaggcac 4gagctcc cgtttggcca catcgctgat tctagctcgc gtccgccgag cccagaaatc 4cgcatcc cggttggctt ggatgttctg gcacagatcc cggaacccag ccatccagaa 42cagcct cccgccagat agcgttgttg ataaaaatgg tttcgctcctctattgggac 426acgtg tcctggtcac ggggcacgta gccgaaaccg tttgaagtct gcagtccaag 432gggct tctctgtggt cgtcgggtct catgcaaagt gccgttgccg tctggctcgg 438cgtat ttgcgtagag tgaggcatgg agactgctgg aatatcgtca tggccttggc 444taccc acagattggatgatctgaac tccgcttggc cccgttccaa tgacagccac 45ttaccg cgcatactga cagcgtcatg aggccatttt gcggtgtggt agatgggacc 456atcga gacattcctg gaatcctggg gatgttgaga acggacgaaa accctacagc 462tgaac catcgcgcct cggctcttct gccatcttct aaagagacggtccatctctg 468tttct gagtaccggg ccgcggaaac cgaaacgcca aactcaaaac tagcagagat 474atcgc ttgtccacgt ggtcaaaata tctcagcatc tctgcacggg tgggaaattg 48acccat tcccaatctt ggagaagctc cgcatcatag aactggtaga agggaaacag 486cgact gctgctcccggataagcgtt ctcgcgccag acacctccaa gacgttcctg 492caaac ccttggactc gaaatccgag ctttcgtagt ctttagtcat agttcagtcc 498ctcta ctctattcgt gtcttggatg gcaacgtaga ctctcacctg tagacagcga 5tacctga aaaaccagcg ccaacgacga ttacgtccaa attggtcaatgtcatcttag 5aatgaag aagaattaaa taatcatatg cagaatagaa gcaaattttg gtgtatcaga 5gtcatca aaggctaaca gctccgggga cagaaaagct tgatcgaggc tgcaatttac 522ggcgt aagggactga tactaagacg gtcgattatc tgtgtgcgag tggtcagaat 528actgc gcatttggatagcccagttt gggaggggga gtatagtcgt acacatggat 534atttg ggaatgaagc gttaagtctg ttatggtata atagggtcac taaatgcaca 54gcgtta gtcctaatcc ggattaacga tccatgcacc ttatgcctat atgtgtcata 546aggta ttgatattat taaagctatt acaattacca ctatactagtattaacttaa 552taact ctctattata tacgccttaa ataattacta ctaaataaat tcaaccacta 558ccgtt acttactaag tattaatagc actgattata tcttttatag ttatatacaa 564ttatc tttaataatg acataataaa gggcacttaa aaagagcctt attatattat 57cgttgc attgcattgcgttacattat attagaaggc tttttacaat aagcattata 576ccact tgcattttat actagctctc taatatactt agcaagggat taagtaaaca 582ttttt ttgttttagg actaacgcgg tatgcgcatt tagtgacccg gtataatagg 588ggaga ggcgtgagtg gggtgttcac tcactccgtg tcacgtcacttctcacaaag 594ggagc gtggctattc ggacctgcgt tttcttgctt actagagctg tgcctaccac 6atagggc cacatcccac atcccacgcc ccgccactaa attatttgta tagcactccc 6caataaa aatagtcaga attacagtac acccctgagt tattttacag atctacataa 6gggggat tgagcgaattaagtgctagc aaagaaataa gggagatagg ggctaggatt 6aagtacc tagattcctt tatactttat atagaaaatt atatatcttt tagtagtgct 624tgcta tatattttcc ttatagctct ctaaaataat ataggggttc tagtgcactt 63ctaatt atagctatta gagaggaacg aaaaactagg gcatgtagatttgtaaaatg 636gtaca ggcctgtcgg ccccgcccgc cgcaataggt aatagctgta ctacgcccgt 642ccacc cacttatcat gccacgcccc acttcttttg gttcgcgtgc cacttcagtg 648tactc cgtattcata agcttgacaa acacacatcc gcgacaacgg tatcctcatc 654ggccg cataccataatgcttgctgc agctcattga taatatacct ggcctaagat 66acgacc gaccggctgg agtcatcggc tttgcctggc cctccgctat tttgagagac 666cggcc tggtgactac aatttgctac caagacagat tcgctgaata tccgcaagca 672gctgc atcatcaaaa cataaataac gaccaaagaa tacacggagtagaagaaagg 678ccaga acaagttggc gattttccaa cttggttact cacccaagcc gtcactctgt 684tcatt actcgccttc cagtgtcttg cccaccttgt ttcaatattg tcgtcgagca 69gacagt agatacgatt acttcgactt ctaacgggaa ccaagatgtt ccaaaggagt 696ccaaa agaattcgaaactcagcttc tccatgttgg gtaggttatc gcgcctcata 7cggtcct ctatcccaga actaatcagt ttgcgattca agccggttcc cggacatttt 7cagttgc gcggtgcctg tatacagttc ggcagtaaga tcaagccacc gcctcctcga 7ccaccaa ctatgccaca tgtactgaat tcttttccct ttttgcgcatcttgataggc 72gagttc aacagcgttg cccacggtgc gcgtcttcta aacttgacgc agttcggcaa 726acagc cgcttcacca atgtttgtct ctttctcctt ctccctcatg actgcttttt 732aggac acaagctaat aaaacaaaac catccttcaa cagcccaccg tcaatgtatt 738atcga ctggccgggctggaaggagg cgtcgctgct tgtgccgtcg catccggctc 744cggta gtcgtgacgg taatggccct cgcaggcgtt ggcgacaact tcgtctcatc 75cacgtt catgctggca ctttccacca gttcgagagt ttagccaagc agatgggcat 756gccgc tttgtgaagt ctcgagaccc tgcagacttt gcggcggccatcgacgacaa 762agttc gtctggcttg agaccatcag caaccctggc aacgtaatac tagaccttga 768tctcg atggtctgcc acaccaaggg cattcctttg attgttagta tcccaatgaa 774tccgt cccatagggg gggttggggc taaaattcgg ggggatgtgg ttcccatcca 78tttagt gcgataacacctttggctgt gccgggtact tttgtcgtcc catcaaccac 786cgata tcgtcgttca ctcggccacc aagtggatcg gcggccacgg cactacggta 792tgtca tcgtcgacgg cggtaccttt gactggggcc agcacccgga tcggttcccc 798ccatg atccacggac gcgactctgg gaacgctttt cccgtcgggcgtttgctgtc 8tgccagt ttgagatcct gcgcgatacg gggagcaccc tcagcgctcc tgcggcccag 8ctgctgg ttggcctcga atcccttgcc gtgcgctgcg agcgccacgc gcagaatgcg 8aagattg ccgactggct gcgtgagcat cccctcgtgg cctgggtcag ctatgttggt 822gaacc accccgatcaccagggagcg ctcaagtacc tcaagcgagg ctttggctcg 828ctgct ttggtctacg gggggggttt cgaagcaggt gccctgttct gcgatgcgtt 834tggtc atcaccacta ccaagtgcgt aattaaacta gccccttctt ctcccgagag 84tcgttc tgccattcta acctcgcttt gcagcctggg ggatgccaagaccctgatcc 846cccgc ctcgactact catgagcact tcagttccga gcatcgagct gaggctggcg 852gatga tatgatcagg ctgtctgtgg gtattgagca gatcaaggat atcaaggccg 858gagca ggcctttgag caagtgcttc ggggtaagaa gagtcttcgt aagccttgca 864aagat tctcttgcaggatgagatca atgaagactt atttggacct tcagcttgtc 87cgtaaa taggggtcat tgcgaggcat ggtaaatgtt ctaccagaag tggcatggaa 876ttcca atagacctgt aattcacggt tgctacgttt tttcatactt accatgcgga 882tttga taatatttct ttaagtgtgc agaactcgta gtcacttacaaagctaattg 888attaa tctttagtgc gccatgtcct cttgactatc ttgtaaacga aggggcatta 894gcttt gctttgtctc tcctcgtgtt tttaagtttt gctatattaa cttgaatatt 9actaact agatgctagg ctttttacta tttacaaaca cctgtaacaa tcagcgcggc 9aggcaac tgcagagattattttactat agtatagact ataatgccat actttaatta 9ttcagta cgctatgttt ttttcactat cttgtacaga ttaaacaaag ggccattagg 9gtgttgg gagcataaag gcaaagaggt cagagacagg acaaccgtat agtgaatcct 924gacta agcgtagttg cctagctagt agatctcctt aagcgtgctacagcttgtca 93acgtta gctagagtct atatctaatt agataaaagt acattaaaat agtatatata 936atgta aattagctaa taatcgttat actagtaatt ttctatagta tagattacta 942cactc attaattatc ttagataagt agtacgtact tacgcggtta ttaaccttat 948ggggg gctgacgtaaggtagcttag gagtataagg gggctgtaag ggataatcct 954ctctc ctccagtttc ttaatactac atcgacgccc tatcgcagtc gcctaggggc 96ctataa caggaggtta gagtttgaga catttacgca caaacctaat ataggtagcc 966attag taacaaagaa tcttagctat tactcggttt taacaaaccaggccattagc 972cagca tgctccactt agtctctccc agtgttttag agttatacta