CROSS REFERENCE TORELATED APPLICATIONS

This application claims the benefit of priority to Japanese Patent Application No. 2005-58193, filed on Mar. 2, 2005, which is incorporated herein by reference.

TECHNICAL FIELD

The present invention relates to methods for producing proteins.

DESCRIPTION OF THE RELATED ART

In protein production, gene recombination technology has developed, by which proteins can be produced in large amounts using recombinant cells made by introducing an expression vector containing a gene encoding a protein of interest into hostcells. In particular, to produce a protein of interest in large amounts and easily recover the produced protein, expression systems in microorganisms such as E. coli, yeast, bacillus subtilis, actinomycetes, fungi, etc. have been used.

However, when a heterologous gene has been expressed in a expression system in microorganism, most or all of the expressed proteins has been accumulated as insoluble protein aggregates called inclusion bodies in many cases. Thus, a method bywhich such insoluble proteins can be isolated in an active and solubilized state has been desired.

For example, there is disclosed a method for activating insoluble hydantoinase produced in recombinant bacteria, in which, after insoluble hydantoinase that has been produced in recombinant bacteria and accumulated as insoluble aggregates wassolubilized by adding 2-mercaptoethanol or urea, the solubilized hydantoinase is activated under the presence of Mn ions (Japanese Laid-Open Application No. 1994-30772).

Further, there is disclosed a protein-renaturing method, in which a cysteine-containing protein is solubilized, being converted into a reduced and denatured state by a denaturing agent and a reducing agent, its disulfide bonds are formed at thesites corresponding to those observed in the natural protein by removing the reducing agent and oxidizing the protein in a denaturing condition, and then the renatured protein is isolated and purified (Japanese Patent No. 2669859).

As described in the above, to obtain a protein of interest that has physiological activity from inactive insoluble protein aggregates folded into the form (tertiary structure) that does not give its intrinsic physiological activity, it wasnecessary to treat the aggregates with a denaturing solution containing a denaturing agent such as guanidine hydrochloride and urea and a reducing agents such as .beta.-mercaptoethanol, cysteine, and glutathione, unfold polypeptides in the aggregates,and subsequently refold them into an active conformation.

Such a method for unfolding and refolding insoluble protein aggregates, not only requires enormous efforts in considering conditions but also involves complicated operations such as removal of the denaturing agent by dialysis, gel filtration,etc. In addition, renaturation efficiency is sometimes extremely low.

Meanwhile, there is disclosed a method for producing a protein by culturing host cells in which a introduced foreign gene can be inducibly expressed, in which a protein of interest can be obtained in an active state by inducing expression of theforeign gene in the low temperature range of 12.degree. C. to 25.degree. C., preferably 21 to 25.degree. C. (Japanese Laid-Open Application No. 2004-24243).

SUMMARY OF THE INVENTION

The object of the present invention is to provide a novel method for obtaining a protein of interest efficiently in a soluble form when the protein is produced by expression of a foreign gene in host cells such as microorganisms etc.

The inventors found that an insoluble protein can be recovered efficiently in an active form in the production of transaminase proteins by culturing E. coli into which an expression vector containing a thermophile-derived transaminase gene hasbeen introduced at 46.degree. C. after inducing expression of the transaminase gene, and have thus accomplished the present invention based on these findings.

The present invention encompasses the following:

1. A method for, by culturing a host cell into which a foreign gene has been introduced, producing a protein encoded by the foreign gene, which includes culturing the host cell, after inducing expression of the foreign gene, in the temperaturerange lower than or equal to the upper temperature limit for growth of the host cell and higher than 5.degree. C. below the upper temperature limit for growth of the host cell.

2. The production method of claim 1, wherein the host cell is E. coli.

3. A method for, by culturing a host cell into which a foreign gene has been introduced, producing a protein encoded by the foreign gene, which includes culturing the host cell, after inducing expression of the foreign gene, in the temperaturerange higher than 42.degree. C. and equal to or lower than 47.degree. C.

