STATEMENT ASTO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

Not applicable.

FIELD OF THE INVENTION

The present invention relates to regulation of cellular proliferation. More particularly, the present invention is directed to nucleic acids encoding MRE11, which is a protein involved in modulation of cellular proliferation. The inventionfurther relates to methods for identifying and using agents, including small molecule chemical compositions, antibodies, peptides, cyclic peptides, nucleic acids, antisense nucleic acids, RNAi, and ribozymes, that modulate cellular proliferation viamodulation of MRE11; as well as to the use of expression profiles and compositions in diagnosis and therapy related to modulation of cellular proliferation, e.g., in diseases such as cancer.

BACKGROUND OF THE INVENTION

Double and single-stranded breaks occur in chromosomal DNA during normal cell cycle progression, or after exposure to ionizing regulation or other mutagens, or during homologous recombination. Eukaryotic cells have multiple pathways forrepairing DNA breaks, as chromosomal breaks can be lethal to the cell if they are not repaired. Ends can be repaired by homologous recombination, or by joining of non-homologous ends (see, e.g., Roth et al., Mol. Cell. Biol. 5:2599-2607 (1985); Roth &Wilson, Proc. Nat'l Acad. Sci. USA 82:3355-3359 (1985)). Enzymes involved in such pathways have been implicated in diseases related to cellular proliferation, such as cancer. Thus, there is a need to establish screening assays for understandinghuman diseases caused by disruption of DNA repair pathways. Identifying proteins, their ligands and substrates, and downstream signal transduction pathways involved in neoplasia in humans is important for developing therapeutic regents to treat cancerand other proliferative diseases.

BRIEF SUMMARY OF THE INVENTION

The present invention therefore provides nucleic acids encoding meiotic recombination 11 (MRE11), which is a nuclease protein with exo- and endonuclease activity involved in modulation of DNA damage assessment and checkpoint regulation, andcellular proliferation. The present invention shows for the first time that mutant MRE11 is antiproliferative in tumor cells. The invention therefore provides methods of screening for compounds, e.g., small organic molecules, antibodies, peptides,cyclic peptides, nucleic acids, antisense molecules, RNAi, and ribozyme, that are capable of modulating cellular proliferation, e.g., either inhibiting cellular proliferation or activating apoptosis. The compounds of the invention are also useful forenhancing sensitivity of a cell to chemotherapeutic agents such as bleomycin and etoposide, and/or to reducing toxicity of chemotherapeutic agents. Therapeutic and diagnostic methods and reagents are also provided. Modulators of MRE11 are thereforeuseful in treatment of cancer, inflammation, and other diseases involving cellular proliferation.

In one aspect, the present invention provides a method for identifying a compound capable of interfering with binding of an MRE11 polypeptide or fragment thereof, the method comprising the steps of: (i) combining an MRE11 polypeptide or fragmentthereof with a polypeptide selected from the group consisting of RAD50 and NSB1, and the compound, wherein the MRE11 polypeptide or fragment thereof has nuclease activity and is encoded by a nucleic acid that hybridizes under stringent conditions to anucleic acid encoding a polypeptide having an amino acid sequence of SEQ ID NO:2; and (ii) determining the binding of the MRE11 polypeptide or fragment thereof to a polypeptide selected from the group consisting of RAD50 and NBS1.

In one embodiment, the MRE11 polypeptide or fragment thereof and the RAD50 or NSB1 polypeptide are combined first. In another embodiment, the MRE11 polypeptide or fragment thereof and the RAD50 and NSB1 polypeptide are combined. In anotherembodiment, the MRE11 polypeptide or fragment thereof and the RAD50 or NSB1 polypeptide are expressed in a cell, e.g., a mammalian cell or a yeast cell. In another embodiment, the MRE11 polypeptide or fragment thereof is fused to a heterologouspolypeptide. In another embodiment, the binding of the MRE11 polypeptide or fragment thereof to RAD50 or NSB1 is determined by measuring reporter gene expression.

In another aspect, the present invention provides a method for identifying a compound that modulates cellular proliferation or chemosensitivity, the method comprising the steps of: (i) contacting the compound with an MRE11 polypeptide, thepolypeptide encoded by a nucleic acid that hybridizes under stringent conditions to a nucleic acid encoding a polypeptide having an amino acid sequence of SEQ ID NO:2; and (ii) determining the functional effect of the compound upon the MRE11 polypeptide.

In one embodiment, the functional effect is measured in vitro. In another embodiment, the polypeptide is expressed in a eukaryotic host. In another embodiment, the functional effect is a physical effect, e.g., ligand or substrate binding. Inanother embodiment, the functional effect is a chemical effect, e.g., enzymatic activity such as endo- or exo-nuclease activity. In another embodiment, the chemical or phenotypic effect is determined by measuring cellular proliferation, e.g., bymeasuring DNA synthesis or fluorescent marker dilution. In another embodiment, DNA synthesis is measured by .sup.3H thymidine incorporation, BrdU incorporation, or Hoescht staining. In another embodiment, the fluorescent marker is selected from thegroup consisting of a cell tracker dye or green fluorescent protein.

In another embodiment, modulation is inhibition of cellular proliferation, e.g., cancer cell proliferation. In another embodiment, modulation is activating sensitivity to chemotherapeutic reagents, e.g., cancer cell sensitivity tochemotherapeutic reagents. In another embodiment, the host cell is a cancer cell, e.g., a breast, prostate, colon, or lung cancer cell. In another embodiment, the cancer cell is a transformed cell line, e.g., PC3, HI299, MDA-MB-231, MCF7, A549, orHeLa. In another embodiment, the cancer cell is p53 null, p53 mutant, or p53 wild-type. In another embodiment, the cancer cell is treated with bleomycin or etoposide.

In another embodiment, the polypeptide is recombinant. In another embodiment, the polypeptide is encoded by a nucleic acid having a sequence of SEQ ID NO:1. In another embodiment, the compound is an antibody, antisense oligonucleotide, smallorganic compound, peptide, or circular peptide.

In another aspect, the present invention provides a method for identifying a compound that modulates cellular proliferation or chemosensitivity, the method comprising the steps of: (i) contacting the compound with an MRE11 polypeptide or afragment thereof, the MRE11 polypeptide or fragment thereof encoded by a nucleic acid that hybridizes under stringent conditions to a nucleic acid encoded by a polypeptide comprising an amino acid sequence of SEQ ID NO:2; (ii) determining the physicaleffect of the compound upon the MRE11 polypeptide; and (iii) determining the chemical or phenotypic effect of the compound upon a cell comprising an MRE11 polypeptide or fragment thereof, thereby identifying a compound that modulates cellularproliferation or chemosensitivity.

In another aspect, the present invention provides a method of modulating cellular proliferation in a subject, the method comprising the step of administering to the subject a therapeutically effective amount of a compound identified using themethods described above.

In one embodiment, the subject is a human. In another embodiment, the subject has cancer.

In another aspect, the present invention provides a method of modulating cellular proliferation in a subject, the method comprising the step of administering to the subject a therapeutically effective amount of a MRE11 polypeptide, thepolypeptide encoded by a nucleic acid that hybridizes under stringent conditions to a nucleic acid encoding a polypeptide having an amino acid sequence of SEQ ID NO:2.

In another aspect, the present invention provides a method of modulating cellular proliferation in a subject, the method comprising the step of administering to the subject a therapeutically effective amount of a nucleic acid encoding a MRE11polypeptide, wherein the nucleic acid hybridizes under stringent conditions to a nucleic acid encoding a polypeptide having an amino acid sequence of SEQ ID NO:2.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows a human nucleotide sequence (SEQ ID NO:1) of MRE11.

FIG. 2 shows a human amino acid sequence (SEQ ID NO:2) of MRE11.

FIG. 3 shows a schematic representation of MRE11 activity.

FIG. 4 shows dominant negative mutants generated for target validation studies. hMRE11=SEQ ID NO:3; SCNMRE11=SEQ ID NO:4; consensus peptides=SEQ ID NOS:5-18.

FIG. 5 shows a representation of the active site of P. furiosus MRE11.

FIGS. 6-7 shows a summary of target validation studies for MRE11.

FIG. 8 shows data demonstrating that overexpression of GFP-fused MRE11 H129N mutant is antiproliferative in A549 tumor cells and HeLa cells.

FIG. 9 shows cell tracker assay data demonstrating that the activity of GFP-fused MRE11 H129N mutant is antiproliferative in A549 tumor cells.

FIG. 10 shows cell tracker assay data demonstrating that the activity of MRE11 H129N mutant using IRES GFP is antiproliferative in A549 tumor cells.

FIG. 11 shows overexpression of GFP-fused MRE11 wild-type and mutants in PC-3 and H1299 cells.

FIG. 12 shows data demonstrating that MRE11 wild type and mutant is not antiproliferative in normal cells.

FIG. 13 shows data demonstrating that no antiproliferative activity of MRE11 wild-type or mutant proteins is detected by the cell tracker assay in normal cells.

FIG. 14 shows overexpression of MRE11 wild-type and mutants is not antiproliferative in normal cells.

FIG. 15 shows MRE11 specific antisense oligo effects in A549 cells.

FIG. 16 shows strategies for assessing chemosensitization using dominant negative studies.

FIG. 17 shows plate based chemosensitization studies of sorted HeLa cells expression GFP-fused wild-type or mutant MRE11.

FIG. 18 shows additional strategies for assessing dominant negative chemosensitization effects.

FIG. 19 shows no selective sensitization of MRE11 wild type or mutant expression A540 tumor cells 48 hours after bleomycin treatment.

FIG. 20 shows that A549 cells expressing MRE11 H217Y mutant fail to recover from bleomycin treatment.

FIG. 21 shows that overexpression of GFP-MRE11 H217Y mutant in A549 tumor cells and HeLa cells enhances sensitivity to bleomycin treatment.

FIG. 22 shows that overexpression of GFP-MRE11 H217Y mutant in normal HMEC cells does not enhance sensitivity to bleomycin treatment.

FIG. 23 shows that depletion of MRE11 is antiproliferative in the hyper-recombinogenic chicken B-cell line DT40 made conditionally null for MRE11.

FIG. 24 shows possible models explaining the antiproliferative and chemosensitization effects of MRE11 inhibition.

FIG. 25 shows that MRE11 may block repair of spontaneous or drug-induced double strand breaks.

FIG. 26 shows that MRE11 inhibition may block the formation of the protective T-loop structure at telomere ends.

FIG. 27 provides a summary of MRE11 activity.

FIG. 28 shows a proposed HTS compatible biochemical assay for MRE11.

FIG. 29 shows an oligonucleotide duplex substrate (SEQ ID NOS:19 and 20) for MRE11 plate-based assay.

FIG. 30 shows a biochemical assay for MRE11 exonuclease activity.

FIG. 31 shows cleavage of double-stranded biotinylated reporter by MRE11.

FIG. 32 shows a picogreen dye assay.

FIG. 33 shows fluorescence quenching assays.

DETAILED DESCRIPTION OF THE INVENTION

Introduction

In mammalian cells, MRE11, RAD50, and NBS1 protein associate with one another in a multiprotein complex involved in the cellular DNA repair response (see, e.g., Petrini, Am. J Hum. Genet. 64:1264-1269 (1999)). MRE11 has endo and exonucleaseactivity, and its crystal structure has been reported using Pyrococcus furiosus MRE11 (see, e.g., Paull & Gellert, Mol. Cell, 1:969-979 (1998); and Hopfner et al., Cell 105:473-485 (2001)). Recent studies have shown that MRE11 is mutated in individualswith ataxiatelangiectasia-like disorder (see, e.g., Stewart et al., Cell 99:577-587 (1999). In addition, in Nijmegen breakage syndrome, a disease characterized by immunodeficiency, genomic instability, and cancer susceptibility, the defective geneproduct p95 associates with MRE11 and RAD50 (see, e.g., Lombard & Guarente, Cancer Res. 60:2331-2334 (2000)). Finally, studies have found occasional MRE11 mutations in some primary tumors (see, e.g., Fukuda et al., Cancer Res. 61:23-26 (2001)). However, MRE11 involvement in transformation and tumorigenesis has never been demonstrated. The present invention demonstrates for the first time that inhibition of MRE11 is antiproliferative in tumor cells, and demonstrates a role for MRE11 in cellularproliferation, transformation, and enhancement of sensitivity to chemotherapeutic reagents.

As described below, the present inventors identified MRE11 in a yeast two hybrid assay, using PCNA as bait. Another molecule, NBS1, was identified in the two-hybrid assay as a PCNA-binding protein, as NBS1 binds the mammalian homolog of yeastRAD50, which also binds to MRE11 (see, e.g., Petrini, Am. J Hum. Genet. 64:1264-1269 (1999); Kim et al., J. Biol. Chem. 271:29255-29264 (1996); see also GenBank Accession number XP.sub.--034864 for a protein sequence of human RAD50 and Accessionnumber XM.sub.--034864 for a nucleic acid sequence of human RAD50; see also Example 1)). NBS1 therefore bound to the RAD50/MRE11 complex, as well as to PCNA. As shown in FIGS. 8-15, inhibition of MRE11 or overexpression of an MRE11 mutant isantiproliferative in tumor cells and HeLa cells but not in normal cells (using, e.g., GFP positivity assays, cell tracker assays, and antisense assays). FIGS. 16-22 demonstrate that overexpression of an MRE11 mutant enhances sensitivity tochemotherapeutic reagents in tumor cells. These functional studies, presented herein, demonstrate, e.g., that inhibition of MRE11 will inhibit tumor cell growth and enhance chemosensitivity to compounds such as bleomycin and etoposide.