tgttattaca 978tacat atactattat tttaaagtaa actttcacat tttaaaactt attatgttaa 984gataa ttcatgcata tattaacttg aatactatta cttactactc gatactaggc 99tactat ttacaaacacccataatagg cggcgtggcg tgaggcaatt gaggagacag 996caata gcagggagca tatcacattc atttatagta cagatgccga gccaaatgcc tgcgtgatc gaaacggtga gccaaagcgc agcacaccat caagatgcgg ctgtaatctc gttgtcact tggaagcact tggaagcact cgtgcataac gcaagtcgctctctcataca ggctttcag agtttatgag ggactagaac agacaagtct ggctttttga caaggaagta ctggacaag gttcgcaggc gctctgaccg agcataaacc aatattggag actggagact tgccatgtc ttcaataggc ccttatgtag ccttgcttgt gtgtgtactt gcagggatgt tataaatat gtgtatgttcgagtatcttg ttcggttttg taaactcaaa ctcgccagct tcagcctgt cagccgagtg aattgctatt gccattgtat tactccagaa cacgtatctt cacaaactc caatctcagc aatggccacc gtcgtacgag aagcatttga gaaccatgtc agctggtcg agagtcggaa ctcgcccggc catgtgcttg cttcttctgaggcctccttc ttgttgccg acttgaacga cattgttcgt aagtgggcgg cgtggaagaa agctctcccg atgtcaccc ctttttttgg tacgtcctca attcccccca tttcatgtct cactaagctg gaagtcccg tccgagggtc cgaatcaatt gacttggagg cagccgtgaa aagcagctac atcgacggc tgatccagactctggccacc tgtggagccg gatttgactg tgcctcggtg aggagattg agttgatcct ctccttgggc attggcgcag aacgaatcgt cttcactcat cgtgcaagc ccgtctctcc tcgggctttg ccgcaagctt gggatcacgc tcatcacttt gacacgaat gcgaagctcg taagctcacc atcactatcc cgaggctcagaccgtcctcc cgtcttcgc cgacgaccca accaatgccg atcctttggg taccaagttt ggcgccgcgc ggaggacat tgatggactc gtgcgtctgg tcaaggagtt gaacatgaag ctggccggcg cagctttca tgcaggtgcg tctcgctctc ggtacctcgg ccggtgaaat gcatgcagct gctaacggc ggcaattccacgccctgttc tagcccctag cgtcgctgtc gacgcagctg atacgtgcg gggcatccgg gacgcagccg aggtcttcgc gcgggcccga cgggtcgggt gaaccctac ggtgctggat attggcggcg gctacacaga ctcgacgttt caacagattg aggggcggt caggccggcc atcgccgagt gcttcaagtc gcaagtggtcgagggacgcc tcgcatcct tgcggagccg gggactctct tctcctgcag cccgttctat ctagcagtca ggttgtcgc gcggaggagg aacgccgctg cgtttgggaa tgagccagcc acgcgtctct catcaacga cggcatctac agcaacttca tgatgcgttt catcgtcaac atgaccttct gcccgtggc cgtcatccggaagggggtgt ggtacgatca gacggagcaa acgatgcgcc cgaggcgtg ctctctttgg ggccggagct gtgactccaa cgactgcatc aacagggatt ccggctcga tccggaagtg ggggtcgggg actggcttgt cttcaaagac atgggtggtg gcgtctcaa cttttccccc cttttccttt tcgtttttgg gtccctgtggagaatagcat tgtaggagc taaccatgca tggtgggcag cctacacaac ggtatgtaac accaccttca tggcttcac cagttccaat cacacaatct acattgaacc cacccaagtc gacaaagccc gtcgacctt tgaacagttg gagttggcca tctgagtgcc agttcgggga gacccacacg ggcacgtgc cgtcccgggttcccgggcgt ggctgcatga cgctagacgc gctagtctag acctactcc gttccgtact gtccttgcag cagtccgtag tcacaacaga tggcttggat aattgatgc acactccctg attagcttgt ttgacacatt ccatttggct tcgtgcacat atgatacaa ccagtacatg tttcctccag tccttttgta catggccacgccgagctctt taagtacct cgtcgagctt ggtcttcctg caccaagtta tgtacagtgg gggtgcagat taaggtgca gatgtaagga taaccacaaa aattagtcct gttaggcaaa atgaccttat atttaaata aatagctaaa taaaatatat aatatataat tatactaaga agttatttct ttttaccta tattacttaaaactttatat taaacccttt agcgtgtgaa ataaattaag taaacctaa gataaaatcc ttcattatcc tcacatctgc acccccactc taggtgccgc ctcccggag aaggggtcca ccccaagtca ccccgagaac ggtaaaaatg acgacatatg cggaacccc cttctcttag cgacaatcgc aatgagacgg acaaggtacaacgacctgag ttctgaccg actggcataa gtgctcatga ttgaatacta ggtagcagac tgtacggact agttcgttg tttcagtgca aatcacttca ctactacaag cctcaggcct ccgtcgcctc tacatgacc gttgctgctg tcttgcgctc atactcaaga gcaactcggc gggccagcca tgccctgcc gtcatccggtccttccactc gagcgtgctc cactttcctt gcttctcgca ccaggcaga ggttcgatca tctcgtccag attcaagtgt ccgaagaaga cgagcgagta cgctgcacc agctcgtcat cgtcaccggc acttccttcg tacatgtacc ggctcggcgc gtgacgcgg tggagggcgc tccgccatct gccgttggtc tgcttctcaagcaggtcccc acttgaaca atcatagccc ccttgatcgg aggcacaggt cggtaaatgt cttcctcgta tcgtgcagc tcaagccccc cgaccatgtc ctggaagagc atggtgaact ggcagtagtc gtatgcgcg ttgagccggt tcgcggatcc gctggccagc tgtgaaacgg gctgccccag aagtagttc caagttgagtgggtgctcat gtggcgcggc tcaaactttt ttccaatgta tccagatcc tccatcccga ggatttcgca cacgagccgc atgttctgga gagattgctt tagcaggcc gcgaaccact tcttcaagaa gtcgagaaag cccgggagat gctgctccac aagtttaga tcgggggcgc ccggggggta cgttccgcaa gggtcctgcagctccatggc tctttgagc tccgtcggcg tctccttgcg gagcctctcg atctcgtcgg gatcccagac ccctgcgag gagatggcct cgcctgtgcc cgtccagccc tggaaatgct ttgatacgtc ggtgggatg tgaaccgagt

tcttgaccgc cagaggcagg tcaaaaaact tcttgcactg atttcaaaa ggcacacaag atcaattagc gatcctaact tgcatgggga atgccagccc ttcttgagt aaccaggcca gctacttacc caggcgaatg cttcctcgag cgtcctagtt caatactgt ggttaataac gtagatggct ccgtgatggctccatgcctc gtcgagctgt gcaagtatt tcttgcgctc attcccgaca ctggcatgga ttgcctcaaa gtccatcact gcacattag caggcttaac aggcttgttt gttaccgtca tcttgggagt tgaacagata aatcttgat gttgaatttg ggattagtgc ctcggaaaga gtgaggaatc gtgatatgtg agcggatcgttaaataaag gctttgagga ggtcatttat aatagtgtca acaagctgat tatcacact gcaatcctgc atctatatga cacggtctct attattggag gggtctctta tgcgcatac cgcattagtc ctggaacaaa aggagtacct ttccacttaa tcccttacta atatactag ccatctttag tagtgaatat aagtggcttaatataatgct tatagcctct ctatagaaa attgctttct ttttactatt atcaaagcct tataatataa cgtaatataa gcaataacg taacgtaacg caatgtaacg caatataacg taatgcaata aggctctttt aaatactcc ttattatatt attctttaag atagctattg tatataacta tagaaaattg attcatattattaatactt agtaagtcag tgaggggtta atagcaaaat aaattcataa aattcttca aggtatatat aataaagact taattattta atttaatact agtatagtag aattataat agctttaata atattaatac cttttaatat cttatatgta agcatcttcg taatagtca aaatcaatag acgcaagcca cactaaagttaggtgtgtag gactaacgct tatgcgcat ttagtgacct taatcaacgg tttcaaagtg gtatgatctc attagattct ggggatcct cttgagggac acgatacaaa tcttcttgag ctacgtttgc catcgttatg gaagtggct gacaagtact tcgtaattta agagcatcgc gtctggcgaa ttctacagac cggaacgtcagtgacacca aacccattca gcccacccac aaaatctcaa ttcgactgta tttctaacg atgctcgatg aaagcccaat gaggaagggt gattctgtga gcaacgacca agcaacccg gagagcaatg catctgtttc aatccatcag cagaatcaaa tcatcacctg gtctcccca ggcccagtct gccccaatgc gatagaaatcaagcgtgaca ttgtgatcgt agactacgg cccgtcgaaa gttgtccagg ctatcgcttc tttcgccgag tctttgagac ctagagaaa tggcagctgc aagtcgacat gttctcaacc agtctggggc gaataacctt gcgctgggg gccgcagcgc tgcaagccgg cattagtgac tcatgcagtg ccagaaatga atgatgagccgggatctca tgcacggcat gcagaagcta ctcccggacg atcacataga ctctttcct cacatggcca tcatctcggt