4. The production method of claim 1, wherein the foreign gene is derived from a thermophile.

It should be noted herein that thermophiles refer to microorganisms whose optimum growth temperature is 50.degree. C. or higher, and which hardly thrive at 40.degree. C. or lower. Among thermophiles, microorganism whose optimum growthtemperature is 50 to 70.degree. C. is referred to as moderate thermophiles, microorganism whose optimum growth temperature is 70.degree. C. or higher is referred to as extreme thermophiles, and microorganisms whose optimum growth temperature is80.degree. C. or higher is referred to as hyperthermophiles. In addition, mesophiles refer to microorganisms whose growth temperature is in the normal temperature environment, especially those whose optimum growth temperature is 20 to 40.degree. C.Psychrophiles refer to microorganism whose optimum growth temperature is 20.degree. C. or less.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows a result of a measurement of enzyme activity in Example 1 performed according to the present invention.

FIG. 2 shows a result of electrophoresis in Example 1 performed according to the present invention. The arrowhead on the right side of the gel indicates the protein expressed.

FIG. 3 shows a result of a measurement of enzyme activity in Example 2 performed according to the present invention.

FIG. 4 shows a result of electrophoresis in Example 2 performed according to the present invention. The arrowhead on the right side of the gel indicates the protein expressed.

FIG. 5 shows a result of a measurement of enzyme activity in Example 3 performed according to the present invention

FIG. 6 shows a result of electrophoresis in Example 3 performed according to the present invention. The arrowhead on the right side of the gel indicates the protein expressed.

FIG. 7 shows a result of a measurement of enzyme activity in Example 4 performed according to the present invention.

FIG. 8 shows a result of electrophoresis in Example 4 performed according to the present invention. The arrowhead on the right side of the gel indicates the protein expressed.

DESCRIPTION OF THE PREFERRED EMBODIMENT

Embodiments of the present invention accomplished based on the above-described findings are hereinafter described in detail by giving Examples. Unless otherwise explained, methods described in standard sets of protocols such as J. Sambrook andE. F. Fritsch & T. Maniatis (Ed.), "Molecular Cloning, a Laboratory Manual (3rd edition), Cold Spring HarborPress and Cold Spring Harbor, N.Y. (2001); and F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl(Ed.), "Current Protocols in Molecular Biology," John Wiley & Sons Ltd., or alternatively, modified/changed methods from these are used. When using commercial reagent kits and measuring apparatus, unless otherwise explained, attached protocols to themare used.

The objective, characteristics, and advantages of the present invention as well as the idea thereof will be apparent to those skilled in the art from the descriptions given herein. It is to be understood that the embodiments and specificexamples of the invention described hereinbelow are to be taken as preferred examples of the present invention. These descriptions are for illustrative and explanatory purposes only and are not intended to restrict the invention to these embodiments orexamples. It is further apparent to those skilled in the art that various changes and modifications may be made based on the descriptions given herein within the intent and scope of the present invention disclosed herein.

The present invention provides a method for producing a protein by culturing host cells into which a foreign gene has been introduced, in which the host cells are cultured after inducing expression of the foreign gene, in the temperature rangelower than or equal to the upper temperature limit for growth of the host cells and higher than 5 degrees below the upper temperature limit for growth of the host cells.

In this method, the host cells are not particularly limited but can be appropriately selected from various eukaryotic and prokaryotic cells. In particular, it is preferred that host cells have the system in which the expression of a protein isregulated by at least one promoter whose activity can be induced with an inducer to express the gene. E. coli, bacteria of the genus Bacillus, and yeast are particularly preferred hosts, among which E. coli is the most preferred because of ease ofculture, known genome information, well known characteristics of the strains, high expression levels of recombinant proteins, availability of various host-vector systems, etc.

The foreign genes and their encoding proteins include, but not limited to, for example, genes derived from thermophiles, such as hyperthermophiles, extreme thermophiles, and moderate thermophiles, etc; mesophiles; and psychrophiles. The presentinvention can be applied to any gene and protein.

In the method for producing a protein according to the present invention, the culture temperature after inducing expression is near the upper temperature limit for growth of a host. For this reason, when using a mesophile, such as E. coli, B.subtilis, yeast, etc. as a host, the foreign gene is derived preferably from a thermophile, such as a hyperthermophile, an extreme thermophile, and a moderate thermophile, etc; and a mesophile, and more preferably from a thermophile, such as ahyperthermophile, an extreme thermophile, and a moderate thermophiles, etc.