MRE11 therefore represents a drug target for compounds that suppress or activate cellular proliferation, or cause cell cycle arrest, cause release from cell cycle arrest, increase sensitivity to chemotherapeutic reagents such as bleomycin andetoposide, and decrease toxicity of chemotherapeutic reagents. Agents identified in these assays, including small organic molecules, antibodies, peptides, cyclic peptides, nucleic acids, antisense nucleic acids, RNAi, and ribozymes, that modulatecellular proliferation via modulation of MRE11, can be used to treat diseases related to cellular proliferation, such as cancer and inflammation. In particular, inhibitors of MRE11 are useful for inhibition of cancer and tumor cell growth. MRE11activators can also be used to induce apoptosis. MRE11 modulators can also be used to modulate the sensitivity of cells to chemotherapeutic agents, such as bleomycin and etoposide, and other agents known to those of skill in the art. MRE11 modulatorscan also be used to decrease toxicity of such chemotherapeutic reagents.

Such modulators are useful for treating cancers, such as melanoma, breast, ovarian, lung, gastrointestinal and colon, prostate, and leukemia and lymphomas, e.g., multiple myeloma. In addition, such modulators are useful for treating noncancerousdisease states caused by pathologically proliferating cells such as thyroid hyperplasia (Grave's disease), inflammation, psoriasis, benign prostatic hypertrophy, neurofibromas, atherosclerosis, restenosis, and other vasoproliferative disease.

Definitions

By "disorder associated with cellular proliferation" or "disease associated with cellular proliferation" herein is meant a disease state which is marked by either an excess or a deficit of cellular proliferation. Such disorders associated withincreased cellular proliferation include, but are not limited to, cancer and non-cancerous pathological proliferation.

The terms "MRE11" or a nucleic acid encoding "MRE11" refer to nucleic acids and polypeptide polymorphic variants, alleles, mutants, and interspecies homologs that:

(1) have an amino acid sequence that has greater than about 60% amino acid sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater amino acid sequence identity, preferably over a regionof over a region of at least about 25, 50, 100, 200, 500, 1000, or more amino acids, to an amino acid sequence encoded by an MRE11 nucleic acid (for a human MRE11 nucleic acid sequence, see, e.g., FIG. 1, SEQ ID NO:1, or Accession number NM.sub.--005591)or amino acid sequence of an MRE11 protein (for a human MRE11 protein sequence, see, e.g., FIG. 2, SEQ ID NO:2 or Accession number NP.sub.--005582); (2) bind to antibodies, e.g., polyclonal antibodies, raised against an immunogen comprising an amino acidsequence of an MRE11 protein, and conservatively modified variants thereof; (3) specifically hybridize under stringent hybridization conditions to an anti-sense strand corresponding to a nucleic acid sequence encoding an MRE11 protein, and conservativelymodified variants thereof; (4) have a nucleic acid sequence that has greater than about 95%, preferably greater than about 96%, 97%, 98%, 99%, or higher nucleotide sequence identity, preferably over a region of at least about 25, 50, 100, 200, 500, 1000,or more nucleotides, to an MRE11 nucleic acid. A polynucleotide or polypeptide sequence is typically from a mammal including, but not limited to, primate, e.g., human; rodent, e.g., rat, mouse, hamster; cow, pig, horse, sheep, or any mammal. Thenucleic acids and proteins of the invention include both naturally occurring or recombinant molecules. A MRE11 protein typically has nuclease activity, e.g., endonuclease and/or exonuclease activity.

The phrase "functional effects" in the context of assays for testing compounds that modulate activity of an MRE11 protein includes the determination of a parameter that is indirectly or directly under the influence of an MRE11, e.g., an indirect,phenotypic or chemical effect, such as the ability to increase or decrease cellular proliferation, apoptosis, DNA repair, homologous recombination, cell cycle arrest, or nuclease activity; or e.g., a direct, physical effect such as ligand or substratebinding or inhibition of ligand or substrate binding. A functional effect therefore includes ligand binding activity, substrate binding activity, the ability of cells to proliferate, apoptosis, and enzyme activity, such as endo- and exo-nucleaseactivity. "Functional effects" include in vitro, in vivo, and ex vivo activities. FIGS. 28 and 30-33 shows examples of biochemical high throughput assays that measure enzymatic activity.

By "determining the functional effect" is meant assaying for a compound that increases or decreases a parameter that is indirectly or directly under the influence of an MRE11 protein, e.g., measuring physical and chemical or phenotypic effects. Such functional effects can be measured by any means known to those skilled in the art, e.g., changes in spectroscopic characteristics (e.g., fluorescence, absorbance, refractive index); hydrodynamic (e.g., shape); chromatographic; or solubilityproperties for the protein; measuring inducible markers or transcriptional activation of the protein; measuring binding activity or binding assays, e.g. binding to antibodies; measuring changes in ligand or substrate binding activity; measuring cellularproliferation; measuring apoptosis; measuring cell surface marker expression; measurement of changes in protein levels for MRE11 associated sequences; measurement of RNA stability; phosphorylation or dephosphorylation; nuclease activity; identificationof downstream or reporter gene expression (CAT, luciferase, .beta.-gal, GFP and the like), e.g., via chemiluminescence, fluorescence, colorimetric reactions, antibody binding, and inducible markers.

"Inhibitors", "activators", and "modulators" of MRE11 polynucleotide and polypeptide sequences are used to refer to activating, inhibitory, or modulating molecules identified using in vitro and in vivo assays of MRE11 polynucleotide andpolypeptide sequences. Inhibitors are compounds that, e.g., bind to, partially or totally block activity, decrease, prevent, delay activation, inactivate, desensitize, or down regulate the activity or expression of MRE11 proteins, e.g., antagonists. "Activators" are compounds that increase, open, activate, facilitate, enhance activation, sensitize, agonize, or up regulate MRE11 protein activity, e.g., agonists. Inhibitors, activators, or modulators also include genetically modified versions ofMRE11 proteins, e.g., versions with altered activity, as well as naturally occurring and synthetic ligands, substrates, antagonists, agonists, antibodies, peptides, cyclic peptides, nucleic acids, antisense molecules, ribozymes, RNAi, small chemicalmolecules and the like. Such assays for inhibitors and activators include, e.g., expressing MRE11 protein in vitro, in cells, or cell membranes, applying putative modulator compounds, and then determining the functional effects on activity, as describedabove.

Samples or assays comprising MRE11 proteins that are treated with a potential activator, inhibitor, or modulator are compared to control samples without the inhibitor, activator, or modulator to examine the extent of inhibition. Control samples(untreated with inhibitors) are assigned a relative protein activity value of 100%. Inhibition of MRE11 is achieved when the activity value relative to the control is about 80%, preferably 50%, more preferably 25-0%. Activation of MRE11 is achievedwhen the activity value relative to the control (untreated with activators) is 110%, more preferably 150%, more preferably 200-500% (i.e., two to five fold higher relative to the control), more preferably 1000-3000% higher.

The term "test compound" or "drug candidate" or "modulator" or grammatical equivalents as used herein describes any molecule, either naturally occurring or synthetic, e.g., protein, oligopeptide (e.g., from about 5 to about 25 amino acids inlength, preferably from about 10 to 20 or 12 to 18 amino acids in length, preferably 12, 15, or 18 amino acids in length), small organic molecule, polysaccharide, lipid, fatty acid, polynucleotide, oligonucleotide, etc., to be tested for the capacity todirectly or indirectly modulation tumor cell proliferation. The test compound can be in the form of a library of test compounds, such as a combinatorial or randomized library that provides a sufficient range of diversity. Test compounds are optionallylinked to a fusion partner, e.g., targeting compounds, rescue compounds, dimerization compounds, stabilizing compounds, addressable compounds, and other functional moieties. Conventionally, new chemical entities with useful properties are generated byidentifying a test compound (called a "lead compound") with some desirable property or activity, e.g., inhibiting activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds. Often, highthroughput screening (HTS) methods are employed for such an analysis.

A "small organic molecule" refers to an organic molecule, either naturally occurring or synthetic, that has a molecular weight of more than about 50 daltons and less than about 2500 daltons, preferably less than about 2000 daltons, preferablybetween about 100 to about 1000 daltons, more preferably between about 200 to about 500 daltons.

"Biological sample" include sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histologic purposes. Such samples include blood, sputum, tissue, cultured cells, e.g., primary cultures, explants, and transformedcells, stool, urine, etc. A biological sample is typically obtained from a eukaryotic organism, most preferably a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; orfish.

The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues ornucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region (e.g., nucleotide sequence SEQ ID NO:1 or amino acid sequence SEQ IDNO:2), when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visualinspection (see, e.g., NCBI web site http://www.ncbi.nlm.nih.gov/BLAST/ or the like). Such sequences are then said to be "substantially identical." This definition also refers to, or may be applied to, the compliment of a test sequence. The definitionalso includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.

For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates aredesignated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequenceidentities for the test sequences relative to the reference sequence, based on the program parameters.

A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 inwhich a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment ofsequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similaritymethod of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr.,Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 supplement)).

A preferred example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschulet al., J. Mol. Biol. 215:403-410 (1990), respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention. Software for performing BLASTanalyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the querysequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initialneighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores arecalculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate thecumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one ormore negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults awordlength (W) of 11, an expectation (E) of 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff &Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.

The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of acorresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.

The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids arethose encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, .gamma.-carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as anaturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g.,norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure ofan amino acid, but that functions in a manner similar to a naturally occurring amino acid.

Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonlyaccepted single-letter codes.

"Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentiallyidentical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any givenprotein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering theencoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of thenucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identicalmolecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide is implicit in each described sequence with respect to the expression product, but not with respect to actual probe sequences.

As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage ofamino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar aminoacids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.

The following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5)Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).

Macromolecular structures such as polypeptide structures can be described in terms of various levels of organization. For a general discussion of this organization, see, e.g., Alberts et al., Molecular Biology of the Cell (3.sup.rd ed., 1994)and Cantor and Schimmel, Biophysical Chemistry Part I: The Conformation of Biological Macromolecules (1980). "Primary structure" refers to the amino acid sequence of a particular peptide. "Secondary structure" refers to locally ordered, threedimensional structures within a polypeptide. These structures are commonly known as domains, e.g., enzymatic domains, extracellular domains, transmembrane domains, pore domains, and cytoplasmic tail domains. Domains are portions of a polypeptide thatform a compact unit of the polypeptide and are typically 15 to 350 amino acids long. Exemplary domains include domains with enzymatic activity, e.g., a nuclease domain. Typical domains are made up of sections of lesser organization such as stretches of.eta.-sheet and .alpha.-helices. "Tertiary structure" refers to the complete three dimensional structure of a polypeptide monomer. "Quaternary structure" refers to the three dimensional structure formed by the noncovalent association of independenttertiary units. Anisotropic terms are also known as energy terms.

A particular nucleic acid sequence also implicitly encompasses "splice variants." Similarly, a particular protein encoded by a nucleic acid implicitly encompasses any protein encoded by a splice variant of that nucleic acid. "Splice variants,"as the name suggests, are products of alternative splicing of a gene. After transcription, an initial nucleic acid transcript may be spliced such that different (alternate) nucleic acid splice products encode different polypeptides. Mechanisms for theproduction of splice variants vary, but include alternate splicing of exons. Alternate polypeptides derived from the same nucleic acid by read-through transcription are also encompassed by this definition. Any products of a splicing reaction, includingrecombinant forms of the splice products, are included in this definition.

A "label" or a "detectable moiety" is a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include .sup.32P, fluorescent dyes, electron-densereagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and proteins which can be made detectable, e.g., by incorporating a radiolabel into the peptide or used to detect antibodies specifically reactive with the peptide.

The term "recombinant" when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein orthe alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (nonrecombinant) form of the cell or express native genesthat are otherwise abnormally expressed, under expressed or not expressed at all.

The term "heterologous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, the nucleic acidis typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous protein indicatesthat the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).

The phrase "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions aresequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and MolecularBiology--Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5-10.degree. C. lower than the thermal melting point(T.sub.m) for the specific sequence at a defined ionic strength pH. The T.sub.m is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence atequilibrium (as the target sequences are present in excess, at T.sub.m, 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specifichybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as following: 50% formamide, 5.times.SSC, and 1% SDS, incubating at 42.degree. C., or,5.times.SSC, 1% SDS, incubating at 65.degree. C., with wash in 0.2.times.SSC, and 0.1% SDS at 65.degree. C.

Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is createdusing the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions. Exemplary "moderately stringent hybridization conditions" include ahybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in 1.times.SSC at 45.degree. C. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize that alternativehybridization and wash conditions can be utilized to provide conditions of similar stringency. Additional guidelines for determining hybridization parameters are provided in numerous reference, e.g., and Current Protocols in Molecular Biology, ed. Ausubel, et al.

For PCR, a temperature of about 36.degree. C. is typical for low stringency amplification, although annealing temperatures may vary between about 32.degree. C. and 48.degree. C. depending on primer length. For high stringency PCRamplification, a temperature of about 62.degree. C. is typical, although high stringency annealing temperatures can range from about 50.degree. C. to about 65.degree. C., depending on the primer length and specificity. Typical cycle conditions forboth high and low stringency amplifications include a denaturation phase of 90.degree. C.-95.degree. C. for 30 sec-2 min., an annealing phase lasting 30 sec.-2 min., and an extension phase of about 72.degree. C. for 1-2-5 min. Protocols and guidelinesfor low and high stringency amplification reactions are provided, e.g., in Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y.).

"Antibody" refers to a polypeptide comprising a framework region from an immunoglobulin gene or fragments thereof that specifically binds and recognizes an antigen. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma,delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn definethe immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. Typically, the antigen-binding region of an antibody will be most critical in specificity and affinity of binding.