cgttggacac ccgagccgac gaatggccgg cacatcttc gccaccatgg atgccaatga tattcccacg gtcatgattt cgcacggtat gcctcaatc ctttcccgtt tccatagcaa atcatcgtcccattcttctg accagcatgt cagacgccg ccaggctcgg tatagcctgt gccatctcgg agcagtacac tgctaaagcc tgtgcgtct tcgagcaatg cttattccgg tactccttga cacattgaac cgttatctca tctcttcat caaaactctt ctcgttgcag aattagatag attagatgca caagacactc ttgtgggctatggtttttt tgccgtgata gacagctaaa actaaaacct cattgtagtt caagcagct ttagtacttc ccgtgatact gacttttctt tagcagctga tcgaccactc agtgacaac aacgttcaag attccttcgg atctagtgct tctgaagact aacttccacc agtcctagc tcctggagaa gactgtcgcg caccatctccatgacgggag ccagaaagtc tccgtatag tatgcatcat tgtagtacaa gtacagccgc atagtgccgc ggaaggtaaa agctggaac tcgatggttg gatcagtcgt tgcattgacg agggctacgt cttcgatctc caaacaggg gcttgtgccc cctttttccc gtacgcgcgc gctagatatc tctccaacac ccgaggctactgaggttgg gtacccggaa gggcggacag ccggcaacgg gcaaggagcc aggaaagcg gcctcccggc tttcatacag cggcagcagc tcgagaaagc tcacagggtc cctgccggg tctgagggca gcgccgacag atctcgcgag taaacagcac ccagacgttg gtgaggtcc tcgaagccac ccgtgagaca gaacggcacgacaaagatac agaggccgag gcgtagtcc ggaacaaccc acttggggtc cagaagtgga cgcaggttcg cgacgagggg atgagcatg ttgcgcgctc cggtgtgctg ttgttgaggg aatgaggccc agacgcggac atactcgcg tggacggcgg ccgagacgct cacgcccagc ttcttgcaac ccgccacgat gcctcgagcgtcggctcgt cgaacaaagt caccaggtgt tgggtgttgg caggcgcggc tcctcggac ccctcacgca cggggagaga caagctgtac aaaccatgat gccaatgccg atcagctca tcgacggcac gctccacgcg gtgtgggacg ggtgtctcct gcggcgggaa cccagaata tagtcgatgc cgggcgggag ggacggttgtttgacatcgg tagtgtagca tctaggttg gcgtcgaggc cgagacggaa gactgactcg agaccgagca tgaaggtgtt gtcgccttg tatattccca cagcgtcaaa tcggaggtga gtgctgcgaa taatcaaggt gacgaagga ggaaaccagt aggccattgc cgttggacga ggttgaaaga tctttccggc tcgtccacgtccctgaaaa cagcctgggt cccttggttt actgtggaaa cttagccgca ccactcctc aggatccatg aggggaaccg taaccaggta ccgccctgtc tcatctcgtt tgaataggg cggatatatt gcgcctatga gcggctggac atatcgaaaa acaagccaag gcggcggag gtaggggatg gggtcatcaa tgtcttggggcagtcgtaat ttgagcttgt ggtgagacc ctcggcttca cgaccaggag gcgtgttggc gcgttggata cgggcaagca ccagttctc caccaagtcg aggggccgtg tgagagagcc gtcttctgat ctggtccatc gggagcgac aatggcatga ttccctgggc tggccatggc tgctctgcct gttaagaaca cggggatagtctgggagag taaagcagtg agggctattg gatattgacg acgaaaacct gcaatgtaa gaagtaagtt tcaaaccagc accataggca agcctcctat ttgggcgact taccgaatt tactactata tcttagggac atctaaatgc gctaccgcgt tttttgaatg gctaccgcg ttagtcctaa aacagaagaa gtacctttttacctaattac ttactaaata actagccct ttttagtaat aaatgctagt agcttactgc aatatgcaat gcttatctcc taagcgtgc taaagcttgt gggtctataa gccctgcaaa ttgtatatat ctcttgttta ttttatcta attagatata tatagaccct agttaacgtg actccacaag ctttagcacg tttaggagataacctttcc ttttcttcct ttttattatt ataaagtctt ataacgtaac tagcgtaat gtaatgtaac gtaataaggc tttaaatatc gcataaatag gcatcttaat aacagcgaa aatttacaga tgtaagctac actaaaatta ggtgtgggga ctgtctttcc ttttaggac taacgtggta tgcgcattta aaaaacgcggtatacgcatt tagaggtcta tttcgaacg tttttcatta tctccttgga ctctgtccac cttgtgagtt agtggggccc cacaggccc cctgctataa ggttagtaac cacgtaagca cacgaacgta tagtgtagta tttatatag ggaaaattag tagtatattt actattagct tatttatata taagcaaata acctttaatccacttctac ctaattggat atagacccta gtaaacgtga ctccacaagg agacagagt ccaaggagat accaatctac ccctaccttg acaactataa atcccttact acttataag atattaaaag tattaatttt gttatttatg gttatataaa atagctatat ttaaagaat aatataataa agggcattaa aaaagagtcttattgcataa tgttacattg attgcgtta tatttgtgat aatctaggct ttggctagac ttagtaatat agttgttgat gcgtaattt aaagggactt gtttcacgcg tatccttttg ctatggtgca attggattag cacatcacc cgtacacgtg ctcgcagaca tccgcgatag cccctcaggc tacaccgtaa aaaattgcattatattgcg ttacattgcg ttgtgttgcg ttgcgttata ttataaggct tttataata ataaaaagga aggaactctt ctattgaaaa attgataggt attatagtaa ccacttata tttactactc ataagagcta gtatattcag taagggttta ggtaaaaata gtacttctt ttctcctagg actaacgcgg tatgcgcatttaataaccct aagccaatta aaacacatg tccgacttcg cattcgtcat tttcggcggg gaatcatcag agcacacttg ctcatcgtg gtgggtttga tggccaaaag gaattcggat atcagccttg cccgcagcgt cgtgccgcg cggggagtct tgctctctct ttgggtctgt ccaatgtccg gcgacctgat atatgatcataatcacaca cggagcaccc ataacctggg gtcaatatat aagtcagccc tgtgttctc aaaggggctt tctagtgtcc ccatcgccgg ggacttgatc tcgtagcaca gcaccatcc cacccattgc cgccgacggt tcatacacaa cttgatggat ctgacccagt caacacagc gggcatcgtt tggccgacgg ttgctgccatcgccatctcc tatatcctgc gtcgagctt tctctcttgg tataggctac ggcacatccc cggccctttc ttggcctcga ctcaagtct ttggaatgtt ctaaacatcg tgactgggcg cacgtcgcca gtgctcgaga actgccagg aaagtacggc ccgctggtgc gaaccggccc caactacgtt ctcacagatg tgccgaaattttacgtcac gtcaatggcg ctccagcaca tacccccgta atgggtgtaa tctgtccat atcacatgtc ttttgaaatg tagggagact cagagaccca ctcacactgt gcttccagg gtatgaaggc ttcaaggtcg atgaacacga ccatatgggg tcccatatcg cacgtcggt acatgacgcc atcaaaagca aggtgattggggggtacaac ggcaaggatg gatagacct cgagggggcc atcggatcgc aggtcaagac cctggtcagt gagatccggc ccgtcacct tgggcaacct gtcgacttct ctcgtctgat gcgtcagatg gcgctcgacg catcaccgc cgtagccttt ggcgaggccc ttgggttcct gacggccgaa gacggagacg gttcggctacgtcagcgcc gttgacaaga tgctgaccta cctgacactt gccagcgacc gcccgtagt gcgcagcgtt gtccggtcac gccgcatggc gccggcggtg cgttgcgtcc 2gcctatac tggcattggc cgcatgctca accatacacg ccgggtggtg gcggagcgct 2gcggccga cgaccccggg aagggcgaca tgacggcctcattcatccgc aaggggctca 2cagatcga gtgcgagggc gagagccacc tgcagctcat cgccggcgcc gacactgccg 2acggtgct gcagctccac gctgctgtac atcatgacga cgccgcgcgt gtacacgcgg 2caaggccg agatcaaggc cgcggtggat gccggcgagg tggtcgaggt catcaccatg 2ccaggcccagaggctgcc gtatctgcag gctgtcgtgc tcgagggctt ccgcatgcgc 2ggccgtcg tgtacgggca cttcaagtcg gtgccggccg gcggcgatac gctgccgaat 2tgtacgcc tgcctgcagg caccgccatc gcccccaact acatagcact gacccggcgc 2cgacgtct atggcgccga tgtcgatttg tttcggcccgagcgtttcct cgacgccgag 2ggccaagc gccacgagat ggagcgcgcc atggacctga acttcgggct tggccgctgg 2gtgcgctg gcaggaacat tgctctcatg gagatgaaca aggttttctt cgaggtcggt 2atgtgcat ctccgctctt tgcttttgtt tcttttcctg ctattactct cgccctcctt 2ctatcctgacgcgggcga ggtatgagac gagatgagag actgattcaa tgcgcagtta 2acgccact tcgacctcca gatcttgtat ccgggcaaag catgggatga atacacgtaa 2ccttctga aacctttttt aatacctttc gcgcataggc gtctcgggtg gcgtgagcag 2tgccatgg atattggagt gctaaccagg ttacctcttacctctgcagg ggctgtggta 