The expression vector into which a foreign gene encoding a protein of interest has been incorporated is not particularly limited and a known expression vector may be used. The expression vector include, for example, E. coli-derived plasmids,such as the pET derivatives, pBR derivatives, pUC derivatives, etc; B. subtilis-derived plasmids, such as the pUB110 derivatives, pC194 derivatives, etc; yeast-derived plasmids, such as pPIC6, pAUR123 DNA, etc; and vectors made by inserting variouspromoters for expression of foreign genes into animal virus vectors such as adenoviruses or insect virus vectors such as baculovirus.

These expression vectors may optionally contain a gene encoding a protein to be coexpressesed, such as a selective marker, chaperonin, etc. Examples of the selection marker include a chloramphenicol resistance gene, an ampicillin resistance gene,a tetracycline resistance gene, etc.

The method for incorporating a foreign gene into an expression vector is not particularly limited, and known methods may be used. One example of the method is to digest the aforementioned foreign gene with restriction enzymes and ligate it intoan expression vector that has been digested with the same restriction enzymes. The most appropriate method can be selected depending on the type of foreign gene, expression vector etc. to be used.

The method for introducing an expression vector into a host cell is not limited, but can appropriately be selected depending on the type of host cell and vector etc. to be used. Examples of the method include electroporation, heat shock method,etc.

In the expression systems that have the above-described composition, a protein of interest is expressed, for example, in the following methods.

First, recombinant transformed with an expression vector harboring a foreign gene encoding the protein of interest are cultured. The medium for culturing recombinant cells is not particularly limited, and appropriately selected depending on thehosts to be used. In the method according to the present invention, it is necessary to induce expression in recombinant cells when they are cultured. The suitable timing for the induction is, when using E. coli as the host, for example, is the pointwhen the cell concentration in the culture measured as the absorbance at 660 nm (OD660) is 0.05 to 3.0, preferably 0.50 to 1.0.

As the inducer, known agents may be used and it can be appropriately selected depending on the type of promoter and host cell, etc. For example, when the host is E. coli, 3-.beta.-indole acrylic acid (IA) can be used for the trp promoter; andisopropyl .beta.-thiogalactopyranoside (IPTG), etc. can be used for the lac promoter and tac promoter. When the host is yeast, methanol, etc. can be used for the AOX1 promoter and AUG promoter.

After the expression of the protein is induced in the recombinant cells, the cells are cultured in the temperature range lower than or equal to the upper temperature limit for growth of the host cells and higher than 5 degrees below the uppertemperature limit for growth of the host cells; preferably in the temperature range lower than or equal to the upper temperature limit for growth of the host cells and higher than or equal to 3 degrees below the upper temperature limit for growth of thehost cells; more preferably in the temperature range lower than or equal to the upper temperature limit for growth of the host cells and higher than or equal to 1 degree below the upper temperature limit for growth of the host cells. For example, whenusing E. coli Rosetta (DE3), of which upper temperature limit for growth is 47.degree. C., recombinant cells are cultured in the temperature range higher than 42.degree. C. to 47.degree. C., preferably in the temperature range equal to or higher than44.degree. C. to 47.degree. C., more preferably in the temperature range equal to or higher than 46.degree. C. to 47.degree. C. By growing the host cells under such conditions, a protein of interest can be efficiently obtained in an active form.

The protein that has been expressed can be isolated and purified by known methods. For example, after the cells are disrupted by sonication, with a homogenizer, or the like and the cell debris is removed by centrifugation or the like, theprotein can be isolated and purified by ammonium sulfate precipitation, gel chromatography, ion exchange chromatography, affinity chromatography, etc. Alternatively, when a tag, such as a His tag, a GST tag, a Flag tag, etc. is fused to a protein, theprotein can be isolated and purified by affinity chromatography using an appropriate column such as nickel column, depending on the tag. Alternatively, depending on the purpose, the conditioned medium or cell homogenate can be used.

Hereinafter, the present invention will be explained in more detail with reference to Examples. However, the present invention is by no means limited by these Examples.