An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kD) and one "heavy" chain (about 50-70 kD). TheN-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (V.sub.L) and variable heavy chain (V.sub.H) refer to these light and heavy chainsrespectively.

Antibodies exist, e.g., as intact immunoglobulins or as a number of well-characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region toproduce F(ab)'.sub.2, a dimer of Fab which itself is a light chain joined to V.sub.H-C.sub.H1 by a disulfide bond. The F(ab)'.sub.2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting theF(ab)'.sub.2 dimer into an Fab' monomer. The Fab' monomer is essentially Fab with part of the hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993). While various antibody fragments are defined in terms of the digestion of an intactantibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, also includes antibody fragments either produced by themodification of whole antibodies, or those synthesized de novo using recombinant DNA methodologies (e.g., single chain Fv) or those identified using phage display libraries (see, e.g., McCafferty et al., Nature 348:552-554 (1990))

For preparation of antibodies, e.g., recombinant, monoclonal, or polyclonal antibodies, many technique known in the art can be used (see, e.g., Kohler & Milstein, Nature 256:495-497 (1975); Kozbor et al., Immunology Today 4: 72 (1983); Cole etal., pp. 77-96 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985); Coligan, Current Protocols in Immunology (1991); Harlow & Lane, Antibodies, A Laboratory Manual (1988); and Goding, Monoclonal Antibodies: Principles and Practice(2d ed. 1986)). The genes encoding the heavy and light chains of an antibody of interest can be cloned from a cell, e.g., the genes encoding a monoclonal antibody can be cloned from a hybridoma and used to produce a recombinant monoclonal antibody. Gene libraries encoding heavy and light chains of monoclonal antibodies can also be made from hybridoma or plasma cells. Random combinations of the heavy and light chain gene products generate a large pool of antibodies with different antigenicspecificity (see, e.g., Kuby, Immunology (3.sup.rd ed. 1997)). Techniques for the production of single chain antibodies or recombinant antibodies (U.S. Pat. No. 4,946,778, U.S. Pat. No. 4,816,567) can be adapted to produce antibodies topolypeptides of this invention. Also, transgenic mice, or other organisms such as other mammals, may be used to express humanized or human antibodies (see, e.g., U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, Markset al., Bio/Technology 10:779-783 (1992); Lonberg et al., Nature 368:856-859 (1994); Morrison, Nature 368:812-13 (1994); Fishwild et al., Nature Biotechnology 14:845-51 (1996); Neuberger, Nature Biotechnology 14:826 (1996); and Lonberg & Huszar, Intern. Rev. Immunol. 13:65-93 (1995)). Alternatively, phage display technology can be used to identify antibodies and heteromeric Fab fragments that specifically bind to selected antigens (see, e.g., McCafferty et al., Nature 348:552-554 (1990); Marks etal., Biotechnology 10:779-783 (1992)). Antibodies can also be made bispecific, i.e., able to recognize two different antigens (see, e.g., WO 93/08829, Traunecker et al., EMBO J. 10:3655-3659 (1991); and Suresh et al., Methods in Enzymology 121:210(1986)). Antibodies can also be heteroconjugates, e.g., two covalently joined antibodies, or immunotoxins (see, e.g., U.S. Pat. No. 4,676,980, WO 91/00360; WO 92/200373; and EP 03089).

Methods for humanizing or primatizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residuesare often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers (see, e.g., Jones et al., Nature 321:522-525 (1986); Riechmann etal., Nature 332:323-327 (1988); Verhoeyen et al., Science 239:1534-1536 (1988) and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, suchhumanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies aretypically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.

A "chimeric antibody" is an antibody molecule in which (a) the constant region, or a portion thereof, is altered, replaced or exchanged so that the antigen binding site (variable region) is linked to a constant region of a different or alteredclass, effector function and/or species, or an entirely different molecule which confers new properties to the chimeric antibody, e.g., an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, is altered,replaced or exchanged with a variable region having a different or altered antigen specificity.

In one embodiment, the antibody is conjugated to an "effector" moiety. The effector moiety can be any number of molecules, including labeling moieties such as radioactive labels or fluorescent labels, or can be a therapeutic moiety. In oneaspect the antibody modulates the activity of the protein.

The phrase "specifically (or selectively) binds" to an antibody or "specifically (or selectively) immunoreactive with," when referring to a protein or peptide, refers to a binding reaction that is determinative of the presence of the protein,often in a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein at least two times the background and more typically more than 10 to 100 timesbackground. Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular protein. For example, polyclonal antibodies raised to a MRE11 protein, polymorphic variants, alleles,orthologs, and conservatively modified variants, or splice variants, or portions thereof, can be selected to obtain only those polyclonal antibodies that are specifically immunoreactive with MRE11 proteins and not with other proteins. This selection maybe achieved by subtracting out antibodies that cross-react with other molecules. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays areroutinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Antibodies, A Laboratory Manual (1988) for a description of immunoassay formats and conditions that can be used to determine specificimmunoreactivity).

By "therapeutically effective dose" herein is meant a dose that produces effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques(see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); and Pickar, Dosage Calculations (1999)).

Assays for Protiens that Modulation Cellular Proliferarion

High throughput functional genomics assays can be used to identify modulators of cellular proliferation. Such assays can monitor changes in cell surface marker expression, proliferation and differentiation, and apoptosis, using either cell linesor primary cells. Typically, the cells are contacted with a cDNA or a random peptide library (encoded by nucleic acids). In one embodiment, the peptides are cyclic or circular. The cDNA library can comprise sense, antisense, full length, and truncatedcDNAs. The peptide library is encoded by nucleic acids. The effect of the cDNA or peptide library on the phenotype of cellular proliferation is then monitored, using an assay as described above. The effect of the cDNA or peptide can be validated anddistinguished from somatic mutations, using, e.g., regulatable expression of the nucleic acid such as expression from a tetracycline promoter. cDNAs and nucleic acids encoding peptides can be rescued using techniques known to those of skill in the art,e.g., using a sequence tag.

Proteins interacting with the peptide or with the protein encoded by the cDNA (e.g., MRE11) can be isolated using a yeast two-hybrid system, mammalian two hybrid system, immunoprecipitation or affinity chromatography of complexed proteinsfollowed by mass spectrometry, or phage display screen, etc. Targets so identified can be further used as bait in these assays to identify additional members of the cellular proliferation pathway, which members are also targets for drug development (see,e.g., Fields et al., Nature 340:245 (1989); Vasavada et al., Proc. Nat'l Acad. Sci. USA 88:10686 (1991); Fearon et al., Proc. Nat'l Acad. Sci. USA 89:7958 (1992); Dang et al., Mol. Cell. Biol. 11:954 (1991); Chien et al., Proc. Nat'l Acad. Sci. USA 9578 (1991); and U.S. Pat. Nos. 5,283,173, 5,667,973, 5,468,614, 5,525,490, and 5,637,463).

Suitable cell lines include A549, HeLa, Jurkat, BJAB, Colo205, H1299, MCF7, MDA-MB-231, PC3, HUMEC, HUVEC, and PrEC. Cell surface markers can be assayed using fluorescently labeled antibodies and FACS. Cell proliferation can be measured using.sup.3H-thymidine, MTT assay, BrdU incorporation, cell tracker assay, cell count, AlmarBlue assay, or dye inclusion. Apoptosis can be measured using dye inclusion, or by assaying for DNA laddering, increases in intracellular calcium, or caspaseactivation assay Growth factor production can be measured using an immunoassay such as ELISA.

cDNA libraries are made from any suitable source. Libraries encoding random peptides are made according to techniques well known to those of skill in the art (see, e.g., U.S. Pat. Nos. 6,153,380, 6,114,111, and 6,180,343). Any suitablevector can be used for the cDNA and peptide libraries, including, e.g., retroviral vectors.

Isolation of Nucleic Acids Encoding MRE11 Family Members

This invention relies on routine techniques in the field of recombinant genetics. Basic texts disclosing the general methods of use in this invention include Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed. 1989); Kriegler, GeneTransfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et al., eds., 1994)).

MRE11 nucleic acids, polymorphic variants, orthologs, and alleles that are substantially identical to an amino acid sequence encoded by SEQ ID NO:2 can be isolated using MRE11 nucleic acid probes and oligonucleotides under stringent hybridizationconditions, by screening libraries. Alternatively, expression libraries can be used to clone MRE11 protein, polymorphic variants, orthologs, and alleles by detecting expressed homologs immunologically with antisera or purified antibodies made againsthuman MRE11 or portions thereof.

To make a cDNA library, one should choose a source that is rich in MRE11 RNA. The mRNA is then made into cDNA using reverse transcriptase, ligated into a recombinant vector, and transfected into a recombinant host for propagation, screening andcloning. Methods for making and screening cDNA libraries are well known (see, e.g., Gubler & Hoffman, Gene 25:263-269 (1983); Sambrook et al., supra; Ausubel et al., supra).

For a genomic library, the DNA is extracted from the tissue and either mechanically sheared or enzymatically digested to yield fragments of about 12-20 kb. The fragments are then separated by gradient centrifugation from undesired sizes and areconstructed in bacteriophage lambda vectors. These vectors and phage are packaged in vitro. Recombinant phage are analyzed by plaque hybridization as described in Benton & Davis, Science 196:180-182 (1977). Colony hybridization is carried out asgenerally described in Grunstein et al., Proc. Natl. Acad. Sci. USA., 72:3961-3965 (1975).

An alternative method of isolating MRE11 nucleic acid and its orthologs, alleles, mutants, polymorphic variants, and conservatively modified variants combines the use of synthetic oligonucleotide primers and amplification of an RNA or DNAtemplate (see U.S. Pat. Nos. 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., eds, 1990)). Methods such as polymerase chain reaction (PCR) and ligase chain reaction (LCR) can be used to amplify nucleic acidsequences of human MRE11 directly from MRNA, from cDNA, from genomic libraries or cDNA libraries. Degenerate oligonucleotides can be designed to amplify MRE11 homologs using the sequences provided herein. Restriction endonuclease sites can beincorporated into the primers. Polymerase chain reaction or other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes fordetecting the presence of MRE11 encoding mRNA in physiological samples, for nucleic acid sequencing, or for other purposes. Genes amplified by the PCR reaction can be purified from agarose gels and cloned into an appropriate vector.

Gene expression of MRE11 can also be analyzed by techniques known in the art, e.g., reverse transcription and amplification of mRNA, isolation of total RNA or poly A.sup.+ RNA, northern blotting, dot blotting, in situ hybridization, RNaseprotection, high density polynucleotide array technology, e.g., and the like.

Nucleic acids encoding MRE11 protein can be used with high density oligonucleotide array technology (e.g., GeneChip.TM.) to identify MRE11 protein, orthologs, alleles, conservatively modified variants, and polymorphic variants in this invention. In the case where the homologs being identified are linked to modulation of cellular proliferation, they can be used with GeneChip.TM. as a diagnostic tool in detecting the disease in a biological sample, see, e.g., Gunthand et al., AIDS Res. Hum. Retroviruses 14: 869-876 (1998); Kozal et al., Nat. Med. 2:753-759 (1996); Matson et al., Anal. Biochem. 224:110-106 (1995); Lockhart et al., Nat. Biotechnol. 14:1675-1680 (1996); Gingeras et al., Genome Res. 8:435-448 (1998); Hacia et al., NucleicAcids Res. 26:3865-3866 (1998).

The gene for MRE11 is typically cloned into intermediate vectors before transformation into prokaryotic or eukaryotic cells for replication and/or expression. These intermediate vectors are typically prokaryote vectors, e.g., plasmids, orshuttle vectors.

Expression in Prokaryotes and Eukaryotes

To obtain high level expression of a cloned gene, such as those cDNAs encoding MRE11, one typically subclones MRE11 into an expression vector that contains a strong promoter to direct transcription, a transcription/translation terminator, and iffor a nucleic acid encoding a protein, a ribosome binding site for translational initiation. Suitable bacterial promoters are well known in the art and described, e.g., in Sambrook et al., and Ausubel et al, supra. Bacterial expression systems forexpressing the MRE11 protein are available in, e.g., E. coli, Bacillus sp., and Salmonella (Palva et al., Gene 22:229-235 (1983); Mosbach et al., Nature 302:543-545 (1983). Kits for such expression systems are commercially available. Eukaryoticexpression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available. In one preferred embodiment, retroviral expression systems are used in the present invention.

Selection of the promoter used to direct expression of a heterologous nucleic acid depends on the particular application. The promoter is preferably positioned about the same distance from the heterologous transcription start site as it is fromthe transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

In addition to the promoter, the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the MRE11 encoding nucleic acid in host cells. A typicalexpression cassette thus contains a promoter operably linked to the nucleic acid sequence encoding MRE11 and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. Additional elements ofthe cassette may include enhancers and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.

In addition to a promoter sequence, the expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same geneas the promoter sequence or may be obtained from different genes.

The particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard bacterialexpression vectors include plasmids such as pBR322 based plasmids, pSKF, pET23D, and fusion expression systems such as MBP, GST, and LacZ. Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, e.g., c-myc. Sequence tags may be included in an expression cassette for nucleic acid rescue. Markers such as fluorescent proteins, green or red fluorescent protein, .beta.-gal, CAT, and the like can be included in the vectors as markers for vector transduction.

Expression vectors containing regulatory elements from eukaryotic viruses are typically used in eukaryotic expression vectors, e.g., SV40 vectors, papilloma virus vectors, retroviral vectors, and vectors derived from Epstein-Barr virus. Otherexemplary eukaryotic vectors include pMSG, pAV009/A.sup.+, pMTO10/A.sup.+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the CMV promoter, SV40 early promoter, SV40 later promoter,metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.