2ttcgcagc ataacatgtg ggtacaaatc accgagagct cgtgagagag cgcaaaggtg 2tatagtgt acagggatac acatggcagg ggtggctacg aacgtccatg accacgtacg 2gcggtacc gatgggcggg aaaggacacg actgagacgg ctggagagaa cgatgaagat 2ggtaaggaattatagcaa tcagaataac gatcgtgttt gtgcgcgtcg ggctttgcct 2cactgcct acctaaacaa gtcccgaagt gatgaataaa attcggcctc ggtgccttcc 2tttgctct gagccaccaa tgaagaatca acttggttag aaaccctcct cgccaagacc 2attactag ctgtgataag caccacctgc aaatgctgtaggcagcttgt tatttaaaag 2cgacaaac cgcagcatct ttggttagct gggatttagt ggtgccacct atatgagtcc 2aatctatt gtcccatctc cctgttgagt atctcttcgc atattacctt gagagaattg 2ggccatct caaaatcact gacctccaag tatacttgcg cacagagtct agcccatatc 2tccgcggtaatcgatgat gggtatccag gtcttgtatc tttccgccag agcctttgtc 2gtaacgaa ctgccgggcc gacctctttc tccgtcagag cgccgcccgg cacatgagct 2ggcagtgg acgggcccgt ggcaatggcc aagggaagtc gcactgtcac gatgccgcag 2tctcatct ggccatctac cccggcccca agaccaggctcctccaagac ctctgtctga 2aatatcgg cgatcttgtc accaccctct ttcgcgagcc actttatgta ctcgtaaatt 2cgcctcgc caccacagac gtctcgcctg aagcggaggg cggccgggat gcacagatgg 2catgtaat cgctcgtggc agtgtaggcg aacagtgtct caaacgaaga cgccgtttcg 22gcactgaccatctgcga ccacagggga agtcgagagt tgccattctt gggaataaat 22aaagagg tcgggatgac ggagcgcatc atgtgctggt tgcgctcggc aacgtatagg 22gcacaag gtcgaggaac aaataaccac ctagtaagat caatgcgtag agtatcagca 222accgcc gtattaaggg cgtgtgtgac gttggatctgcatacttgtg gcaatcagag 2226gaagt caggctgcag ctcctggaga ttgacctcga actggcccac gctatgcgcc 2232gacca acgtcatgat gccttccttc tggcatacgc gcagcaagtc ttcgaacggc 2238aacag cagggatgct cactatcgtc tctagaattg ctaggcgcgg gcgtagaccg 2244cctgatttgggccat ggcagtctca aactgggaca caatcttttg gcccgtcgtg 225gctcaa actccaccct acgtgtcttg aagggccgag tctcggccaa ggaagtgatg 2256gtcga tggcaccgta agtagttgat agagtcacca cgacgtcccg ttcctcaaat 2262gttgt aaaggacggt gaagatacca gtagtgacgttggagacgag gacgcactcc 2268ggcgg catgaactag atgagcgagg ccgatactgt gcctcctgca gcaccaagcc 2274aaaac tcggagaaca agtcgggctg ggcctccagc agggaccagt aatctctgat 228ttgctc accaccttgg gccatgaccc acaagatgct acgaccacgt cttgttagtt 2286acagtcaacatggaa attgaaacgg gcacatcgtg tgacgggcaa ctgacaagaa 2292gttgg tgtattccgg atccatgcag aaagcctcca gcataggctt gccgaatggg 2298cttgc tgttcactgt catcttgaca aggcgatgtc accgaacaag taaatgggaa 23gtgagag tagagatgcc agcagcactt ggtgaaaagggacacgtcaa gttaaagcac 23gctggca ttcttatgat ttacccaatg ggactaaaat caccccatcc acatcccgtg 23gattagt agctgagcag accacatgca ttgtgtgggc ggggtgataa tatgcaagga 2322ctatt cgcatctcat tcttttattt acatatgtcg tttgatcatt ggatgcgtct 2328agcgtgcatatgtat gcttgcctct ggaaaagttc atctttctga aagggcagtc 2334tttaa taaacttcat tactccaacc catacccccc ttcgtcgaag ctctctaaat 234gtccaa cctacgagac aatcacggtg aagccctctg tttcacttaa tccatcatga 2346gcttc ttcccctcac ccaggcgtct ctgcagaggacatcgaattc taccaagcca 2352tatct tcgcctgccc caagaggctc acggcctgtt cgacgacttg gcaaagttgc 2358tgggt ggcagaaatc tcccagtggg gcctggaaac ggggaaatgg cgacattact 2364acgac gaatggcaag catcttctct gggggacgga gaagctcatg gaataccacg 237catgcgagacctgatt gctggcgagg cacctctcac actgctcaag tcgctgacgg 2376gacat ggtggtcttc aaggacgaga tagggtggaa actcccaggc gggaaggggg 2382cctca cctcgaccgg cccgcgtact ccatgtttgc ccccgagttc atcgagatca 2388gccgt cgatgcccat acggtcgaga atggttgtttacagtttgta ccaggctctc 2394gaggc agtcccgatt tcggccgacg gccgcattgc atcggcgtgg ctagagggca 24agttcat ccccatggtc ctcgatcccg gcgacgtctt gatcttcaac gagagcatgg 24atcggtt ggatcctaac aagacggacc aaagacgtgc agctgtcttt ggcacctacc 24ttgaccggtcccagccc gacctgcggg acaaattcta cgcccaccgg ctcatccaca 24ccccaga aaacggtaag gcttttcctt ggccagatga tgtttgcatg tttggaggcc 2424taaca tgatgcgtga ccaatctcac gtagcctggg ttgaaacagt ggaagcgcag 243gacaag aacgatacgt ataacgtagt ctagatagcacgcacaggaa gttagttacg 2436ggggg tcgaaatgga acttggcatt caccatgtca aatattgtct tcgctatagg 2442acatt tgcacagttg ttgcgtctta ttgttcgtgg ccggtgtaaa atcacacgcc 2448ttcaa tacctagagc acgtttgcac aatcccgtat ctcctgtcct tggcaacttt 2454ctgttagatatagca gcctcacatc ttaggcatca ctcctataat accttccctc 246tggcta gttatactgc cttagcactt agggcaaaga ccctctttta ggcccttata 2466cctta ttaattaatt tttaattttt tttggggtta ttagttatag ccaatgcatc 2472taaga aaaacataat tactagcgat acctagctagtataacaatt aacatataat 2478ttaac tatagtaata aataaaaccc tatataagaa taagctttaa gattataaat 2484gggct ataaggttag attaaagttt ataataaact ttatagctat attagcataa 249tagtta tagtttataa ctatagttaa acttaaattt atttaagttt tacttatagt 2496ttaatataattcccc ctttctttat aactatattt attcttgtga gaacaaagga 25ctaggta tgagacggtg tggaaagtga taatgatgta ttcagctatc taggctattc 25catgtgg cataacaagg ctataggtat aagggtaaag agggtcttta ctctaagtcc 25ggtacta taatctatag taacctataa ccttaaataaggaagttatt ataagtaata 252agatat aaggctacta tatttaacac tacccctagt aaaatatcta gcctaaagat 2526tataa atataactta tttactaaga tacttacttt actaaagtat ttttatttaa 2532agtct tataccttta ttattt 25346 7 DNA Neotyphodium uncinatum agcttt tattatagcc tatagtaatt ttataaagta aactagctag ttcttatacc 6aatta caggaggtta cttatcttat aaatttatat aaaaagatat ctccttcgtt ggcctag ttattactat ataattgaaa aatcactact gcatgtttac gtgttgcttg agacctg tggatccggg tccaattacc cctacaggtgtgtaagagga catctacatg 24acgca tctgtcaaaa attgaacacg catctgccgt tagtaatgca gcccgcatta 3tgcaga gaaactaacc catagtctct taatattaca cattataata ctataacaat 36ctttt tattccttta ctattatatt attccctaag atatagctat tgtatactat 42aagctatggttaatg ctatttagat tgttagacgc aagccacact agaaacaggt 48ggtcg tttatcctga ttaggactaa cggcagatgc gtgttcaatt tttgacagat 54tttag aggtccggcc taagatggac atgaccaacc ggctagatcc ctgtcattgg 6gcctgg ccctccgctc tcttgagaga caagatcgac ctggtggctataatttgcta 66acaga ttcgctgaat atctgcaagc aagcaagctg cattatcaaa acataaataa 72ataaa ttacacggag tcgaagaaag aaaggaccag aacaagttgg cgattttcca 78gttac tcacccgaac cgtcactctg ttcatatcat cactcgcctc cagtgtcttg 84cttgt ttcaatattgtcgtcgagaa aaatgacagt agatacgatt acttcgactt 9cgggaa ccaagatgtc ccaaaggaat tccttccaat tgaattcgaa actcagcttc 96cttgg gtaggttatc gcatctcata tgacggtcct ctattccaga actaatcagt gcgattca agccgattcc cggacatttt aggcagttgc gcagtgcctg tatacagttccagtaaga tcaagccacc gcctcctcga aacctaccaa ctatgcacat gtactgaatt tttccttt ttgcgcatct taataggcct ttgagttcaa cagcgttgcc cacggtgcgc cttctaaa cttgacgcag ttcggcaaca tctacagccg cttcaccaat gtttgtctct