EXAMPLE 1

1. Method for Preparing of Recombinant Cells into which a Foreign Gene Has Been Incorporated

In this Example, the transaminase gene (APE2248) of the hyperthermophile Aeropyrum pernix was used as a foreign gene. The hyperthermophile Aeropyrum pernix is an aerobic hyperthermophile harvested by Kyoto University in 1993 in a hydrothermalvent at Kodakara Island in Kagoshima Prefecture. Its genome information has been published by the National Institute of Technology and Evaluation.

First, DNA that has the nucleotide sequence shown in SEQ ID NO: 1 was amplified from the genome of Aeropyrum pernix by a PCR reaction. As primers for the PCR reaction, DNAs shown in SEQ ID NOs: 2 and 3 were used. The PCR reaction was performedusing KOD plus polymerase (manufactured by Toyobo Co., Ltd.), according to the protocol attached to this enzyme. After the reaction, 5 .mu.g/.mu.l DNA solution was obtained by purifying the amplified DNA fragments using GFX PCR and Gel Band PurificationKit (manufactured by Amercham), according to the protocol of the kit.

Next, the restriction enzymes EcoRI and NdeI (1 .mu.l each), 5 .mu.l of 10.times.H Buffer, (all of which are manufactured by Takara Bio Inc.) and 43 .mu.l of the DNA solution obtained as above were mixed and incubated at 37.degree. C. overnight.

Meanwhile, 2 .mu.l of 0.5 .mu.g/.mu.l pET21a(+), (which is manufactured by Novagen) 1 .mu.l of EcoRI, 1 .mu.l of NdeI, and 5 .mu.l of 10.times.H Buffer (which are manufactured by Takara Bio Inc.) were mixed and incubated at 37.degree. C.overnight. The genomic DNA and plasmid digested with the restriction enzymes were purified by agarose electrophoresis. DNAs were recovered from the gel with GFX PCR and Gel Band Purification Kit (manufactured by Amersham) and ligated with DNA LigationKit Ver.2 (manufactured by Takara Bio Inc.) according to the protocol of the kit. Then, E. coli JM109 competent cells was transformed with the resulting recombinant plasmids by the electroporation method.

The transformed cells were spread onto LB agar plates (1.0% Tryptone, 0.5% Yeast Extract, 1.0% NaCl) containing 50 .mu.g/ml ampicillin and incubated at 37.degree. C. overnight. Clones that have the fragment of interest were identified by colonydirect PCR from several colonies selected randomly from single colonies formed on the agar medium and then directly suspended in a reaction solution. Colony direct PCR was performed in a total volume of 50 .mu.l of reaction mixture freshly prepared.

TABLE-US-00001 Ex Taq polymerase 0.5 .mu.l (manufactured by Takara Bio Inc.) Buffer 5 .mu.l (10 .times. Ex Taq Buffer, manufactured by Takara Bio Inc.) dNTP 4 .mu.l (2.5 mM each, manufactured by Takara Bio Inc.) Primer DNA of SEQ ID NO: 4 (100pmol/.mu.l) 0.5 .mu.l Primer DNA of SEQ ID NO: 5 (100 pmol/.mu.l) 0.5 .mu.l E. coli in each colony Subtle quantity

PCR was performed in a commercial temperature cycler (ROBOCYCLER.TM.; manufactured by Stratagene) using the following conditions: an initial denaturation of 3 min at 94.degree. C., followed by 25 cycles of 60 sec at 94.degree. C., 60 sec at56.degree. C., 140 sec at 72.degree. C. After the reaction, amplification of the fragments of interest was confirmed by 1% agarose electrophoresis and recombinant plasmid containing the transaminase gene of interest was prepared from the positivecolonies. The DNA fragments of interest in the recombinant plasmid were sequenced, and the DNA sequences of the clones were found to have no mutation.

Using the resulting recombinant plasmid, the Rosetta (DE3) strain was transformed. The transformed E. coli was spread onto an LB agar plate containing 50 .mu.g/ml ampicillin and 34 .mu.g/ml chloramphenicol, and incubated at 37.degree. C.overnight.