Expression of proteins from eukaryotic vectors can be also be regulated using inducible promoters. With inducible promoters, expression levels are tied to the concentration of inducing agents, such as tetracycline or ecdysone, by theincorporation of response elements for these agents into the promoter. Generally, high level expression is obtained from inducible promoters only in the presence of the inducing agent; basal expression levels are minimal.

In one embodiment, the vectors of the invention have a regulatable promoter, e.g., tet-regulated systems and the RU-486 system (see, e.g., Gossen & Bujard, PNAS 89:5547 (1992); Oligino et al., Gene Ther. 5:491-496 (1998); Wang et al., Gene Ther. 4:432-441 (1997); Neering et al., Blood 88:1147-1155 (1996); and Rendahl et al., Nat. Biotechnol. 16:757-761 (1998)). These impart small molecule control on the expression of the candidate target nucleic acids. This beneficial feature can be used todetermine that a desired phenotype is caused by a transfected cDNA rather than a somatic mutation.

Some expression systems have markers that provide gene amplification such as thymidine kinase and dihydrofolate reductase. Alternatively, high yield expression systems not involving gene amplification are also suitable, such as using abaculovirus vector in insect cells, with a MRE11 encoding sequence under the direction of the polyhedrin promoter or other strong baculovirus promoters.

The elements that are typically included in expression vectors also include a replicon that functions in E. coli, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sitesin nonessential regions of the plasmid to allow insertion of eukaryotic sequences. The particular antibiotic resistance gene chosen is not critical, any of the many resistance genes known in the art are suitable. The prokaryotic sequences arepreferably chosen such that they do not interfere with the replication of the DNA in eukaryotic cells, if necessary.

Standard transfection methods are used to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of MRE11 protein, which are then purified using standard techniques (see, e.g., Colley et al., J. Biol. Chem.264:17619-17622 (1989); Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher, ed., 1990)). Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, J. Bact. 132:349-351 (1977); Clark-Curtiss & Curtiss, Methods in Enzymology 101:347-362 (Wu et al., eds, 1983).

Any of the well-known procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, biolistics, liposomes,microinjection, plasma vectors, viral vectors and any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al., supra). It is only necessarythat the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing MRE11.

After the expression vector is introduced into the cells, the transfected cells are cultured under conditions favoring expression of MRE11, which is recovered from the culture using standard techniques identified below.

Purifacation of MRE11 Polypeptides

Either naturally occurring or recombinant MRE11 can be purified for use in functional assays. Naturally occurring MRE11 can be purified, e.g., from human tissue. Recombinant MRE11 can be purified from any suitable expression system, such asbacteria, yeast, plants, insects, and mammalian cells.

The MRE11 protein may be purified to substantial purity by standard techniques, including selective precipitation with such substances as ammonium sulfate; column chromatography, immunopurification methods, and others (see, e.g., Scopes, ProteinPurification: Principles and Practice (1982); U.S. Pat. No. 4,673,641; Ausubel et al., supra; and Sambrook et al., supra).

A number of procedures can be employed when recombinant MRE11 protein is being purified. For example, proteins having established molecular adhesion properties can be reversible fused to the MRE11 protein. With the appropriate ligand (e.g.,binding partners such as RAD50 and NBS1) or substrate, MRE11 protein can be selectively adsorbed to a purification column and then freed from the column in a relatively pure form. The fused protein is then removed by enzymatic activity. Finally, MRE11protein could be purified using immunoaffinity columns.

A. Purification of MRE11 from Recombinant Bacteria

Recombinant proteins are expressed by transformed bacteria in large amounts, typically after promoter induction; but expression can be constitutive. Promoter induction with IPTG is one example of an inducible promoter system. Bacteria are grownaccording to standard procedures in the art. Fresh or frozen bacteria cells are used for isolation of protein.

Proteins expressed in bacteria may form insoluble aggregates ("inclusion bodies"). Several protocols are suitable for purification of MRE11 protein inclusion bodies. For example, purification of inclusion bodies typically involves theextraction, separation and/or purification of inclusion bodies by disruption of bacterial cells, e.g., by incubation in a buffer of 50 mM TRIS/HCL pH 7.5, 50 mM NaCl, 5 mM MgCl.sub.2, 1 mM DTT, 0.1 mM ATP, and 1 mM PMSF. The cell suspension can be lysedusing 2-3 passages through a French Press, homogenized using a Polytron (Brinkman Instruments) or sonicated on ice. Alternate methods of lysing bacteria are apparent to those of skill in the art (see, e.g., Sambrook et al., supra; Ausubel et al.,supra).

If necessary, the inclusion bodies are solubilized, and the lysed cell suspension is typically centrifuged to remove unwanted insoluble matter. Proteins that formed the inclusion bodies may be renatured by dilution or dialysis with a compatiblebuffer. Suitable solvents include, but are not limited to urea (from about 4 M to about 8 M), formamide (at least about 80%, volume/volume basis), and guanidine hydrochloride (from about 4 M to about 8 M). Some solvents which are capable ofsolubilizing aggregate-forming proteins, for example SDS (sodium dodecyl sulfate), 70% formic acid, are inappropriate for use in this procedure due to the possibility of irreversible denaturation of the proteins, accompanied by a lack of immunogenicityand/or activity. Although guanidine hydrochloride and similar agents are denaturants, this denaturation is not irreversible and renaturation may occur upon removal (by dialysis, for example) or dilution of the denaturant, allowing re-formation ofimmunologically and/or biologically active protein. Other suitable buffers are known to those skilled in the art. Human MRE11 proteins are separated from other bacterial proteins by standard separation techniques, e.g., with Ni-NTA agarose resin.

Alternatively, it is possible to purify MRE11 protein from bacteria periplasm. After lysis of the bacteria, when the MRE11 protein exported into the periplasm of the bacteria, the periplasmic fraction of the bacteria can be isolated by coldosmotic shock in addition to other methods known to skill in the art. To isolate recombinant proteins from the periplasm, the bacterial cells are centrifuged to form a pellet. The pellet is resuspended in a buffer containing 20% sucrose. To lyse thecells, the bacteria are centrifuged and the pellet is resuspended in ice-cold 5 mM MgSO.sub.4 and kept in an ice bath for approximately 10 minutes. The cell suspension is centrifuged and the supernatant decanted and saved. The recombinant proteinspresent in the supernatant can be separated from the host proteins by standard separation techniques well known to those of skill in the art.

B. Standard Protein Separation Techniques for Purifying MRE11 Proteins

Solubility Fractionation

Often as an initial step, particularly if the protein mixture is complex, an initial salt fractionation can separate many of the unwanted host cell proteins (or proteins derived from the cell culture media) from the recombinant protein ofinterest. The preferred salt is ammonium sulfate. Ammonium sulfate precipitates proteins by effectively reducing the amount of water in the protein mixture. Proteins then precipitate on the basis of their solubility. The more hydrophobic a proteinis, the more likely it is to precipitate at lower ammonium sulfate concentrations. A typical protocol includes adding saturated ammonium sulfate to a protein solution so that the resultant ammonium sulfate concentration is between 20-30%. Thisconcentration will precipitate the most hydrophobic of proteins. The precipitate is then discarded (unless the protein of interest is hydrophobic) and ammonium sulfate is added to the supernatant to a concentration known to precipitate the protein ofinterest. The precipitate is then solubilized in buffer and the excess salt removed if necessary, either through dialysis or diafiltration. Other methods that rely on solubility of proteins, such as cold ethanol precipitation, are well known to thoseof skill in the art and can be used to fractionate complex protein mixtures.

Size Differential Filtration

The molecular weight of the MRE11 proteins can be used to isolate it from proteins of greater and lesser size using ultrafiltration through membranes of different pore size (for example, Amicon or Millipore membranes). As a first step, theprotein mixture is ultrafiltered through a membrane with a pore size that has a lower molecular weight cut-off than the molecular weight of the protein of interest. The retentate of the ultrafiltration is then ultrafiltered against a membrane with amolecular cut off greater than the molecular weight of the protein of interest. The recombinant protein will pass through the membrane into the filtrate. The filtrate can then be chromatographed as described below.

Column Chromatography

The MRE11 proteins can also be separated from other proteins on the basis of its size, net surface charge, hydrophobicity, and affinity for ligands. In addition, antibodies raised against proteins can be conjugated to column matrices and theproteins immunopurified. All of these methods are well known in the art. It will be apparent to one of skill that chromatographic techniques can be performed at any scale and using equipment from many different manufacturers (e.g., Pharmacia Biotech).

Assays for Modulators of MRE11 Protein

A. Assays

Modulation of an MRE11 protein, and corresponding modulation of cellular, e.g., tumor cell, proliferation, can be assessed using a variety of in vitro and in vivo assays, including cell-based models. Such assays can be used to test forinhibitors and activators of MRE11 protein, and, consequently, inhibitors and activators of cellular proliferation, including modulators of chemotherapeutic sensitivity and toxicity. Such modulators of MRE11 protein are useful for treating disordersrelated to pathological cell proliferation, e.g., cancer. Modulators of MRE11 protein are tested using either recombinant or naturally occurring MRE11, preferably human MRE11.

Preferably, the MRE11 protein will have the sequence as encoded by SEQ ID NO:2 or a conservatively modified variant thereof. Alternatively, the MRE11 protein of the assay will be derived from a eukaryote and include an amino acid subsequencehaving substantial amino acid sequence identity to SEQ ID NO:2. Generally, the amino acid sequence identity will be at least 60%, preferably at least 65%, 70%, 75%, 80%, 85%, or 90%, most preferably at least 95%.

Measurement of cellular proliferation modulation with MRE11 protein or a cell expressing MRE11 protein, either recombinant or naturally occurring, can be performed using a variety of assays, in vitro, in vivo, and ex vivo, as described herein. Asuitable physical, chemical or phenotypic change that affects activity, e.g., enzymatic activity (endo- and exonuclease activity for ds and ss nucleic acid), cell proliferation, substrate binding (ds or ss nucleic acid) or ligand binding (e.g., RAD50)can be used to assess the influence of a test compound on the polypeptide of this invention. When the functional effects are determined using intact cells or animals, one can also measure a variety of effects, such as, ligand binding, substrate binding,endonuclease and/or exonuclease activity, transcriptional changes to both known and uncharacterized genetic markers (e.g., northern blots), changes in cell metabolism, changes related to cellular proliferation, cell surface marker expression, DNAsynthesis, marker and dye dilution assays (e.g., GFP and cell tracker assays), contact inhibition, tumor growth in nude mice, etc.

In Vitro Assays

Assays to identify compounds with MRE11 modulating activity can be performed in vitro (e.g., biochemical assays). FIG. 28 shows one example of a high throughput biochemical assay for exonuclease activity (see also FIGS. 29-33). Assays forendonuclease activity are also useful. Enzymatic or biochemical assays include biotinylated substrates non-covalently bound to a plate, and labeled with a fluorescent molecule; measurement of BrdU bound to substrate, using an anti-Brdu-HRP antibody; dyebinding (e.g., picogreen dye); and fluorescence quenching. The MRE11 substrate can be a synthetic or recombinant oligonucleotide or nucleic acid, either single-stranded or double stranded, or DNA from a cell, either single or double stranded. The DNAcan be labeled or unlabeled.

Such assays can used full length MRE11 protein or a variant thereof (see, e.g., SEQ ID NO:2), or a fragment of an MRE11 protein, such as a nuclease domain. Purified recombinant or naturally occurring MRE11 protein can be used in the in vitromethods of the invention. In addition to purified MRE11 protein, the recombinant or naturally occurring MRE11 protein can be part of a cellular lysate, nuclear extract, or a cell membrane.

Ligand and substrate binding assays can also be performed. As described below, the biochemical assay can be either solid state or soluble. For the biochemical assays, the protein, substrate (e.g., ss or ds nucleic acid) or ligand is bound to asolid support, either covalently or non-covalently. Often, the in vitro assays of the invention are ligand binding or ligand affinity assays, either non-competitive or competitive (with a ligand such as RAD50 or NBS1), or substrate binding and enzymaticactivity assays, such as endo- and exo-nuclease assays. Other in vitro assays include measuring changes in spectroscopic (e.g., fluorescence, absorbance, refractive index), hydrodynamic (e.g., shape), chromatographic, or solubility properties for theprotein.

In one embodiment, a high throughput assay is performed in which the MRE11 protein or a fragment thereof in the biochemical assay is contacted with a potential modulator and incubated for a suitable amount of time, e.g., with. In one embodiment,the potential modulator is bound to a solid support, and the MRE11 protein is added. In another embodiment, the MRE11 protein is bound to a solid support. A wide variety of modulators can be used, as described below, including small organic molecules,peptides, antibodies, and MRE11 ligand analogs. A wide variety of assays can be used to identify MRE11-modulator binding, including enzymatic activity assays (endo- or exonuclease assays) labeled protein-protein binding assays, electrophoretic mobilityshifts, immunoassays, and the like.

In some cases, the binding of the candidate modulator is determined through the use of competitive binding assays, where interference with binding of a known ligand or substrate is measured in the presence of a potential modulator. Either themodulator or the known ligand is bound first, and then the competitor is added. After the MRE11 protein is washed, interference with binding, either of the potential modulator or of the known ligand, is determined. Often, either the potential modulatoror the known ligand is labeled.