ctccttct cccgcatgac tgcttttccctgacgaggat acaagctaat aaaacacaac tccttcaa cagcccaccg tcaatgtatt gcaaaatcga ctggccgggc tggaaggagg tcgctgct tgtggcgtcg catccggctc tgcggcggta gtcgtgacgg taatggccct caggcgtt ggcgacaact tcgtctcatc ctttcacgtt catgctggca ctttccacca tcgacagt ttagccaagc agatgggcat cgagtgccgc tttgtgaagt ctcgagaccc cagacttt gcggcggcca tcgacgacaa gaccaagttt gtctggcttg agaccatcag accctggc aacgtaatac tagaccttga ggcagtctcg acggtctgcc acaccaaggg ttcctttg attgttagta tcccaatgaatactgtccat cccatagggg gagttggggc aaattagg ggggatgggg tttccatccg ggggatttta gtgcgataac acctttggct gccgggta cttttgtcgt cccatcgacc acggtgtcga tatcgtcgtt cactcggcca aagtggat cggcggccac ggcactacgg taggcggtat catcgtcgac ggcggtacct gactgggg ccagcacccg gatcgctttc cccagttcca tgatccacgg acgcgactct gaacgctt ttcccgtcgg gcgtttgctg tccgctgcca gtttgagatc ctgcgcgata 2ggagcac cctcagcgcc cctgcggccc agcagctgct ggtaggcctc gaatcgcttg 2tgcgctg cgagcgccac gcgcagaatgcggccaagat tgccgactgg ctgcgcgagt 2ccctcgt ggcctgggtc agctatgttg gtcacccgaa ccaccccgat caccagggag 222aagta cctcaagcga ggctttggct cggtcatctg cttcggtcta cgggggggtt 228gcagg tgccctgttc tgcgatgcgt tgaagatggt catcaccact accaagtgcg 234aaact agccccttct tctcctgcga gaacatcgtt ctgccattct aacctcgctt 24gcctgg gggatgccaa gaccctaatc ctccatcccg cctcgactac tcatgagcac 246ttccg agcatcgagc tgaggctggc gtcacagatg atatgattag gctgtctgtg 252tgagc agatcaagga tatcaaggccgacttcgagc aggcctttaa gcaagtgctt 258taaaa agagtcttcg taagccttgc atcggaaaga ttctcatgca ggatgagatc 264agact tatttggacc ttcggcttgt cgtacgtaaa taggggtcat tgcgaggcat 27agtttt cctaatagac ccgtaattca cggttgttac ttttttcatg tttgccatgc 276ttatt ttcataatat ttttttttca agtgtgcaga actcgtagtc acttacaaag 282tgccg taatcaatct ttagtgcgcc atgtcctctt gaccagagct ttgcacttgt 288gtagt attttttgta gtatttttta tttaatttta tatctagctt ataattaaag 294atcct aggaattacg taatcttatctagcaaagtt ctaagaaaaa taccatatat 3ggtaggt ctaagagtgg gttatcgccc tacaaattag aaaaactaca tttgtagtga 3tttagcg gtaaagctag atatttagaa aatgtgttac aaaataaaga tctttgatta 3aagcagt tttaccttat gcctagtaag gggtgttttg gaattatact actatattat 3ataaaaa atatatacta ttatcttaaa tagtcaatta ttacatatta aaacttatta 324aaagg tggagatttt ttgcatatct taccttaaat

attattacta cttaatatta 33ttccac tgtttacaaa cacctaagct aggcggcgtg gcattaggca attacggaga 336tcgct atagcacgga gtatatcaga atcatgtatc atacagatgc cgagccaaat 342ccatg atcgaaacga agccaaagcg cagcacgcca tcaagatgcc gctgtaatct 348gtcac ttggaaacac ttggaagcac tcgtgcataa tgcaagtcgc tctctcatac 354ctaca gagttcttga gggaccagaa cagacaagtc tgaacttttg gcaaggaagt 36ggacaa ggtttgcaga cgctctgacc gatcatagac caatattgga ggctggagac 366catat cttcaatagg ccctgatgtagccttacttg tgtgtgtact tgcagggatg 372aaata tgtgcgggtt cgattatctt gttcggtttt gtaaactcaa actcgccagc 378gcctg tcagccactt gagtgaattg ttattgccat tgttttactt cagaacacgt 384gcaca attttcagtc gcagcaatga cgacagtcgt acgagaagca tttgagaacc 39caagct ggtcgagagt cggaactcgc ccggccatgt gcttgcttct tctgaggcct 396tttgt tgccgacttg aacgacgtcg ttcgtaagtg ggcggcgtgg aaggaagctc 4cagatgt cacccctttt tttggtacgt cttcaattcc cccccatttc atgtctcact 4ctgggaa gtcccgtccg agggtccgaatcaattgact tggaggcagc cgtgaaaagc 4tatgatc gacggctgat ccagactctg gccacctgtg gagccggatt tgactgtgcc 42cggagg agattgagtt gatcctgtcc ttgggcattg gggcagaacg aatcatcttc 426tccgt gcaagcccgt ctcctccctg gggctgtgcc gcaagcttgg gatcacgctc 432ttttg acaacgaatg tgagcttcgt aagctccacc atcactatcc cgaggctcag 438gctcc gagtcttcgc cgacgatcca accaatgccg atcccttggg taccaagttt 444cgcgc gggacgactt tgatggactc gtccgtctgg ttaaggagtt gaacatgcag 45ccggcg ccagctttca tgcaggtgcgtctcgctctc ggtatcttgg ccggtaaaat 456catac agctcgctaa cggcggcaat tccacaccct gttccactgt tccagccccc 462cgctg tcgatgcagc tgcatacgta cggggcatcc gggacgcagc cgaggtcttc 468ggccc gacaggtggg gctgaaccct acggtgctgg atatcggcgg cggctacacg 474gacgt ttcaacagat tgcaggggcg gtcaggccgg cgattgccga gtgcttcaag 48aagtgg gcgagggacg cctgcgcatc cttgcggagc cggggactct cttctcctgc 486gttct atctagcagt caaggttgtc gcgcggaggg tgaacgccac tgcgtttggg 492gccag ccacgcgtct ctacatcaacgacggcatct acagcaactt catgatgcgt 498cgtca acatgacctt ctcgcccgcg gccgtcatcc gggagggtgt gtggcacgat 5gcggatc atacgatgcg cggcgaggcg tgctctcttt ggggccggag ctgcgactcc 5gactgca tcaacaggga ttgccggctc ggtccggaag tgagggtcgg ggactggctt 5ttcaaag acatgggggg tgagcgtttc cccttttccc cctgtggaga atagcataca 522tagca taggagctaa ccatgcatgg tgtggcagcc tacacaacgg tatgcaacac 528tcaat ggcttcacca gctccaatca cacaatctac ctggaacctg gaacccaccc 534gacga agcccagtcg acctttgaacagttggccat cggcccacat acggtacgga 54gtggtg ctgtaccgcg tcccgtccgc ggctgcatgg cgatggtgat agacgcgcta 546atacc tacatgtaca tactccggta cggaagtact gtccttgtag tagtccgtac 552ttagt cacaacggat gacttggatc aattgatgca cactccctgg ttcgcttgtt 558ttcgg tttggcttcg tgcgcatcat gttacagcca ctccatgttt cctccagtcc 564gtatg ggccatgatt cattcaaccc gttatcatgc aagcaattat gtagacggcg 57cgagct cttgcaagta ccttgtacgg agtagagccc aattttcctg caccaagcta 576cgcgt ccccggaaaa gcggggcaggggtccacccc gagaacggta aaaatgacga 582ggcgg aaccccctct cttggcgaca atcacaacaa gacggacaag gtattacaac 588gggtt tctgaccgac tggcagaagt gctcatgatt gaatactagg tagcagcaga 594cggac tagttcattg tttcggtgca aatcacttca ctgctataag cctcaggcct 6tcccctc ctacatgacc gttgctgctg tcttgcgctc atactcaaga gcaactcggc 6ccagcca ctgccctgcc gtcatcagat ccttccactc gagcgtgctc cacttccctg 6tctcgca gccaggcaga ggtttgatca tctcgtccag attcaagtgt ccgaagaaga 6gcgagta gcgctgcacc agctcgtcatcgccaccggg acttcctccg tacatgtacc 624ggcgc cgtcacgcgg tggagggcgc tccgccatct gccgttggtc tgcttctcaa 63gtcccc aacttgaaca atcatagccc ccttgatcgg aggcacaggt ctgtaaatgt 636tcgta gtcgtgcagc tcaagccccc cgaccatgtc ctggaagagc atggtgaact 642tagtc cgtatgcgcg ttgagccggt tcgaggatcc gctggccagc tgtgaaacgg 648cccag gaaatagttc caggttgaat gggtgctcat gtggcgcggc tcaaactttt 654atgta atccaaatcc tccatcccga ggatttcgca cacgaggcgc atgttctgga 66ttgctt gtagcaggcc gcgaaccacttcttcaagaa gtcgagatag cccgggagat 666tccac caagtttaga tctgggttgc ccggggggta cgttccgcaa gggtcctgca 672atggc ctctttgagc tccgtcggca tctccttgcg gagcctctcg atctcgtcgg 678cagac gccctgcgag gagatggcct cacctgtgcc cgtccagccc tggaaatgct 684acgtc aggtgggatg tgaaccgagt tcttgaccgc cagaggcagg tcaaaaaact 69gcactg catttcaaag gcacacggga tcaattagcg ctcctaactt