2. Induction of Protein Expression

The recombinant E. coli thus obtained was inoculated into 5 ml of LB medium containing 50 .mu.g/ml ampicillin and 34 .mu.g/ml chloramphenicol and incubated at 37.degree. C. overnight.

Next, 50 .mu.l of the pre-culture was added to 5 ml of LB medium containing 50 .mu.g /ml ampicillin and 34 .mu.g/ml chloramphenicol, and the main culture was incubated at 37.degree. C. to an OD660 of 1.0. IPTG was then added to the culture at afinal concentration of 1 mM, and the gene expression was induced by incubating it for 1 hour, 3 hours, 5 hours, 7 hours, 9 hours, 20 hours, 30 hours, and 44 hours each at 15.degree. C., 25.degree. C., 37.degree. C., 43.degree. C. that corresponds to4 degrees below the upper temperature limit for growth, and 46.degree. C. that corresponds to 1 degree below the upper temperature limit for growth. After incubation, bacteria was harvested from 3 ml of the culture, washed with 20 mM potassiumphosphate buffer (pH 7.5), and suspended in 20 mM potassium phosphate buffer (pH 7.5) containing 1 mM pyridoxal phosphate. The bacterial suspension was ultrasonicated, followed by centrifugation, and the supernatant was used as cell-free extraction. Byheat-treating this cell-free extraction at 80.degree. C. for 30 min, E. coli-derived aminotransferase was inactivated, insoluble debris was removed by centrifugation, and the supernatant was used as a crude enzyme.

3. Method for Confirming Enzyme Activity

200 .mu.l of reaction mixture containing 30 mM L-phenylalanine, 60 mM 2-oxoglutaric acid, 0.5 mM pyridoxal phosphate, 100 mM potassium phosphate buffer (pH 7.5), and 50 .mu.l of the above-mentioned crude enzyme was incubated at 80.degree. C. for30 min, and then the reaction was stopped by adding 50 .mu.l of a 30% trichloroacetic acid aqueous solution. The glutamic acid generated in the reaction was derivatized with the Marfey's reagent and quantified by HPLC.

The result of measurement of the enzyme activity is shown in FIG. 1.

4. Electrophoresis

The samples of the crude enzyme solution obtained from bacteria which were cultured for the induction for 20 hours at temperatures of 15.degree. C., 25.degree. C., 37.degree. C., and 46.degree. C., were mixed with an equivalent volume of2.times. sample buffer composed of 0.1 M tris-hydrochloric acid (pH 6.8), 4% SDS, 12% .beta.-mercaptoethanol, 20% glycerol, and a subtle quantity of bromophenol blue. The soluble proteins contained in the samples were analyzed by SDS-polyacrylamide gelelectrophoresis. In addition, the precipitates resulting from ultrasonication were suspended in a 1.times. sample buffer and insoluble proteins were analyzed by SDS-polyacrylamide gel electrophoresis. The result of the electrophoresis is shown in FIG.2.

EXAMPLE 2

Recombinant E. coli was obtained, the protein expression was induced, and the crude enzyme solutions were obtained according to Example 1, except that the transaminase gene (PH1423) of the hyperthermophile Pyrococcus horikosii was used as aforeign gene. The nucleotide sequence of PH1423 used here is shown in SEQ ID NO: 6 and the primers for the PCR reaction are shown in SEQ ID NOs: 7 and 8. Pyrococcus horikoshii OT3 is a hyperthermophile isolated from a hydrothermal fluid in OkinawaPrefecture by the manned deep-sea investigation vessel "Shinkai 2000" in the DeepStar project. Its genome information has been published by the National Institute of Technology and Evaluation.

20 .mu.l of reaction mixture containing 40 mM L-ornithine, 60 mM 2-oxoglutaric acid, 0.5 mM pyridoxal phosphate, 100 mM potassium phosphate buffer (pH 7.5), and 10 .mu.l of the above-mentioned crude enzyme was incubated at 80.degree. C. for 10min, and then the reaction was stopped by adding 50 .mu.l of a 30% trichloroacetic acid aqueous solution. The result of measurement of the enzyme activity is shown in FIG. 3.

In addition, the soluble proteins and non-soluble proteins were analyzed by SDS-polyacrylamide gel electrophoresis in the same procedure as in Example 1. The result of electrophoresis is shown in FIG. 4.