Cell-based in Vivo Assays

In another embodiment, MRE11 protein is expressed in a cell, and functional, e.g., physical and chemical or phenotypic, changes are assayed to identify MRE11 and modulators of cellular proliferation, e.g., tumor cell proliferation. Cellsexpressing MRE11 proteins can also be used in binding assays and enzymatic assays. Any suitable functional effect can be measured, as described herein. For example, cellular morphology (e.g., cell volume, nuclear volume, cell perimeter, and nuclearperimeter), ligand binding, substrate binding, nuclease activity, apoptosis, cell surface marker expression, cellular proliferation, GFP positivity and dye dilution assays (e.g., cell tracker assays with dyes that bind to cell membranes), DNA synthesisassays (e.g., .sup.3H-thymidine and fluorescent DNA-binding dyes such as BrdU or Hoescht dye with FACS analysis) and nuclear foci assays, are all suitable assays to identify potential modulators using a cell based system. Suitable cells for such cellbased assays include both primary cancer or tumor cells and cell lines, as described herein, e.g., A549 (lung), MCF7 (breast, p53 wild-type), H1299 (lung, p53 null), HeLa (cervical), PC3 (prostate, p53 mutant), MDA-MB-231 (breast, p53 wild-type). Cancercell lines can be p53 mutant, p53 null, or express wild type p53. The MRE11 protein can be naturally occurring or recombinant. Also, fragments of MRE11 or chimeric MRE11 proteins with nuclease activity can be used in cell based assays.

Cellular MRE11 polypeptide levels can be determined by measuring the level of protein or mRNA. The level of MRE11 protein or proteins related to MRE11 are measured using immunoassays such as western blotting, ELISA and the like with an antibodythat selectively binds to the MRE11 polypeptide or a fragment thereof. For measurement of mRNA, amplification, e.g., using PCR, LCR, or hybridization assays, e.g., northern hybridization, RNAse protection, dot blotting, are preferred. The level ofprotein or mRNA is detected using directly or indirectly labeled detection agents, e.g., fluorescently or radioactively labeled nucleic acids, radioactively or enzymatically labeled antibodies, and the like, as described herein.

Alternatively, MRE11 expression can be measured using a reporter gene system. Such a system can be devised using an MRE11 protein promoter operably linked to a reporter gene such as chloramphenicol acetyltransferase, firefly luciferase,bacterial luciferase, .beta.-galactosidase and alkaline phosphatase. Furthermore, the protein of interest can be used as an indirect reporter via attachment to a second reporter such as red or green fluorescent protein (see, e.g., Mistili & Spector,Nature Biotechnology 15:961-964 (1997)).

The reporter construct is typically transfected into a cell. After treatment with a potential modulator, the amount of reporter gene transcription, translation, or activity is measured according to standard techniques known to those of skill inthe art.

Animal Models

Animal models of cellular proliferation also find use in screening for modulators of cellular proliferation, e.g., inhibitors of MRE11. Similarly, transgenic animal technology including gene knockout technology, for example as a result ofhomologous recombination with an appropriate gene targeting vector, or gene overexpression, will result in the absence or increased expression of the MRE11 protein. The same technology can also be applied to make knock-out cells. When desired,tissue-specific expression or knockout of the MRE11 protein may be necessary. Transgenic animals generated by such methods find use as animal models of cellular proliferation and are additionally useful in screening for modulators of cellularproliferation.

Knock-out cells and transgenic mice can be made by insertion of a marker gene or other heterologous gene into an endogenous MRE11 gene site in the mouse genome via homologous recombination. Such mice can also be made by substituting anendogenous MRE11 with a mutated version of the MRE11 gene, or by mutating an endogenous MRE11, e.g., by exposure to carcinogens.

A DNA construct is introduced into the nuclei of embryonic stem cells. Cells containing the newly engineered genetic lesion are injected into a host mouse embryo, which is re-implanted into a recipient female. Some of these embryos develop intochimeric mice that possess germ cells partially derived from the mutant cell line. Therefore, by breeding the chimeric mice it is possible to obtain a new line of mice containing the introduced genetic lesion (see, e.g., Capecchi et al., Science244:1288 (1989)). Chimeric targeted mice can be derived according to Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory (1988) and Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, Robertson,ed., IRL Press, Washington, D.C., (1987).

Exemplary Assays

Biochemical Assays

Exemplary biochemical assays are described in FIGS. 28 and 30-31. One assay uses a heterogenous assay format with chemiluminescent readout. This assay relies upon the differential activity of anti-BrdU against an immobilized oligonucleotidesubstrate containing the antigen (BrdU). The exonuclease activity of MRE11 results in the release of BrdU from the immobilized strand, leading to loss of signal when the MRE11-treated strand is incubated with HRP-conjugated anti-BrdU followed byincubation with a chemiluminescent HRP substrate (FIGS. 29-31).

Another biochemical assay is a homogenous assay format with a fluorescent readout. This assay is based on the difference in fluorescence of a special dye in the presence of nucleic acids. The fluorescence enhancement of the dye upon binding todouble-stranded DNA is greater than 1000-fold over the background fluorescence of the dye itself (or in the presence of nucleotides). The exonuclease activity of MRE11 results in the digestion of a 40-mer duplex oligonucleotide into free nucleotides,causing a dramatic decrease in the fluorescent intensity of the dye (see FIG. 32).

Another biochemical assay is a homogenous assay format based on fluorescent quenching, based on a change in the structural integrity of an oligonucleotide duplex containing a donor fluorophore positioned next to a quencher molecule. When theduplex is intact (in the absence of MRE11), the donor and quencher are held in close spatial proximity, resulting in quenching of the fluorescent donor. Exonuclease activity of MRE11 results in digestion of the duplex, leading to the physical separationof the fluorescent donor and quencher and an accompanying increase in the fluorescence of the donor (see FIG. 33).

Soft Agar Growth or Colony Formation in Suspension

Normal cells require a solid substrate to attach and grow. When the cells are transformed, they lose this phenotype and grow detached from the substrate. For example, transformed cells can grow in stirred suspension culture or suspended insemi-solid media, such as semi-solid or soft agar. The transformed cells, when transfected with tumor suppressor genes, regenerate normal phenotype and require a solid substrate to attach and grow.

Soft agar growth or colony formation in suspension assays can be used to identify MRE11 modulators. Typically, transformed host cells (e.g., cells that grow on soft agar) are used in this assay. For example, RKO or HCT116 cell lines can beused. Techniques for soft agar growth or colony formation in suspension assays are described in Freshney, Culture of Animal Cells a Manual of Basic Technique, 3.sup.rd ed., Wiley-Liss, New York (1994), herein incorporated by reference. See also, themethods section of Garkavtsev et al. (1996), supra, herein incorporated by reference.

Tumor Specific Markers Levels

Tumor cells release an increased amount of certain factors (hereinafter "tumor specific markers") than their normal counterparts. For example, plasminogen activator (PA) is released from human glioma at a higher level than from normal braincells (see, e.g., Gullino, Angiogenesis, tumor vascularization, and potential interference with tumor growth. In Mihich (ed.): "Biological Responses in Cancer." New York, Academic Press, pp. 178-184 (1985)). Similarly, tumor angiogenesis factor (TAF)is released at a higher level in tumor cells than their normal counterparts. See, e.g., Folkman, Angiogenesis and cancer, Sem Cancer Biol. (1992)).

Tumor specific markers can be assayed to identify MRE11 modulators which decrease the level of release of these markers from host cells. Typically, transformed or tumorigenic host cells are used. Various techniques which measure the release ofthese factors are described in Freshney (1994), supra. Also, see, Unkless et al. , J. Biol. Chem. 249:4295-4305 (1974); Strickland & Beers, J. Biol. Chem. 251:5694-5702 (1976); Whur et al., Br. J. Cancer 42:305-312 (1980); Gulino, Angiogenesis, tumorvascularization, and potential interference with tumor growth. In Mihich, E. (ed): "Biological Responses in Cancer." New York, Plenum (1985); Freshney Anticancer Res. 5:111-130 (1985).

Invasiveness into Matrigel

The degree of invasiveness into Matrigel or some other extracellular matrix constituent can be used as an assay to identify MRE11 modulators which are capable of inhibiting abnormal cell proliferation and tumor growth. Tumor cells exhibit a goodcorrelation between malignancy and invasiveness of cells into Matrigel or some other extracellular matrix constituent. In this assay, tumorigenic cells are typically used as host cells. Therefore, MRE11 modulators can be identified by measuring changesin the level of invasiveness between the host cells before and after the introduction of potential modulators. If a compound modulates MRE11, its expression in tumorigenic host cells would affect invasiveness.

Techniques described in Freshney (1994), supra, can be used. Briefly, the level of invasion of host cells can be measured by using filters coated with Matrigel or some other extracellular matrix constituent. Penetration into the gel, or throughto the distal side of the filter, is rated as invasiveness, and rated histologically by number of cells and distance moved, or by prelabeling the cells with .sup.125I and counting the radioactivity on the distal side of the filter or bottom of the dish. See, e.g., Freshney (1984), supra.

Apoptosis Analysis

Apoptosis analysis can be used as an assay to identify MRE11 modulators. In this assay, cell lines, such as RKO or HCT116, can be used to screen MRE11 modulators. Cells are contacted with a putative MRE11 modulator. The cells can beco-transfected with a construct comprising a marker gene, such as a gene that encodes green fluorescent protein, or a cell tracker dye. The apoptotic change can be determined using methods known in the art, such as DAPI staining and TUNEL assay usingfluorescent microscope. For TUNEL assay, commercially available kit can be used (e.g., Fluorescein FragEL DNA Fragmentation Detection Kit (Oncogene Research Products, Cat.# QIA39)+Tetramethyl-rhodamine-5-dUTP (Roche, Cat. # 1534 378)). Cells contactedwith MRE11 modulators would exhibit, e.g., an increased apoptosis compared to control.

G.sub.0/G.sub.1 Cell Cycle Arrest Analysis

G.sub.0/G.sub.1 cell cycle arrest can be used as an assay to identify MRE11 modulators. In this assay, cell lines, such as RKO or HCT116, can be used to screen MRE11 modulators. The cells can be co-transfected with a construct comprising amarker gene, such as a gene that encodes green fluorescent protein, or a cell tracker dye. Methods known in the art can be used to measure the degree of G.sub.1 cell cycle arrest. For example, a propidium iodide signal can be used as a measure for DNAcontent to determine cell cycle profiles on a flow cytometer. The percent of the cells in each cell cycle can be calculated. Cells contacted with a MRE11 modulator would exhibit, e.g., a higher number of cells that are arrested in G.sub.0/G.sub.1 phasecompared to control.

Tumor Growth in Vivo

Effects of MRE11 modulators on cell growth can be tested in transgenic or immune-suppressed mice. Knock-out transgenic mice can be made, in which the endogenous MRE11 gene is disrupted. Such knock-out mice can be used to study effects of MRE11,e.g., as a cancer model, as a means of assaying in vivo for compounds that modulate MRE11, and to test the effects of restoring a wild-type or mutant MRE11 to a knock-out mice.

Knock-out cells and transgenic mice can be made by insertion of a marker gene or other heterologous gene into the endogenous MRE11 gene site in the mouse genome via homologous recombination. Such mice can also be made by substituting theendogenous MRE11 with a mutated version of MRE11, or by mutating the endogenous MRE11, e.g., by exposure to carcinogens.

A DNA construct is introduced into the nuclei of embryonic stem cells. Cells containing the newly engineered genetic lesion are injected into a host mouse embryo, which is re-implanted into a recipient female. Some of these embryos develop intochimeric mice that possess germ cells partially derived from the mutant cell line. Therefore, by breeding the chimeric mice it is possible to obtain a new line of mice containing the introduced genetic lesion (see, e.g., Capecchi et al., Science244:1288 (1989)). Chimeric targeted mice can be derived according to Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory (1988) and Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, Robertson,ed., IRL Press, Washington, D.C., (1987). These knock-out mice can be used as hosts to test the effects of various MRE11 modulators on cell growth.

Alternatively, various immune-suppressed or immune-deficient host animals can be used. For example, genetically athymic "nude" mouse (see, e.g., Giovanella et al., J. Natl. Cancer Inst. 52:921 (1974)), a SCID mouse, a thymectomized mouse, oran irradiated mouse (see, e.g., Bradley et al., Br. J. Cancer 38:263 (1978); Selby et al., Br. J. Cancer 41:52 (1980)) can be used as a host. Transplantable tumor cells (typically about 10.sup.6 cells) injected into isogenic hosts will produceinvasive tumors in a high proportions of cases, while normal cells of similar origin will not. Hosts are treated with MRE11 modulators, e.g., by injection. After a suitable length of time, preferably 4-8 weeks, tumor growth is measured (e.g., by volumeor by its two largest dimensions) and compared to the control. Tumors that have statistically significant reduction (using, e.g., Student's T test) are said to have inhibited growth. Using reduction of tumor size as an assay, MRE11 modulators which arecapable, e.g., of inhibiting abnormal cell proliferation can be identified.

B. Modulators

The compounds tested as modulators of MRE11 protein can be any small organic molecule, or a biological entity, such as a protein, e.g., an antibody or peptide, a sugar, a nucleic acid, e.g., an antisense oligonucleotide, RNAi, or a ribozyme, or alipid. Alternatively, modulators can be genetically altered versions of an MRE11 protein. Typically, test compounds will be small organic molecules, peptides, lipids, and lipid analogs.

Essentially any chemical compound can be used as a potential modulator or ligand in the assays of the invention, although most often compounds can be dissolved in aqueous or organic (especially DMSO-based) solutions are used. The assays aredesigned to screen large chemical libraries by automating the assay steps and providing compounds from any convenient source to assays, which are typically run in parallel (e.g., in microtiter formats on microtiter plates in robotic assays). It will beappreciated that there are many suppliers of chemical compounds, including Sigma (St. Louis, Mo.), Aldrich (St. Louis, Mo.), Sigma-Aldrich (St. Louis, Mo.), Fluka Chemika-Biochemica Analytika (Buchs Switzerland) and the like.