gtatggggaa 696gccca ttcttgagta accaggccag ctacttaccc agacgaatgc ttcctcgagc 7tcagtgc caatactgtg attaataacatagacggctc cgtgatggct ccacgcctcg 7agctgtc gcaagtattc cttacgctca ttcccgacac tggcatggat tgcctcaaag 7atcactg gcacattagc aggctcaaca ggcttgtttg ttaccgtcat ctttggagtt 72agataa aatcttgatg ctgaatttgg gattagcgtc tcggaaagag tgaagaattg 726tgtga ggtggatcgt tgaataaagg ctttggggag atcatttata atagtgttca 732tgatt cgtcgcactg caatcctgca tgtatatgac acggtctcta ttattggagg 738tgatt aatgggatca taaatgcgca taccactgcg ttctctgaat gcatactgcg 744cctag aacaaaacaa gtacctttctatttaatccc ttgctaaata tactagctct 75agtagt aaatataagt ggcttactat aatgcttata acctcttcta tagagacttc 756atgaa attcctttat ttttattatc gtaaaagcct tataatacaa tgcaatgcaa 762tataa cggaatgtaa caaggctctt tctaattact ctttattatt ttattcttta 768tagct attttatata taactataga aaatattatt aatattatta atacttagta 774gggat tcatagtaaa tagatctagt aataattact caaggtttca aagtggtatg 78cattat attcactagg ctcctctcta gggacacgat acaaatcttt ttaggctaag 786cattg ctatgagaag tggctgccaagtacttcgta atttaagagc atcgcgtctg 792ttcca cagacacgga acgtcagtaa caccaaaccc atccagccca cccacaaaat 798ttgaa ctgtattttc taacgatgct tgatgaaagc ccgatgcgga agggtaattc 8gagcaac gaccaaggca acccagagag caatgcatct gtttcaatcc accagcagaa 8gatcatc acctgtgcct ccccaggtcc agtctgcccc aatgccatag gcatcaagcg 8cattgtg gtcgtgagac tacggcccgt caaaagttgt ccagactatc gcttctttcg 822tcttt gagacactag agaaatggca gctgcaagtc gacatgttct caaccagtct 828gaata accttggcgc tgggggccgcagcgctgcaa gccggcattg gtgactcatg 834ccaga aatgacatga tgagccggga tctcatgcac ggcatgcaga agctgctccc 84gatcac atattagagc tctttcctca catggccatc atctcggtcg ttggacaccc 846gacga attgctggcc acatcttcgc caccatggat gccaatgata ttctcacggt 852tttcg cacggtatgg cctcaatcct ttcccgtttc catagaaggt catcgtccca 858ctgac cagcatgttc agacgccgcc aggctcggta tagcctgtgt catctcggag 864cactg ctaaagcttt gggcgtcttc gagcaatgct tattccggta ctccttgaca 87gaacag ttatctcagt ctcttcatcaaaacgcttct cattgcagaa tcatattaga 876aagac actccttgtg ggctatggtt tttttggccg cgatagacag ctaaaactaa 882cattg tagctacaag cagctttatc acttcccgtg atactgactt ttctttggca 888ccgac cactctagtg acatgacaac gacgttcaag cctccttcgg atctagtcct 894agact cacttccatc gagtcccaac tcctggagaa gactttcgcg caccatctcc 9acggaag ccagaaagtc ttccgtatag taagcatcat tgtagtacaa gtacagccgc 9gtgccgc ggaaggtaaa tatctggaac tcgatggttg gatcagtcgt tgcattgacg 9gctacgt cttcgatctc acaaacaggagcttgtgccc ccttttgccc gtacgcacgc 9aggtatc tctccaacac gccgaggctg ctgaggttcg gtacccggaa gggcggacag 924aacgg gcaaggagcc aaggaaagcg gcctcctggc tgtcatacag cggcagcaac 93gaaaac tcacagggtc gcctgccgag tctgagggca gcgccgacag atctcgcgag 936agcac ccagacgttg cgtgaggtcc tcgaagccac ccgtgagaca gaacggcacg 942gatac agaggctaag tgcgtagtcc ggaaccaccc atttggggtc cagaagtgga 948gttcg cgacgagggg aatgagcatg ttggcgcgct ccggtgtgct gctgttgagg 954gaggc cccagacgcg gacaatactcgcgtgcacgg cggccgagac gctcacgccc 96cttgca acccgccacg attgcctcaa gcgtcggctc gtcgaacaag gtcaccatgt 966gtgtt ggcaggcgcg gcgtcctcgg acccctcacg cacagggaga gacaagctgt 972ccatg atgccaatgc cgcatcagct catcgacggc acaccccacc cggtgtgaga 978gtctc ctgcggcggg aaccccagaa tatagtcgat gccgggcggg agggacggtt 984acgtc ggtagtgtag caatctaggt tggcgtcgag gccgagacgg aagactgact 99accgag catgaaggtg tttgtcgcct tgtatagtcc cacagcgtca aatcggaggt 996ctgcg aataaccaag gtcgacgacggaggaaacca gtaggccatt gccgttggac aggtcgaaa gatcattccg gcatcgtcca cgtccctgaa aacggcctgg ctcccttggt tacgtggaa acttagccgc agccactcct caggatccat tgggggaacc gtaaccaggt ccgccctgt ctcatctcgc tctgaatagg gcggatagat tgcgcctatg agcggctgga gtatcgaaa aacaagccaa gcgcggcgga ggtaggggat ggggtcatca atgtcttggg cagtcgtaa tttgagcttg taggtgaggc cctcggcttc acgaccagga ggcgtgttgg gcgttggat acgggcaagc agccagttct ccaccaagtc gagggggcgt gtgagagtgc gtcttctga tgtggtccat ccgagagcgacaatggcatg attccctgcg ctgaccatgg tgctctgcc tgttaagaac ggcggggata gtctgggaga gtaaagcagt gagggcgatt gatatcgac gacgaaaacg aaggaagttt ccaactagca ccataggcaa gccacctatt gggcgactt taccgaatca ctactacatc ttgtgatagt ccgtacttat tggtatttcg cagcactgg tgtgatactg catgatgtaa ccgcaccaag gtgccaaatg acgtgtctca acctgcctt atgcacgcta gaagcggtga catctgtgac taggccgatg ggtcaataaa gcgcattgt accgcgttgg tcctaatccg ggttaatagt ccacacactt aactttagta agcttatac ctataatatg aaaagctataaacattgtta aagctattat aattactatt tactgtatt aaattaagta attaactctt attatttagt gctttaataa tgattactaa ttaatttat tataaatccc ttactaactt actaaatact aaaagtattg attatatttt ttgagttat attaatagct atatcttaaa gattaatata acaaagggca ttcaaaaaga ccttattac ataatgttac attgcattgc gttttatttg tggtaatcta ggctctgcct gacctagta atatagttgt taatgtatgc gcatttcgta accctaggct aatcgtacac catgtccga tgttaaggac attcacagtc aaggaattcg gatatcgacc ttgccagcag gtccgtgcc gcgcggggag tcttgctctctctttgggtc tgtccaatgt ccggcgacct atcatatga tcataatcac aaacgtagca cccataacct ggggtcaata cataagtcag ccatgtgtt ctcaaaggag ttttctagtg tccccatcgc cggggacttg atctctcgta cacacgcac catcccaccc attgccactg acggctcata cagaacttaa tggatctgac caattcaac acagctggca tcgtttggct gacggtcgct gccatcgcca tctcctatat ctgcagtcg agctttctct cttggtacag gctacgccac atccccggcc ctttcctggc tcgatctca agtctttgga atgttctaaa catcgtgact gggcgtacgt cgccggtgct gagaaactg ccaggaaggt acggcccgctggtgcgaacc ggccccaact acgttctcac gacgatgcc gaaattttgc gtcacgtcaa tggcgttcgc agcacatacc cccgtaatgg tgtaagtct gtccatatca cacgtctttt gaaatgtagg gagactcaga gactcactta actgtggct tccagggtat gaaggcttca gggtcgatga atacgaccat atggggtccc tatcgacac gtcggtacac gacgccatca aaagcaaggt gattggtggg tacaacggca ggatgggat agacctcgag ggggccatcg gatcgcaggt caagaccctg gtcagtgaga ccggcgtac acgcggctca aggccgagat caaggccgcg gtggatgccg gcgaggtggt gaggtcatc accatagccc aggcccagaggctgccgtat ctgcaggctg tcgtgctcga ggcttccgc atgcgcccgg ccgtcgtgta cgggcacttc aagtcggtgc cggccggcgg gatacgctg ccgaatggtg tacgcctgcc tgccggcacc gccatcgccc ccaactacat gcactgacc cggcgcgccg acgtctacgg cgctgatgtc gatttgtttc ggcccgagcg ttcctcgac gccgagccgg ccaagcgcct cgagatggag cgcgccatgg acctgaattt gggcttggc cgctggcagt gcgctggcag gaacattgct ctcatggaga tgaataaggt ttattacga ggttggtgga tgtgcatctc cgctctttgc ttttgttctt ttcctgctat gccctcgcc ctcctttgct atcctgacgcgggagaggta tgggacgaga tgagagactg ttcaatgcg cagttattac gccacttcga cctccagatc gtgtatccgg