EXAMPLE 3

Recombinant E. coli was obtained, protein expression was induced, and crude enzyme solutions were obtained according to Example 1, except that the transaminase gene (APE0457) of the hyperthermophile Aeropyrum perni was used as a foreign gene. The nucleotide sequence of the transaminase gene (APE0457) used here is shown in SEQ ID NO: 9 and the primers for the PCR reaction are shown in SEQ ID NOs: 10 and 11.

Enzyme activities were measured in the same procedure as an Example 2. The result of measurement of the enzyme activities is shown in FIG. 5.

In addition, the soluble proteins and non-soluble proteins were analyzed by SDS-polyacrylamide gel electrophoresis in the same procedure as in Example 1. The result of electrophoresis is shown in FIG. 6.

EXAMPLE 4

Recombinant E. coli was obtained, protein expression was induced, and crude enzyme solutions were obtained according to Example 1, except that the transaminase gene (ST1225) of the hyperthermophile Sulfolobus tokodaii was used as a foreign gene. The nucleotide sequence of the transaminase gene (ST1225) used here is shown in SEQ ID NO: 12 and the primers for the PCR reaction are shown in SEQ ID NOs: 13 and 14. Sulfolobus tokodaii is an aerobic and acidophilic thermophile isolated from one of thehot springs in Beppu-Onsen of Oita Prefecture, which is capable of decomposing hydrogen sulfide by itself. Its genome information has been published by the National Institute of Technology and Evaluation.

Enzyme activities were measured in the same procedure as an Example 1. The result of measurement of enzyme activity is shown in FIG. 7.

In addition, the soluble proteins and non-soluble proteins were analyzed by SDS-polyacrylamide gel electrophoresis in the same procedure as in Example 1. The result of electrophoresis is shown in FIG. 8.

RESULTS AND DISCUSSION

FIGS. 1, 3, 5, and 7 indicate that the enzyme activities markedly increased when the method according to the present invention was used, compared with the results obtained when the culture temperature for the induction was 15.degree. C.,25.degree. C., or 37.degree. C.

In all the Examples, it was found that the enzyme activity increased 5 to 10-fold when the culture temperature for the induction was 46.degree. C., compared with the results of the control experiments obtained when the culture temperature forthe induction was 15.degree. C., 25.degree. C., or 37.degree. C. Further, FIG. 7 indicates that, depending on the protein to be expressed, enzyme activity increased 3 to 4-fold when the culture temperature for the induction is 43.degree. C., comparedwith the results obtained at 15.degree. C., 25.degree. C., or 37.degree. C.

Moreover, in all the Examples, it could be confirmed that only a small amount of both soluble and insoluble proteins was obtained when the protein expression was induced at 15.degree. C. or 25.degree. C.; that only a small amount of solubleproteins but a large amount of insoluble proteins were obtained when the protein expression was induced at 37.degree. C.; and that signals for soluble proteins were clearly visible, whereas signals for insoluble proteins were relatively faint, when theprotein expression was induced at 46.degree. C.

In conclusion, it was shown that by using the method herein, a protein of interest can be solubilized with its activity maintained.