In one preferred embodiment, high throughput screening methods involve providing a combinatorial small organic molecule or peptide library containing a large number of potential therapeutic compounds (potential modulator or ligand compounds). Such "combinatorial chemical libraries" or "ligand libranes" are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. Thecompounds thus identified can serve as conventional "lead compounds" or can themselves be used as potential or actual therapeutics.

A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical "building blocks" such as reagents. For example, a linearcombinatorial chemical library such as a polypeptide library is formed by combining a set of chemical building blocks (amino acids) in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millionsof chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.

Preparation and screening of combinatorial chemical libraries is well known to those of skill in the art. Such combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Pat. No. 5,010,175, Furka, Int. J. Pept. Prot. Res. 37:487-493 (1991) and Houghton et al., Nature 354:84-88 (1991)). Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: peptoids (e.g., PCT PublicationNo. WO 91/19735), encoded peptides (e.g., PCT Publication No. WO 93/20242), random bio-oligomers (e.g., PCT Publication No. WO 92/00091), benzodiazepines (e.g., U.S. Pat. No. 5,288,514), diversomers such as hydantoins, benzodiazepines and dipeptides(Hobbs et al., Proc. Nat. Acad. Sci. USA 90:6909-6913 (1993)), vinylogous polypeptides (Hagihara et al., J. Amer. Chem. Soc. 114:6568 (1992)), nonpeptidal peptidomimetics with glucose scaffolding (Hirschmann et al., J. Amer. Chem. Soc. 114:9217-9218 (1992)), analogous organic syntheses of small compound libraries (Chen et al., J. Amer. Chem. Soc. 116:2661 (1994)), oligocarbamates (Cho et al., Science 261:1303 (1993)), and/or peptidyl phosphonates (Campbell et al., J. Org. Chem.59:658 (1994)), nucleic acid libraries (see Ausubel, Berger and Sambrook, all supra), peptide nucleic acid libraries (see, e.g., U.S. Pat. No. 5,539,083), antibody libraries (see, e.g., Vaughn et al., Nature Biotechnology, 14(3):309-314 (1996) andPCT/US96/10287), carbohydrate libraries (see, e.g., Liang et al., Science, 274:1520-1522 (1996) and U.S. Pat. No. 5,593,853), small organic molecule libraries (see, e.g., benzodiazepines, Baum C&EN, Jan 18, page 33 (1993); isoprenoids, U.S. Pat. No.5,569,588; thiazolidinones and metathiazanones, U.S. Pat. No. 5,549,974; pyrrolidines, U.S. Pat. Nos. 5,525,735 and 5,519,134; morpholino compounds, U.S. Pat. No. 5,506,337; benzodiazepines, U.S. Pat. No. 5,288,514, and the like).

Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville Ky., Symphony, Rainin, Woburn, Mass., 433A Applied Biosystems, Foster City, Calif., 9050 Plus,Millipore, Bedford, Mass.). In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex, Princeton, N.J., Asinex, Moscow, Ru, Tripos, Inc., St. Louis, Mo., ChemStar, Ltd, Moscow, RU, 3D Pharmaceuticals,Exton, Pa., Martek Biosciences, Columbia, Md., etc.).

C. Solid State and Soluble High Throughput Assays

In one embodiment the invention provides soluble assays using a MRE11 protein, or a cell or tissue expressing an MRE11 protein, either naturally occurring or recombinant. In another embodiment, the invention provides solid phase based in vitroassays in a high throughput format, where the MRE11 protein its substrate is attached to a solid phase substrate via covalent or non-covalent interactions. Any one of the assays described herein can be adapted for high throughput screening.

In the high throughput assays of the invention, either soluble or solid state, it is possible to screen up to several thousand different modulators or ligands in a single day. This methodology can be used for MRE11 proteins in vitro, or forcell-based or membrane-based assays comprising an MRE11 protein. In particular, each well of a microtiter plate can be used to run a separate assay against a selected potential modulator, or, if concentration or incubation time effects are to beobserved, every 5-10 wells can test a single modulator. Thus, a single standard microtiter plate can assay about 100 (e.g., 96) modulators. If 1536 well plates are used, then a single plate can easily assay from about 100- about 1500 differentcompounds. It is possible to assay many plates per day; assay screens for up to about 6,000, 20,000, 50,000, or more than 100,000 different compounds are possible using the integrated systems of the invention.

For a solid state reaction, the protein of interest or a fragment thereof, e.g., an extracellular domain, or a cell or membrane comprising the protein of interest or a fragment thereof as part of a fusion protein can be bound to the solid statecomponent, directly or indirectly, via covalent or non covalent linkage e.g., via a tag. The tag can be any of a variety of components. In general, a molecule which binds the tag (a tag binder) is fixed to a solid support, and the tagged molecule ofinterest is attached to the solid support by interaction of the tag and the tag binder.

A number of tags and tag binders can be used, based upon known molecular interactions well described in the literature. For example, where a tag has a natural binder, for example, biotin, protein A, or protein G, it can be used in conjunctionwith appropriate tag binders (avidin, streptavidin, neutravidin, the Fc region of an immunoglobulin, etc.) Antibodies to molecules with natural binders such as biotin are also widely available and appropriate tag binders; see, SIGMA hnmunochemicals 1998catalogue SIGMA, St. Louis Mo.).

Similarly, any haptenic or antigenic compound can be used in combination with an appropriate antibody to form a tag/tag binder pair. Thousands of specific antibodies are commercially available and many additional antibodies are described in theliterature. For example, in one common configuration, the tag is a first antibody and the tag binder is a second antibody which recognizes the first antibody. In addition to antibody-antigen interactions, receptor-ligand interactions are alsoappropriate as tag and tag-binder pairs. For example, agonists and antagonists of cell membrane receptors (e.g., cell receptor-ligand interactions such as transferrin, c-kit, viral receptor ligands, cytokine receptors, chemokine receptors, interleukinreceptors, immunoglobulin receptors and antibodies, the cadherein family, the integrin family, the selectin family, and the like; see, e.g., Pigott & Power, The Adhesion Molecule Facts Book I (1993). Similarly, toxins and venoms, viral epitopes,hormones (e.g., opiates, steroids, etc.), intracellular receptors (e.g. which mediate the effects of various small ligands, including steroids, thyroid hormone, retinoids and vitamin D; peptides), drugs, lectins, sugars, nucleic acids (both linear andcyclic polymer configurations), oligosaccharides, proteins, phospholipids and antibodies can all interact with various cell receptors.

Synthetic polymers, such as polyurethanes, polyesters, polycarbonates, polyureas, polyamides, polyethyleneimines, polyarylene sulfides, polysiloxanes, polyimides, and polyacetates can also form an appropriate tag or tag binder. Many othertag/tag binder pairs are also useful in assay systems described herein, as would be apparent to one of skill upon review of this disclosure.

Common linkers such as peptides, polyethers, and the like can also serve as tags, and include polypeptide sequences, such as poly Gly sequences of between about 5 and 200 amino acids (SEQ ID NO:21). Such flexible linkers are known to persons ofskill in the art. For example, poly(ethylene glycol) linkers are available from Shearwater Polymers, Inc., Huntsville, Ala. These linkers optionally have amide linkages, sulfhydryl linkges, or heterofunctional linkages.

Tag binders are fixed to solid substrates using any of a variety of methods currently available. Solid substrates are commonly derivatized or functionalized by exposing all or a portion of the substrate to a chemical reagent which fixes achemical group to the surface which is reactive with a portion of the tag binder. For example, groups which are suitable for attachment to a longer chain portion would include amines, hydroxyl, thiol, and carboxyl groups. Aminoalkylsilanes andhydroxyalkylsilanes can be used to functionalize a variety of surfaces, such as glass surfaces. The construction of such solid phase biopolymer arrays is well described in the literature. See, e.g., Merrifield, J. Am. Chem. Soc. 85:2149-2154 (1963)(describing solid phase synthesis of, e.g., peptides); Geysen et al., J. Immun. Meth. 102:259-274 (1987) (describing synthesis of solid phase components on pins); Frank & Doring, Tetrahedron 44:60316040 (1988) (describing synthesis of various peptidesequences on cellulose disks); Fodor et al., Science, 251:767-777 (1991); Sheldon et al., Clinical Chemistry 39(4):718-719 (1993); and Kozal et al., Nature Medicine 2(7):753759 (1996) (all describing arrays of biopolymers fixed to solid substrates). Non-chemical approaches for fixing tag binders to substrates include other common methods, such as heat, cross-linking by UV radiation, and the like.

Immunological Detection of MRE11 Polypeptides

In addition to the detection of MRE11 gene and gene expression using nucleic acid hybridization technology, one can also use immunoassays to detect MRE11 proteins of the invention. Such assays are useful for screening for modulators of MRE11, aswell as for therapeutic and diagnostic applications. Immunoassays can be used to qualitatively or quantitatively analyze MRE11 protein. A general overview of the applicable technology can be found in Harlow & Lane, Antibodies: A Laboratory Manual(1988).

A. Production of Antibodies

Methods of producing polyclonal and monoclonal antibodies that react specifically with the MRE11 proteins are known to those of skill in the art (see, e.g., Coligan, Current Protocols in Immunology (1991); Harlow & Lane, supra; Goding, MonoclonalAntibodies: Principles and Practice (2d ed. 1986); and Kohler & Milstein, Nature 256:495-497 (1975). Such techniques include antibody preparation by selection of antibodies from libraries of recombinant antibodies in phage or similar vectors, as wellas preparation of polyclonal and monoclonal antibodies by immunizing rabbits or mice (see, e.g., Huse et al., Science 246:1275-1281 (1989); Ward et al., Nature 341:544-546 (1989)).

A number of immunogens comprising portions of MRE11 protein may be used to produce antibodies specifically reactive with MRE11 protein. For example, recombinant MRE11 protein or an antigenic fragment thereof, can be isolated as described herein. Recombinant protein can be expressed in eukaryotic or prokaryotic cells as described above, and purified as generally described above. Recombinant protein is the preferred immunogen for the production of monoclonal or polyclonal antibodies. Alternatively, a synthetic peptide derived from the sequences disclosed herein and conjugated to a carrier protein can be used an immunogen. Naturally occurring protein may also be used either in pure or impure form. The product is then injected intoan animal capable of producing antibodies. Either monoclonal or polyclonal antibodies may be generated, for subsequent use in immunoassays to measure the protein.

Methods of production of polyclonal antibodies are known to those of skill in the art. An inbred strain of mice (e.g., BALB/C mice) or rabbits is immunized with the protein using a standard adjuvant, such as Freund's adjuvant, and a standardimmunization protocol. The animal's immune response to the immunogen preparation is monitored by taking test bleeds and determining the titer of reactivity to the beta subunits. When appropriately high titers of antibody to the immunogen are obtained,blood is collected from the animal and antisera are prepared. Further fractionation of the antisera to enrich for antibodies reactive to the protein can be done if desired (see, Harlow & Lane, supra).

Monoclonal antibodies may be obtained by various techniques familiar to those skilled in the art. Briefly, spleen cells from an animal immunized with a desired antigen are immortalized, commonly by fusion with a myeloma cell (see, Kohler &Milstein, Eur. J Immunol. 6:511b-519 (1976)). Alternative methods of immortalization include transformation with Epstein Barr Virus, oncogenes, or retroviruses, or other methods well known in the art. Colonies arising from single immortalized cellsare screened for production of antibodies of the desired specificity and affinity for the antigen, and yield of the monoclonal antibodies produced by such cells may be enhanced by various techniques, including injection into the peritoneal cavity of avertebrate host. Alternatively, one may isolate DNA sequences which encode a monoclonal antibody or a binding fragment thereof by screening a DNA library from human B cells according to the general protocol outlined by Huse, et al., Science246:1275-1281 (1989).

Monoclonal antibodies and polyclonal sera are collected and titered against the immunogen protein in an immunoassay, for example, a solid phase immunoassay with the immunogen immobilized on a solid support. Typically, polyclonal antisera with atiter of 10.sup.4 or greater are selected and tested for their cross reactivity against non- MRE11 proteins, using a competitive binding immunoassay. Specific polyclonal antisera and monoclonal antibodies will usually bind with a K.sub.d of at leastabout 0.1 mM, more usually at least about 1 .mu.M, preferably at least about 0.1 .mu.M or better, and most preferably, 0.01 .mu.M or better. Antibodies specific only for a particular MRE11 ortholog, such as human MRE11, can also be made, by subtractingout other cross-reacting orthologs from a species such as a nonhuman mammal. In this manner, antibodies that bind only to MRE11 protein may be obtained.

Once the specific antibodies against MRE11 protein are available, the protein can be detected by a variety of immunoassay methods. In addition, the antibody can be used therapeutically as a MRE11 modulators. For a review of immunological andimmunoassay procedures, see Basic and Clinical Immunology (Stites & Terr eds., 7.sup.th ed. 1991). Moreover, the immunoassays of the present invention can be performed in any of several configurations, which are reviewed extensively in EnzymeImmunoassay (Maggio, ed., 1980); and Harlow & Lane, supra.

B. Immunological Binding Assays

MRE11 protein can be detected and/or quantified using any of a number of well recognized immunological binding assays (see, e.g., U.S. Pat. Nos. 4,366,241; 4,376,110; 4,517,288; and 4,837,168). For a review of the general immunoassays, seealso Methods in Cell Biology: Antibodies in Cell Biology, volume 37 (Asai, ed. 1993); Basic and Clinical Immunology (Stites & Terr, eds., 7th ed. 1991). Immunological binding assays (or immunoassays) typically use an antibody that specifically bindsto a protein or antigen of choice (in this case the MRE11 protein or antigenic subsequence thereof). The antibody (e.g., anti-MRE11) may be produced by any of a number of means well known to those of skill in the art and as described above.