gcaaagcatg gatgaattc acgtaaggcc ttctgaaccc tttttcacct ttcgcgcata ggcgtctcgg tggcgcgag cagcgtgcca tggatattgg agtgctaacc aggttacctc ttacctctgc ggggcgtgg tatattcgca gcataacatg tgggtacaaa tcacggagag ctcgtaagta agtggacgg gaatacacat ggcagtggtg gccatgaacg tcgatggcca cgtacgaggc ggtaccaat ggttggggga ggacacggct gagacggctg gagagaacca tggagatggg taaggaatt atagcaatcg aaataacgagcgtgtttgtg cgcgccgggc tttgcctcac ctgcctacc taaacaagtc cccaagtgat gaataaaatt tggcctcggt gccttctaat tgctctgag ccaccaatga aaaatcaact tggttagaaa acctcctcac caaaaccata tactagcgt gataagcaac acctgcaaat gcgtaggcag cttgtcatct aaaaggccga aaccgcagc atcttgggct gaaaacttgt tacccaagca tcttgcattt ttggttggct gaatttagt cgtgccacct atatgagtcc gaaatctctt gtcccatctc cctgctgagt tctcttcgc atattacctt gagagcattg ccggccatct caaaatcact gacctccaag atacttgcg cacagagtct agcccatatccatccgcggc aatcggcgat gggtatccag tcttgtatc tatccgccag agcctttgtc aagtaacgaa ctgccgggcc gacctctttc ccgtcagag cgccgcccgg cacatgagct ggggcagtgg acgggcccgt ggcaatggcc agggaagtc gcactgtcac gatgccgcag tctctcatct ggccatccgc cccggccccg gaccaggct cctccaagac ctctgtctga agtatctcgg cgaccttgtc accaccctct tagcgagcc acttgatgta ctcgtaaatt gccgcctcgc caccacagac gtctcgcctg agcggaggg cggtcgggat gcacagatgg ggcatgttat cgctcgtggc tgtgtaggca acagtgtct cgaatgaaga cgctgttccgtttgcactga ccatctgcga ccatagggga gttgagagt tgccattctt gggaataaat ccgaaagagg tcgggatggc ggagcgcatc tgtgctggt tgcgctcggc aacgtataag aaagcacaag gtcgaggaac aaatagccac tagtaaagt gaatgcgcag aggatcagca tggcaccacc gtatcaaggg cgtggagaga gttggatcc gcatacttgt ggcaatcaga gacgaagaag tcagggtgca gctcctggag ttgacctca aactggccca cgctgtgcgc cccgtcgacc aatgtcatga tgcattcctt tggcatacg cgcagcaagt cctcaaacgg catcctaaca gcagggatgc tcactatcgt tctagaatt gctaggcgcg ggcgtagacccttagccctg atttgagcta ttgtagtctc aactgagac acaatctttt cgccagtcgt ggggagctca aactctaccc tacgtgtttt aaggatcga gtctcggcca aggaagttat gccatggtcg atggcaccgt aagtagttga agagtcacc acaacgtctc gttcctcaaa ttcctggttg taaaggacgg tgaagatgcc gtagtgacg ttggagacga ggacgcactc cgagacggcg gcgtgaacga gacgagcaag ccgagacgt gcctcctgca gcaccaagcc ttggtaaaac tcggagaaca agtcgggctg gcctccagc agggaccagt aatctctgat ctgcttgctc accaccttgg gccatgaccc caagatgct acgaccacgt cttgttagttcagatacatt tcacatggaa actgaaacgg cacatcgtg taatgagcaa ctgacaagaa ttgaggttgg tgtattccgg atccatgcag aagcctcca gcataggctt gccaaatggg atacgcttgc tattcactgt catcttgaca ggcgatgtc accgaacagg taaatgggaa tcagtgagag tggagatgcc agcagcactt gtgaaaagg aacacgtcaa gttatagcac acggctggca ttcttatgat ttacctaatg gacgaaaat caccccatcc acatcccgtg gttggttagt agctgagcag accacatgca gtgtgggcg gggtgataat atgccaagga cacgtaaatt ggcatctcat tcttttattt catgtgtcg tttgatcatt ggatgcttctggtcaaccat gcatatgtat gcttgcctct aaaaagtgc aactttctga aagggcagcc agatatttaa taaacttcac aactccagcc atacccccc tttcgtcgaa gctgtctaaa gaacagtcca acctacgaga caatcacggt aagccctct gtttcctgta atccatcatg accgctgctt cttcccctca cccaggcgtc ctgcagagg acatcgaatt ctaccaagcc aacggatatc ttcgcctgcc ccaagaggct acggtctgt tcgacgactt ggcaaagctg caggtatggg tggcagaaat ctcccagtgg gcctggaaa cgggaaaatg gcgacattat tacgagacaa cgaatggcaa gcatcttctc gggggacgg agaaactaat ggaataccacgcgcccatgc aagacttgat ttctggcgag cacctctcg cactgctcaa gtcgctgacg ggcaaagaca tggtggtctt caaggacgag tagggtgga aactcccagg cgggaagggg gcggttcctc acctcgaccg gcccgcgtac ccatgtttg cccccgagtt catcgagatc atgatcgccg tagatgccca tacggtcgag atggttgtt tgcagtttgt gccaggctct cacaaggaag cagccccgat ctcggccgac gccgcattg catcggcgtg gctagagggc aaggagttca tccccatggt cctcgacccg gcgacgtct tgatcttcaa cgagagcatg gcccatcggt tggagcctaa caagacggac aaagacgtg cagccgtctt tggcacctaccactttgacc tgtcccagcc cgacctgcgg ataaattct acgcccaccg gctcatccac agccctccgg aaaacggtaa ggcttttcca gaaaagatg atgtttgcat gtttggagac caatgctaac atgatacgtg accaatctta gtagcctgg gttgaaaaag tgggagcgca gacttgacaa gaacaatacg cataaagtag cagaagaag ggatttggct aggaggtagg gggtcgaaat ggaacttggc attcatcacg tgcgtctta ttgttcgtgg cgggtgtaaa atcacacgcc tgtctttcaa tacctagagt cgtttacac aatcccgtat gtcctgtcct tggcagcatt acaacccaga agccgacata gacgccaca tttaatgggt cacttaatgcacataccgcg gaagtcctaa tcattaacag ccatacgtg tagcttgcgt atattgattt ttactataac taatatgccg atatatataa attaccagc ccgggcc 7 7478 DNA Neotyphodium uncinatum aaggca gtcattcaca gcatggaagc gccggggatc ttaacaggaa tttggacgat 6ctctgaagaaagtgc cacgatatct tattcaaacg cggcttggat gctcccacag cacaatg agacttttcc agtcctctta caagcattaa tgcggacgct cctgcttctc caatgta cgccttggga cagtggacct ctcgcctcca cgaggaagcc ataccacgtc 24ggtaa agcagaagca aactatccgt catttgctgc accgcaggagacggattgtt 3caaaat gcaagatttg gggcaagcta gcacatgcaa gtcatgctcg actttacgtg 36cctcg ttgaagcatt atcattgctt aaacatcttt tgggcgagga tatgcatggc 42atatg agcccgtgga agacattttc aaccctggtt acggtcttca aacccgatct 48cgaca cgaaacagttccggagagtc atcaaacaca gagaccagca gcggcgaagg 54aacgg tcgatcatgc aagttgaagt cgcgaatcta tctggtcagc tccgtcagat 6cagcta gaagaaggcc ttctacgagc atggaggagg gaaaacaaat cagaaggttg 66cttcc aagcttaata agaaaaaatc ggctaactcc gatctccgtc cacggaagaa72tatcc ttaaccaggg caaaatttac cacggaaaaa gatgatctta ttaaattatg 78aggac gagcaactta catggacgca aattcaggag cggcatggca accagttcca 84gatcc aaggagtcat tccaggtgcg ctaatgtaca aggctgaaga gccgtaaaaa 9tgtgac ctacggcagt tgatgtggtgaacaaaattg gatatttgga aagaaatgtt 96gtcgc acgccctatg gaaggtattg gcagtggact tggatcttga tttaagctat agagggga atttcgtcaa tacttataga ggtctctgaa gttgttgctt tcctgatatt catctgta acttggttga tacagttgtt gttggagccc cctgttttca aagaattggg cccgttga catatttgct cgtggtcact tacgcctgtt ataactatgc gccagagtac tggttatt ggactgttca cggatgacta gctgtaatcc atgtgatgca gtcggcactt gatttatt caatcatgtt tggtgcttgg tgctgcactt gaacacgacg taatgaatgc tgggcaca caactgccac atttctctgcttctgtgcct cgattgcgtc atagaatctc gcctccat ctgaagcctc atccgcgcca acctcggaca agccaaagtc cttgtagatt tatagcat aaagactaag cagaccccaa acccaaaccc cgaattttgt ccccctcctc catgtaca tctacaagct ttacccactc attgctcttg ttcttgttac gctggagatt ccaatttc cctgcgaact tgccaggagg tcgattcaag tcatcaacaa cctccgagtc gaaggata aacgtattgt gccgcggtgc atcccgaagc tcgggtatcg cctcgaggca cggtcatt ttggcgtctc atgtcgtgga taggggcgtc gcggagctcc gagttgtcaa agggtgtc atgttatgaa accgcctcatcagctcggtt tacttggtcg gtcggcgtcg gtgcggct gctgcccagg gtacccagcg gcgactcgtt aaaaaacaga aagctgaccg R>