>

3eropyrum pernix ctggc tgttgcccca gaaggatcct accctggacatccaggagag ggttgttgag 6gggtg agactgcttt cgcatacctc gcagtggcca ggaagctgat ccaggagggt cgcgtaa taagctttgg gataggccag cccgacttcc cgacgcccca tcacattaga gctgcga agaaggcttt agacgagggg ttcacaggct ataccgagac ggccgggata 24gctgagggaggctat cgcatggtac ctcaactcca ggtacggggc cgacgtgtct 3aggagg ttatagccac gacgggggct aagactgcaa tattcctggg tatggccctc 36gaggc cgggagacga ggtcataata ccggacccca gctactacgc ctacgcacag 42taaac tcttcggcgc caggcccgtt tacgttccaa tgaagtttgagccgggtcta 48caggt tcgatatcga ggggatagaa agggctgtga gcgagaagac gaggatgata 54caaca acccccacaa ccccacgggg agtgttttcc cgccggacca ggtggaggcg 6acgata tagcgaggag gaggggccta ataatactgg ccgacgagat atacgacaac 66ctaca cggagaagcccttcaagagc accctctccc tcccagactg gagggagaac 72ttacg tcaacggttt cagcaagaca ttcagcatga cgggctggag gctcggctat 78gctca ggagggaggt aatcccgaag gccctagacc tcgcagtcac aatatacagc 84cccca gcatagctca gaaggctggc gtcgccgcgc tcagaggcga ctggggtcct9gagaga tggtagaaga gttcaggagc agagcgagga tactttacga catactatcc 96cgagg gtatagagcc ctacctcccg gagggcgcct tctacatgtt cccccgtgtg cggcctcc tgaggaagac ggggctcagc gtggagcagc tcgcggagaa gctgctatac ctacggcg tcctggtcct gcccggcaccagcttccctg agagtgttgg cagggagcat taggctga gcttcgccac ggccaccagc gacgtgaagg agggggcgga gataatagtc ggcgtcta gggagctgtc cagcggctag 3rtificial primeraaaccat atgaactggc tgttgcccca g 3DNA Artificial primer2 3ccgaattcct agccgctgga cagctcccta 3DNA Artificial primer3 4 taatacgact cactataggg 2DNA Artificial primer4 5 gctagttatt gctcagcgg 65 DNA Pyrococcus horikoshii 6 atggagttga agccaaacgt taaagagata cccggaccaa aagctaggaa agttattgag 6ccaca agtacatggc aaccacgaca aacgatccaa acgagtactt cctagttatc agggcag agggagttta ttggatcgat gtcgatggaa acgtactctt ggatttctcc ggaatcg gtgtcatgaa cgtaggactt aggaatccaa aagttattga ggccataaag 24acttg atctggtact tcacgctgct gggactgactactataaccc atatcaagta 3ttgcaa agaagctcgt tgagatagcc ccaggagaca tcgaaagaaa ggtcttccta 36tagtg ggaccgaggc caatgaggca gcgttaaaga tagcaaagtg gtccacaaac 42gatgt tcatagcctt cattggagca ttccatggaa gaacccatgg aactatgagc 48cgcgagtaaacctgt ccagagaagc agaatgttcc caacgatgcc tggtgtagtt 54tccat atccaaatcc atacagaaat ccatggggaa ttgatggtta tgaaaaccca 6agttga taaatagggt aatcgactac attgaagagt acctctttga gcactacgtt 66cgaag aagttgccgg aatattcttt gaacccatcc aaggtgagggaggttacgta 72accaa agaacttctt caaagagctc aagaaattgg cagataagca tggaatactc 78agacg atgaagttca gatgggaatg ggaagaactg gaaggatgtg ggccatagag 84cgata tcgttcccga tatagttacc gttgcaaagg cccttggtgg tggaataccc 9gagcga ctatattcagagctgacctt gactttggag tcagcggtgt tcacagcaac 96cggag gaaacactgt cgctgcagct gcagcccttg cggtgataga agagcttcag tggtttaa tagagaatgc ccagaagctg gaacctctct tcagggagag gcttgaggag gaaagaga agtatgagat aatcggtgat gtaagaggcc ttggacttgcatggggagtt gttcgtta aagataggaa gaccaaggaa tatgcaacca aggaaagagg agaaatagtt cgaagccc ttaagagagg tttagcattg cttggctgtg gaaagagtgc aataaggctt cccaccat tgataatcag tgaagaagag gcaaagatgg gattggatat ctttgaggaa aataaagg tcgtcagcgaaaggcacgga tacaagattc attag 35 DNA Artificial primer5 7 cccaaaccat atggagttga agccaaacgt taaag 