Immunoassays also often use a labeling agent to specifically bind to and label the complex formed by the antibody and antigen. The labeling agent may itself be one of the moieties comprising the antibody/antigen complex. Thus, the labelingagent may be a labeled MRE11 or a labeled anti-MRE11 antibody. Alternatively, the labeling agent may be a third moiety, such a secondary antibody, that specifically binds to the antibody/MRE11 complex (a secondary antibody is typically specific toantibodies of the species from which the first antibody is derived). Other proteins capable of specifically binding immunoglobulin constant regions, such as protein A or protein G may also be used as the label agent. These proteins exhibit a strongnon-immunogenic reactivity with immunoglobulin constant regions from a variety of species (see, e.g., Kronval et al., J. Immunol. 111:1401-1406 (1973); Akerstrom et al., J. Immunol. 135:2589-2542 (1985)). The labeling agent can be modified with adetectable moiety, such as biotin, to which another molecule can specifically bind, such as streptavidin. A variety of detectable moieties are well known to those skilled in the art.

Throughout the assays, incubation and/or washing steps may be required after each combination of reagents. Incubation steps can vary from about 5 seconds to several hours, optionally from about 5 minutes to about 24 hours. However, theincubation time will depend upon the assay format, antigen, volume of solution, concentrations, and the like. Usually, the assays will be carried out at ambient temperature, although they can be conducted over a range of temperatures, such as 10.degree. C. to 40.degree. C.

Non-competitive Assay Formats

Immunoassays for detecting MRE11 in samples may be either competitive or noncompetitive. Noncompetitive immunoassays are assays in which the amount of antigen is directly measured. In one preferred "sandwich" assay, for example, the anti-MRE11antibodies can be bound directly to a solid substrate on which they are immobilized. These immobilized antibodies then capture MRE11 present in the test sample. MRE11 proteins thus immobilized are then bound by a labeling agent, such as a second MRE11antibody bearing a label. Alternatively, the second antibody may lack a label, but it may, in turn, be bound by a labeled third antibody specific to antibodies of the species from which the second antibody is derived. The second or third antibody istypically modified with a detectable moiety, such as biotin, to which another molecule specifically binds, e.g., streptavidin, to provide a detectable moiety.

Competitive Assay Formats

In competitive assays, the amount of MRE11 protein present in the sample is measured indirectly by measuring the amount of a known, added (exogenous) MRE11 protein displaced (competed away) from an anti-MRE11 antibody by the unknown MRE11 proteinpresent in a sample. In one competitive assay, a known amount of MRE11 protein is added to a sample and the sample is then contacted with an antibody that specifically binds to MRE11 protein. The amount of exogenous MRE11 protein bound to the antibodyis inversely proportional to the concentration of MRE11 protein present in the sample. In a particularly preferred embodiment, the antibody is immobilized on a solid substrate. The amount of MRE11 protein bound to the antibody may be determined eitherby measuring the amount of MRE11 present in MRE11 protein/antibody complex, or alternatively by measuring the amount of remaining uncomplexed protein. The amount of MRE11 protein may be detected by providing a labeled MRE11 molecule.

A hapten inhibition assay is another preferred competitive assay. In this assay the known MRE11 protein is immobilized on a solid substrate. A known amount of anti-MRE11 antibody is added to the sample, and the sample is then contacted with theimmobilized MRE11. The amount of anti-MRE11 antibody bound to the known immobilized MRE11 is inversely proportional to the amount of MRE11 protein present in the sample. Again, the amount of immobilized antibody may be detected by detecting either theimmobilized fraction of antibody or the fraction of the antibody that remains in solution. Detection may be direct where the antibody is labeled or indirect by the subsequent addition of a labeled moiety that specifically binds to the antibody asdescribed above.

Cross-reactivity Determinations

Immunoassays in the competitive binding format can also be used for crossreactivity determinations. For example, an MRE11 protein can be immobilized to a solid support. Proteins (e.g., MRE11 and homologs) are added to the assay that compete forbinding of the antisera to the immobilized antigen. The ability of the added proteins to compete for binding of the antisera to the immobilized protein is compared to the ability of the MRE11 protein to compete with itself. The percent crossreactivityfor the above proteins is calculated, using standard calculations. Those antisera with less than 10% crossreactivity with each of the added proteins listed above are selected and pooled. The cross-reacting antibodies are optionally removed from thepooled antisera by immunoabsorption with the added considered proteins, e.g., distantly related homologs.

The immunoabsorbed and pooled antisera are then used in a competitive binding immunoassay as described above to compare a second protein, thought to be perhaps an allele or polymorphic variant of an MRE11 protein, to the immunogen protein. Inorder to make this comparison, the two proteins are each assayed at a wide range of concentrations and the amount of each protein required to inhibit 50% of the binding of the antisera to the immobilized protein is determined. If the amount of thesecond protein required to inhibit 50% of binding is less than 10 times the amount of the MRE11 protein that is required to inhibit 50% of binding, then the second protein is said to specifically bind to the polyclonal antibodies generated to MRE11immunogen.

Other Assay Formats

Western blot (immunoblot) analysis is used to detect and quantify the presence of MRE11 in the sample. The technique generally comprises separating sample proteins by gel electrophoresis on the basis of molecular weight, transferring theseparated proteins to a suitable solid support, (such as a nitrocellulose filter, a nylon filter, or derivatized nylon filter), and incubating the sample with the antibodies that specifically bind MRE11. The anti-MRE11 antibodies specifically bind tothe MRE11 on the solid support. These antibodies may be directly labeled or alternatively may be subsequently detected using labeled antibodies (e.g., labeled sheep anti-mouse antibodies) that specifically bind to the anti-MRE11 antibodies.

Other assay formats include liposome immunoassays (LIA), which use liposomes designed to bind specific molecules (e.g., antibodies) and release encapsulated reagents or markers. The released chemicals are then detected according to standardtechniques (see Monroe et al., Amer. Clin. Prod. Rev. 5:34-41 (1986)).

Reduction of Non-specific Binding

One of skill in the art will appreciate that it is often desirable to minimize nonspecific binding in immunoassays. Particularly, where the assay involves an antigen or antibody immobilized on a solid substrate it is desirable to minimize theamount of nonspecific binding to the substrate. Means of reducing such non-specific binding are well known to those of skill in the art. Typically, this technique involves coating the substrate with a proteinaceous composition. In particular, proteincompositions such as bovine serum albumin (BSA), nonfat powdered milk, and gelatin are widely used with powdered milk being most preferred.

Labels

The particular label or detectable group used in the assay is not a critical aspect of the invention, as long as it does not significantly interfere with the specific binding of the antibody used in the assay. The detectable group can be anymaterial having a detectable physical or chemical property. Such detectable labels have been well-developed in the field of immunoassays and, in general, most any label useful in such methods can be applied to the present invention. Thus, a label isany composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful labels in the present invention include magnetic beads (e.g., DYNABEADS.TM.), fluorescent dyes (e.g., fluoresceinisothiocyanate, Texas red, rhodamine, and the like), radiolabels (e.g., .sup.3H, .sup.125I, .sup.35S, .sup.14C, or .sup.32P), enzymes (e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an ELISA), chemiluminescent labels, andcolorimetric labels such as colloidal gold or colored glass or plastic beads (e.g., polystyrene, polypropylene, latex, etc.).

The label may be coupled directly or indirectly to the desired component of the assay according to methods well known in the art. As indicated above, a wide variety of labels may be used, with the choice of label depending on sensitivityrequired, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.

Non-radioactive labels are often attached by indirect means. Generally, a ligand molecule (e.g., biotin) is covalently bound to the molecule. The ligand then binds to another molecules (e.g., streptavidin) molecule, which is either inherentlydetectable or covalently bound to a signal system, such as a detectable enzyme, a fluorescent compound, or a chemiluminescent compound. The ligands and their targets can be used in any suitable combination with antibodies that recognize MRE11 protein,or secondary antibodies that recognize anti-MRE11.

The molecules can also be conjugated directly to signal generating compounds, e.g., by conjugation with an enzyme or fluorophore. Enzymes of interest as labels will primarily be hydrolases, particularly phosphatases, esterases and glycosidases,or oxidotases, particularly peroxidases. Fluorescent compounds include fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, etc. Chemiluminescent compounds include luciferin, and 2,3-dihydrophthalazinediones, e.g.,luminol. For a review of various labeling or signal producing systems that may be used, see U.S. Pat. No. 4,391,904.

Means of detecting labels are well known to those of skill in the art. Thus, for example, where the label is a radioactive label, means for detection include a scintillation counter or photographic film as in autoradiography. Where the label isa fluorescent label, it may be detected by exciting the fluorochrome with the appropriate wavelength of light and detecting the resulting fluorescence. The fluorescence may be detected visually, by the use of electronic detectors such as charge coupleddevices (CCDs) or photomultipliers and the like. Similarly, enzymatic labels may be detected by providing the appropriate substrates for the enzyme and detecting the resulting reaction product. Finally simple colorimetric labels may be detected simplyby observing the color associated with the label. Thus, in various dipstick assays, conjugated gold often appears pink, while various conjugated beads appear the color of the bead.

Some assay formats do not require the use of labeled components. For instance, agglutination assays can be used to detect the presence of the target antibodies. In this case, antigen-coated particles are agglutinated by samples comprising thetarget antibodies. In this format, none of the components need be labeled and the presence of the target antibody is detected by simple visual inspection.

Cellular Transfection and Gene Therapy

The present invention provides the nucleic acids of MRE11 protein for the transfection of cells in vitro and in vivo. These nucleic acids can be inserted into any of a number of well-known vectors for the transfection of target cells andorganisms as described below. The nucleic acids are transfected into cells, ex vivo or in vivo, through the interaction of the vector and the target cell. The nucleic acid, under the control of a promoter, then expresses a MRE11 protein of the presentinvention, thereby mitigating the effects of absent, partial inactivation, or abnormal expression of an MRE11 gene, particularly as it relates to cell cycle proliferation. The compositions are administered to a patient in an amount sufficient to elicita therapeutic response in the patient. An amount adequate to accomplish this is defined as "therapeutically effective dose or amount."

Such gene therapy procedures have been used to correct acquired and inherited genetic defects, cancer, and other diseases in a number of contexts. The ability to express artificial genes in humans facilitates the prevention and/or cure of manyimportant human diseases, including many diseases which are not amenable to treatment by other therapies (for a review of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey,TIBTECH 11:162-166 (1993); Mulligan, Science 926-932 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1998); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer &Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology (Doerfier & Bohm eds., 1995); and Yu et al., Gene Therapy 1:13-26 (1994)).

Pharmaceutical Compositions and Administration

Pharmaceutically acceptable carriers are determined in part by the particular composition being administered (e.g., nucleic acid, protein, modulatory compounds or transduced cell), as well as by the particular method used to administer thecomposition. Accordingly, there are a wide variety of suitable formulations of pharmaceutical compositions of the present invention (see, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989). Administration can be in any convenient manner, e.g.,by injection, oral administration, inhalation, transdermal application, or rectal administration.

Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the packaged nucleic acid suspended in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each containinga predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calciumphosphates, corn starch, potato starch, microcrystalline cellulose, gelatin, colloidal silicon dioxide, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents,preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers. Lozenge forms can comprise the active ingredient in a flavor, e.g., sucrose, as well as pastilles comprising the active ingredient in an inert base,such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art.

The compound of choice, alone or in combination with other suitable components, can be made into aerosol formulations (i.e., they can be "nebulized") to be administered via inhalation. Aerosol formulations can be placed into pressurizedacceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.

Formulations suitable for parenteral administration, such as, for example, by intraarticular (in the joints), intravenous, intramuscular, intradermal, intraperitoneal, and subcutaneous routes, include aqueous and non-aqueous, isotonic sterileinjection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents,solubilizers, thickening agents, stabilizers, and preservatives. In the practice of this invention, compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally. Parenteral administration and intravenous administration are the preferred methods of administration. The formulations of commends can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials.

Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. Cells transduced by nucleic acids for ex vivo therapy can also be administered intravenously or parenterally asdescribed above.

The dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time. The dose will be determined by the efficacy of the particular vector employedand the condition of the patient, as well as the body weight or surface area of the patient to be treated. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration ofa particular vector, or transduced cell type in a particular patient.

In determining the effective amount of the vector to be administered in the treatment or prophylaxis of conditions owing to diminished or aberrant expression of the MRE11 protein, the physician evaluates circulating plasma levels of the vector,vector toxicities, progression of the disease, and the production of anti-vector antibodies. In general, the dose equivalent of a naked nucleic acid from a vector is from about 1 .mu.g to 100 .mu.g for a typical 70 kilogram patient, and doses of vectorswhich include a retroviral particle are calculated to yield an equivalent amount of therapeutic nucleic acid.

For administration, compounds and transduced cells of the present invention can be administered at a rate determined by the LD-50 of the inhibitor, vector, or transduced cell type, and the side-effects of the inhibitor, vector or cell type atvarious concentrations, as applied to the mass and overall health of the patient. Administration can be accomplished via single or divided doses.

EXAMPLES

The following examples are offered to illustrate, but not to limit the claimed invention.

Example 1

Identification of MRE11 Using a Yeast Two Hybrid Assay and Role of MRE11 in Modulation of Cellular and Tumor Cell Proliferation

MRE11 was identified as a member of the PCNA complex using a yeast two hybrid assay, with PCNA as bait. Proteins interacting with the bait peptide are isolated using yeast two-hybrid systems or mammalian two hybrid systems known to those ofskill in the art (see, e.g., Fields et al., Nature 340:245 (1989); Vasavada et al., PNAS USA 88:10686 (1991); Fearon et al., PNAS USA 89:7958 (1992); Dang et al., Mol. Cell. Biol. 11:954 (1991); Chien et al., PNAS USA 9578 (1991); and U.S. Pat. Nos. 5,283,173, 5,667,973, 5,468,614, 5,525,490, and 5,637,463)

As shown in FIGS. 8-15, studies show that inhibition of MRE11 or overexpression of an MRE11 mutant is antiproliferative in A549 tumor cells and HeLa cells but not in normal cells (using, e.g., GFP positivity assays, cell tracker assays, andantisense assays). FIGS. 16-22 demonstrate that overexpression of an MRE11 mutant enhances sensitivity to chemotherapeutic reagents in tumor cells. These functional studies demonstrate that inhibition of MRE11 will inhibit tumor cell growth and enhancechemosensitivity.