tcatttatag atcatctcat ggtcacgagc ccggccatgg ctggatatct cgcaagcagc gacagatt gagaacaaac catcactttc aacttcctcg ctacaacaga attgaagttt ggcgtagc ttgttgcagt cttcgtattg ggccattgct gctcctatcc ctgacttgat 2caatagt accttcaagt tctccgtatacgaaatttcg tcatgacgtc caggctaatc 2gattatg cggtcaaggc tctccatggt tgttgatgac aacgcgtcgc acaacccctg 2aatagca cacttaccaa ctaactctac tacaaaggta catttctcaa tagactgggt 222gggca tacaaactga attattatct gtcaatagtg cctaaggggg gagcggcaca 228gccac tcatgggatc aggtggcggg aaccttgcag tagatcccgt agctcgagag 234gagag aagcttccgc cgaaaggcta ggacgggcct aggatgctaa ttctgggtaa 24ttagga tcagactgag acttgaagat ctagactaga tcattctgat aactgcaacc 246atgca ggagaggagg ggaaacaacatctgtcggta attggcgctt cagatagaag 252aacgg gtccatacaa tgcccccccc ccccccctga attatttttt gtcaaatcta 258cctag tcttttgttc ctctctaata gctgcaatta gctgtacgtc cgtacggagt 264ttgct attattatta gtaagctaca aggaaaattc acggggtgtt aagtgccgct 27gatagg gagggggtgt attactagtg ccacacaaag gtggggtggg tggggcgtgg 276gtctg ttagtgttgc acccacaagg gcataattga tccctgccgc acgatagtct 282ctcaa ctagctgaga caagagtcca cccctagcta gtcattttcc aagacctctg 288tcata gtatgtttca gcactgtacaagtaccccac cgatggtaga ggtacttagg 294aagcc gtagtctgca ccctcttaca gggtcggaca actcaataga ggtggtcaca 3aacccta gcttcgcggt ccaacagtta ggacgcaggg gcgtaccgca attattaaat 3tatgtac atgtatatgt accgcgttat tatatgtctg tggatctaga ataccggtcg 3tgtcatg gtctagccct aagggctaat cgcgggtgcc tgcgccacca tgtgggtgat 3cccaatc ccctgttacg ccataggcaa cgacaaaaga atacgtattg tacaagtcat 324acttg tgcaattgac acctatattg ctaggcctag gcaaagccta ggctatcaca 33ccacct attttaatgt ggcttatgtttactaattat tattaataaa atcaatagta 336tatag ttatagagaa tagctatatg ctagggatta atataataaa gggtatttta 342gccct ataatagtta tattatatta tgttataagg ccttttgata ataaaaatga 348ctata tagaagaaat tattgattga tttttatatt ttttttgggg tcattagtta 354agtgt atctaattta taagtaatat gacaattact agcaatacct agttagttta 36ttgaca tataaataat cacgactata gtaatagata aaacctgtaa ttcctaggaa 366tttaa ggtcacaaat acagggggct gtaaggtcag agcaaagttt gcgataaact 372gtaaa agagattata agcattaacatggcttccta tatttgctgc caagtacttc 378gattt agactaacgt ggtatgcgca tttagtggtc ctaggacgta tgggccggac 384taggc tctccgtcct agcctagcgt atctatgtat tggtctggca acaggcttac 39gctagc caagatgtag atttgaacaa gatgctatca aactgctatt gtgtctgccg 396gttac tggcagatga caccgacgga aacgatgccc attttcttct ggcatagaaa 4agacgta ttggtgtttg tcaatactag agtcttatca gtggaacatg gaaaagcgtg 4acaaaat ctgcctagtg gtcatccaaa aaaacccaat cgctacttgc gtctgaacct 4cagtgta tcgattcgat atacgacagaaagtggcttc acagaagagc cgtctcctct 42accatg cttgaaaccc ctccaggttg ttggccagac agttttccag ctcccgacga 426aatca accccccaac cctgaccggt ttgttagagc agtccacagt acaaagcgac 432ccttt gtgcaaccta ccaagttttc tcttccttgt tagcctcagc tgttttcttg 438gcgtg catgtgtatg gtagagtgtc ttgtcccaaa gtaggctcat cttcttctcc 444gcagt gggacttgga agtcgcctcg agttgacaaa tgcccgcctg ttggcacttt 45tgattt cgcacaacca ctctacctga acagtgatga ccgcggggga gttgaccaga 456aggac actggggtcc atagaggaaaaacatgttag ggaatgaatg gatggccatt 462atgcg actcgacacc atcggaccag gcatcttcta aacggatgcc attccggcct 468atgaa gactcctgag cccgcttgcc tcgtcaccaa acccggtggc aaaaatgatc 474gcatt caactgtctg cccatgaacg cgaatacttg tctctgtaat caactcgatt 48ggttgc tgatgtcaat aatcttcaca tgtggttggt ccatgatctc gtaaagatcc 486caaac agggtcgctt gatgccaaag gcaaaagatg gaatctgagg caccaggagc 492tttgg tcacatcgcc gattctagct cgtgtccgcc gagcccagaa atcatacgca 498gttgg cttggatgtt ctggcacagatcccggaacc cagccatcca gaaagcccag 5cccgcca gatagcgttg ttgataaaaa tggtttcgct cctctattgg gacatccaac 5tcctggt cacggggcac gtagccgaaa ccgttcgaag tctgcagtcc aagtcgtagg 5tctctgt ggtcgtcggg tctcatgcaa agtgccgttg ccgtctggtt cgggctgccg 522gcgta gagtgaggca tggagactgc tggaatatcg tcatggcctt ggctatctta 528agatt ggatgatctg aactccgctt ggccccgttc caatgacagc cactctctta 534catac tgacagcgtc atgaggccat tttgcggtgt ggtagatggc accgcggaat 54acattc ctggaatcct agggatattgagaaccgacg aaaaccctac agctggaatg 546tcgcg cctcggctct tctgccatct tctaaagtga cggtccatct ctgggtagtt 552gtacc tcgccgcgga aaccgaaaca ccaaactcaa aactagcaga gatttcccat 558gtcca cgtggtcaaa atatctgagc atctctgcac gggtgggaaa ttgctctccc 564ccaat cttggagaag ctctgcatca tagaactggt agaagggaaa taggctgtcg 57ctgctc ccggataagc gttctcgcgc cagacacctc caagacgttc ctggcgctcg 576ttgga ctcgaaatcc gagcttttcg cagtctttag tcatagttca gtcctacctc 582tctat tcgtgtcttg gatggcaacgtagactcacc tgtagacagc gagaatacct 588accag cgccaacgac gattgcgtcc aaattggtca atgtcatctt agtgaaatga 594aatta aataactata tgcagaatag aaccaaattt tgttgtatca gaaatgtcat 6aggctaa cagctccggg gagagaaaag cttgatcgag gttgaaattt actgaggtgc 6agggact gatactaaga cggtcgatta tctgtgtgag aatggtcaga atgggtagct 6caattgg atagactagt ttgggagggg gagtatagtc gtacacatgg attcgcaaat 6aatgaag cgttaagtct gttgtgatat aataaggtca ctaaatgcgc ataacgcgtt 624taatc cgggttaacg gtccatacaccttgtgccta tatgtgtaat atttaaaggt 63atacta ttaaagctat tataattatg actatactag tattaagtaa ttaactctct 636gtacg ctttaaataa ttgctactaa ataaatttaa ccgctataaa tcaatcactt 642ataag tattaatagt attaattata tcttgtatag ttatataaat agctttatct 648aatga cacaataaag ggcatgtaaa aagagcctaa ttacattata ttgcgttgtg 654ttgcg ttatattata ttatgaggct ttttacaata agcattatag tcagtgcatt 66actagc tctctaatat atttagcaag gggcttagta tactagtact ttctttttag 666acgcg gtatgcgcat ttactgacctagtacaatac accccctgaa ttattttaca 672acata acaggggtaa ttaagctaat tagatattag ctaggaaata aaggagatag 678agtac attatactac tagttatcta tatagaaata gatatacttt ttcgtggcgc 684acctt gtatatttcc ctcattgctc tctaaaacaa aacagaggtt atattacata 69gctaat catagctatt agagagagac gaataactag ggcatgtaga tttgtaaaat 696agggg gtgtattgta taatagggca taggagaggg gtgagtgggg cgttcactcc 7tcatgtc acttctcaca caaggagggg aagcgttgct attcggagct gtgttttctt 7taccaga gctatgccta ccacgtaataaggccacatc ccacatctca cgccccgcca 7aattatt tgtatagcac tccctggcaa taaaaaatag ttagaattac agtacacccc 72attatt ttacagatct tcataacagg gttgattgcg tgaattaagt gctagcaagg 726aggga gatagaggct aggattagga agtacctaga ttcctttata ctatatttaa 732ttcat atcttctagt agtactacat accctacata ttttccttat agctctctat 738tataa gtgttatagt gcacttatag ctaactaaag ctattagaga gaaacgaaaa 744gtgca tgtagattga aaaaggctga tagaccag 7478

* * * * *