35 8 3rtificial primer6 8 ccgaattcct aatgaatctt gtatccgtgc c 39 DNA Aeropyrum pernix 9 gtggctgttg atgcaccccg gatagttgtg gagcccccgggccctagggc tagggaggtc 6gaggg acgagagggt tataatgcag tctttcactc gctggtaccc cctggttgtt cgtggct acggggctgt ggtggaggat gttgacggca acaggtatat agacttcaac ggtatag cagtgttgaa cgtgggccac aatcacccta gggttgttga ggcggttaaa 24gctggagaggttcct gcactatagc ctgacggact tctactatga ggaggccgtc 3ccgcgg agaggcttgc cagatccgtc cccataagcg gcggggccaa gacgttcttc 36cagcg gggccgagag catcgaggcc tccataaagg ttgtaagggc gttcttcagg 42gaggc cctacataat aagcttcctc gggggcttcc acgggaggacctacggggcc 48cgcct cagccagcaa gccggtccac agggccaggt tctaccccct cgtcccgggc 54ccacg ccccataccc agacccatac cgctgcccct tccccggcct cgagggtgaa 6gtggcg aggcggctgt aagctatata gaggactata tattctcgaa gctggtcgac 66agagg ttgccgcattcctcttcgag cccatccagg gcgagggcgg ctacgtcgtc 72cgaca gcttcctacc ctcgctccag aagctggcta ggaagcatgg gatactgctc 78ggacg aggttcagac gggcttcgcg aggacgggca ggatgttcgc cgtggagcac 84tgtgg agccagatgt catggcccta gccaaagcca tgggaggggg gctgccgctg9ctgcgg tggggaggag cgaggtgatg agcctccccc gcggtagcca cgccaacact 96cggca accccgtcgc cctcgccgcc ttcaacgcgg tgatggacgt tatagagggc gaggctgt gggagaggtc gcagaggctg ggcgagaagg cgctgaagat actgggggag tgccgagg agctgagtat agtgggccatgtgaggggta aggggctaat gataggcgtt gctggtca gggacgagaa caccagggag ccccacaagg aggccctcgc ctgggtgctg taggtctt tcaagagggg tcttctagtg ataggcgcgg gcgtctcagc cgtgaggata gcccccgc tcaccatcga ggaggagctc ttcgaccggg gtctggagat actggtggag cctcaggg aggccgaccg ccgcttctcc caggtctag 3rtificial primer7 aaccat atggctgttg atgcaccccg 3 DNA Artificial primer8 attcct agacctggga gaagcggc 28 DNA Sulfolobus tokoda i i cagtag atgatttttc cctttcggcaaatagtatat caggagaatc taccctagta 6agatg ttgcaagaca agtacagaag actaagggaa taagaatcat aaattttggt ggacaac cggatttgcc tacatttgcc agaataagag aagctgcaaa gaaatcattg gaaggat ttactggcta tacatcagct tatggaattg atgaattaag acaaaagata 24gcatt taagcagtaa atatgagagt gtgagaaagg aagaagttat tgtaactcct 3caaaaa cggcacttta cttagccttt ttattataca taaatcctgg agacgaagtt 36atttg acccttcatt ttactcttat gcagaagtag taaagatgtt aggaggagtc 42ttatg ttaaaatgaa gtttaatgag agtactggattttctcttaa cttatcggaa 48atcta aaataaataa aaaaacaaaa atgatagtat taaataatcc tcataatcca 54tatgg tgtttgatcc aatagaaatt gaaaagctaa tggagattac taaggaaaag 6ttcttc ttctatcaga tgaaatatat gattatttta tttatgaagg aaagatgaag 66actagaagatccaga ttggagagac tatgttattt atgtaaatgg attcagtaaa 72ctcta tgactggttg gaggttaggg tatgtagtag ctaaagaaaa agtgattaag 78ggcag agattgctgc aaatatttat acttgtccta ctagttttgc tcagaaaggt 84agcag cttttgaatc ttttgatgaa gttaaggaaa tgatatcattatttaaaaag 9gggata taatgtacga agaacttaag aaaataaaag gaatacaagt gcataaaagt 96agcgt tctacatgtt tccatttatt ggcgagattc taaaaaaggc taatcttagt taaagact tttcgttaaa gttaattgag gaaaaaggag taaccaccat accgggtgaa attcccat tagaagttggtaaagatttt gttaggctta gttttgctgt aaaagaagat tataagag aaggtataaa aaggatgaaa gagtttattg atatgttgat gacacctga 37 DNA Artificial primer9 aaccat atgccagtag atgatttttc cctttcg 37 NA Artificial primercgaattctc aggtgtcatcaacatatcaa taaac 35

* * * * *