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within thespirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

>

2NAHomo sapienshuman MREtic recombination log A gtcc gggacgccgt tctctcccgc ggaattcagg tttacggccc tgcgggttct 6attt ctagaatttg gaatcgagtg cattttctga catttgagta cagtacccag tcttgg agaagaacct ggtcccagaggagcttgact gaccataaaa atgagtactg tgcact tgatgatgaa aacacattta aaatattagt tgcaacagat attcatcttg 24tgga gaaagatgca gtcagaggaa atgatacgtt tgtaacactc gatgaaattt 3cttgc ccaggaaaat gaagtggatt ttattttgtt aggtggtgat ctttttcatg 36agccctcaaggaaa acattacata cctgcctcga gttattaaga aaatattgta 42atcg gcctgtccag tttgaaattc tcagtgatca gtcagtcaac tttggtttta 48ttcc atgggtgaac tatcaagatg gcaacctcaa catttcaatt ccagtgttta 54atgg caatcatgac gatcccacag gggcagatgc actttgtgccttggacattt 6tgtgc tggatttgta aatcactttg gacgttcaat gtctgtggag aagatagaca 66cggt tttgcttcaa aaaggaagca caaagattgc gctatatggt ttaggatcca 72atga aaggctctat cgaatgtttg tcaataaaaa agtaacaatg ttgagaccaa 78atga gaactcttgg tttaacttatttgtgattca tcagaacagg agtaaacatg 84ctaa cttcattcca gaacaatttt tggatgactt cattgatctt gttatctggg 9gaaca tgagtgtaaa atagctccaa ccaaaaatga acaacagctg ttttatatct 96ctgg aagctcagtg gttacttctc tttccccagg agaagctgta aagaaacatg gtttgctgcgtattaaa gggaggaaga tgaatatgca taaaattcct cttcacacag ggcagtt tttcatggag gatattgttc tagctaatca tccagacatt tttaacccag atcctaa agtaacccaa gccatacaaa gcttctgttt ggagaagatt gaagaaatgc aaaatgc tgaacgggaa cgtctgggta attctcacca gccagagaagcctcttgtac tgcgagt ggactatagt ggaggttttg aacctttcag tgttcttcgc tttagccaga ttgtgga tcgggtagct aatccaaaag acattatcca ttttttcagg catagagaac aggaaaa aacaggagaa gagatcaact ttgggaaact tatcacaaag ccttcagaag caacttt aagggtagaagatcttgtaa aacagtactt tcaaaccgca gagaagaatg agctctc actgctaaca gaaagaggga tgggtgaagc agtacaagaa tttgtggaca aggagaa agatgccatt gaggaattag tgaaatacca gttggaaaaa acacagcgat ttaaaga acgtcatatt gatgccctcg aagacaaaat cgatgaggag gtacgtcgttgagaaac cagacaaaaa aatactaatg aagaagatga tgaagtccgt gaggctatga gggccag agcactcaga tctcagtcag aggagtctgc ttctgccttt agtgctgatg ttatgag tatagattta gcagaacaga tggctaatga ctctgatgat agcatctcag caaccaa caaaggaaga ggccgaggaagaggtcgaag aggtggaaga gggcagaatt catcgag aggagggtct caaagaggaa gagcagacac tggtctggag acttctaccc gcaggaa ctcaaagact gctgtgtcag catctagaaa tatgtctatt atagatgcct 2atctac aagacagcag ccttcccgaa atgtcactac taagaattat tcagaggtga2ggtaga tgaatcagat gtggaagaag acatttttcc taccacttca aagacagatc 2gtggtc cagcacatca tccagcaaaa tcatgtccca gagtcaagta tcgaaagggg 222ttga atcaagtgag gatgatgatg atgatccttt tatgaacact agttctttaa 228atag aagataatat atttaatggcactgagaaac atgcaagata caggaaaaat 234gtta caagctaaga gtttacagtt taagatttta agtattgttt cctgagcata 24ataag taagaaattt ctagttcaca gacatacaat agcattgatt caccttgttt 246cctg gttgttgtag taagagcttt gtttcaatat cactcttgag taaagattaa252gcta ccatttt 253727mo sapienshuman MREtic recombination log A 2Met Ser Thr Ala Asp Ala Leu Asp Asp Glu Asn Thr Phe Lys Ile Leu la Thr Asp Ile His Leu Gly Phe Met Glu Lys Asp Ala Val Arg 2Gly Asn Asp ThrPhe Val Thr Leu Asp Glu Ile Leu Arg Leu Ala Gln 35 4 Asn Glu Val Asp Phe Ile Leu Leu Gly Gly Asp Leu Phe His Glu 5Asn Lys Pro Ser Arg Lys Thr Leu His Thr Cys Leu Glu Leu Leu Arg 65 7Lys Tyr Cys Met Gly Asp Arg Pro Val Gln Phe Glu IleLeu Ser Asp 85 9 Ser Val Asn Phe Gly Phe Ser Lys Phe Pro Trp Val Asn Tyr Gln Gly Asn Leu Asn Ile Ser Ile Pro Val Phe Ser Ile His Gly Asn Asp Asp Pro Thr Gly Ala Asp Ala Leu Cys Ala Leu Asp Ile Leu CysAla Gly Phe Val Asn His Phe Gly Arg Ser Met Ser Val Glu Lys Ile Asp Ile Ser Pro Val Leu Leu Gln Lys Gly Ser Thr Lys Ile Leu Tyr Gly Leu Gly Ser Ile Pro Asp Glu Arg Leu Tyr Arg Met Val Asn Lys Lys Val Thr MetLeu Arg Pro Lys Glu Asp Glu Asn 2rp Phe Asn Leu Phe Val Ile His Gln Asn Arg Ser Lys His Gly 222r Asn Phe Ile Pro Glu Gln Phe Leu Asp Asp Phe Ile Asp Leu225 234e Trp Gly His Glu His Glu Cys Lys Ile Ala Pro ThrLys Asn 245 25u Gln Gln Leu Phe Tyr Ile Ser Gln Pro Gly Ser Ser Val Val Thr 267u Ser Pro Gly Glu Ala Val Lys Lys His Val Gly Leu Leu Arg 275 28e Lys Gly Arg Lys Met Asn Met His Lys Ile Pro Leu His Thr Val 29lnPhe Phe Met Glu Asp Ile Val Leu Ala Asn His Pro Asp Ile33he Asn Pro Asp Asn Pro Lys Val Thr Gln Ala Ile Gln Ser Phe Cys 325 33u Glu Lys Ile Glu Glu Met Leu Glu Asn Ala Glu Arg Glu Arg Leu 345n Ser His Gln Pro Glu LysPro Leu Val Arg Leu Arg Val Asp 355 36r Ser Gly Gly Phe Glu Pro Phe Ser Val Leu Arg Phe Ser Gln Lys 378l Asp Arg Val Ala Asn Pro Lys Asp Ile Ile His Phe Phe Arg385 39rg Glu Gln Lys Glu Lys Thr Gly Glu Glu Ile Asn PheGly Lys 44le Thr Lys Pro Ser Glu Gly Thr Thr Leu Arg Val Glu Asp Leu 423s Gln Tyr Phe Gln Thr Ala Glu Lys Asn Val Gln Leu Ser Leu 435 44u Thr Glu Arg Gly Met Gly Glu Ala Val Gln Glu Phe Val Asp Lys 456uLys Asp Ala Ile Glu Glu Leu Val Lys Tyr Gln Leu Glu Lys465 478n Arg Phe Leu Lys Glu Arg His Ile Asp Ala Leu Glu Asp Lys 485 49e Asp Glu Glu Val Arg Arg Phe Arg Glu Thr Arg Gln Lys Asn Thr 55lu Glu Asp Asp Glu Val ArgGlu Ala Met Thr Arg Ala Arg Ala 5525Leu Arg Ser Gln Ser Glu Glu Ser Ala Ser Ala Phe Ser Ala Asp Asp 534t Ser Ile Asp Leu Ala Glu Gln Met Ala Asn Asp Ser Asp Asp545 556e Ser Ala Ala Thr Asn Lys Gly Arg Gly Arg Gly ArgGly Arg 565 57g Gly Gly Arg Gly Gln Asn Ser Ala Ser Arg Gly Gly Ser Gln Arg 589g Ala Asp Thr Gly Leu Glu Thr Ser Thr Arg Ser Arg Asn Ser 595 6ys Thr Ala Val Ser Ala Ser Arg Asn Met Ser Ile Ile Asp Ala Phe 662rThr Arg Gln Gln Pro Ser Arg Asn Val Thr Thr Lys Asn Tyr625 634u Val Ile Glu Val Asp Glu Ser Asp Val Glu Glu Asp Ile Phe 645 65o Thr Thr Ser Lys Thr Asp Gln Arg Trp Ser Ser Thr Ser Ser Ser 667e Met Ser Gln Ser Gln ValSer Lys Gly Val Asp Phe Glu Ser 675 68r Glu Asp Asp Asp Asp Asp Pro Phe Met Asn Thr Ser Ser Leu Arg 69sn Arg Arg7RTHomo sapienshuman MREo acids 9-3 Glu Asn Thr Phe Lys Ile Leu Val Ala Thr Asp Ile His Leu Gly et Glu Lys Asp Ala Ala Arg Gly Asn Asp Thr Phe Val Thr Leu 2Asp Glu Ile Leu Arg Leu Ala Gln Glu Asn Glu Val Asp Phe Ile Leu 35 4 Gly Gly Asp Leu Phe His Glu Asn Lys Pro Ser Arg Lys Thr Leu 5His Thr Cys Leu Glu Leu Leu ArgLys Tyr Cys Met Gly Asp Arg Pro 65 7Val Gln Phe Glu Ile Leu Ser Asp Gln Ser Val Asn Phe Gly Phe Ser 85 9 Phe Pro Trp Val Asn Tyr Gln Asp Gly Asn Leu Asn Ile Ser Ile Val Phe Ser Ile His Gly Asn His Asp Asp Pro Thr Gly Ala Asp Leu Cys Ala Leu Asp Ile Leu Ser Cys Ala Gly Phe Val Asn His Gly Arg Ser Met Ser Val Glu Lys Ile Asp Ile Ser Pro Val Leu Leu Gln Lys Gly Ser Thr Lys Ile Ala Leu Tyr Gly Leu Gly Ser Ile Asp Glu ArgLeu Tyr Arg Met Phe Val Asn Lys Lys Val Thr Met Arg Pro Lys Glu Asp Glu Asn Ser Trp Phe Asn Leu Phe Val Ile 2ln Asn Arg Ser Lys His Gly Ser Thr Asn Phe Ile Pro Glu Gln 222u Asp Asp Phe Ile Asp Leu Val Ile TrpGly His Glu His Glu225 234s Ile Ala Pro Thr Lys Asn Glu Gln Gln Leu Phe Tyr Ile Ser 245 25n Pro Gly Ser Ser Val Val Thr Ser Leu Ser Pro Gly Glu Ala Val 267s His Val Gly Leu Leu Arg Ile Lys Gly Arg Lys Met Asn Met 27528s Lys Ile Pro Leu His Thr Val Arg Gln Phe 29ccharomyces cerevisiaeyeast MREo acids 5-3 Pro Asp Thr Ile Arg Ile Leu Ile Thr Thr Asp Asn His Val Gly sn Glu Asn Asp Pro Ile Thr Gly Asp Asp Ser Trp Lys ThrPhe 2His Glu Val Met Met Leu Ala Lys Asn Asn Asn Val Asp Met Val Val 35 4 Ser Gly Asp Leu Phe His Val Asn Lys Pro Ser Lys Lys Ser Leu 5Tyr Gln Val Leu Lys Thr Leu Arg Leu Cys Cys Met Gly Asp Lys Pro 65 7Cys Glu Leu Glu Leu LeuSer Asp Pro Ser Gln Val Phe His Tyr Asp 85 9 Phe Thr Asn Val Asn Tyr Glu Asp Pro Asn Phe Asn Ile Ser Ile Val Phe Gly Ile Ser Gly Asn His Asp Asp Ala Ser Gly Asp Ser Leu Cys Pro Met Asp Ile Leu His Ala Thr Gly Leu IleAsn His Gly Lys Val Ile Glu Ser Asp Lys Ile Lys Val Val Pro Leu Leu Phe Gln Lys Gly Ser Thr Lys Leu Ala Leu Tyr Gly Leu Ala Ala Val Asp Glu Arg Leu Phe Arg Thr Phe Lys Asp Gly Gly Val Thr Phe ValPro Thr Met Arg Glu Gly Glu Trp Phe Asn Leu Met Cys Val 2ln Asn His Thr Gly His Thr Asn Thr Ala Phe Leu Pro Glu Gln 222u Pro Asp Phe Leu Asp Met Val Ile Trp Gly His Glu His Glu225 234e Pro Asn Leu Val His AsnPro Ile Lys Asn Phe Asp Val Leu 245 25n Pro Gly Ser Ser Val Ala Thr Ser Leu Cys Glu Ala Glu Ala Gln 267s Tyr Val Phe Ile Leu Asp Ile Lys Tyr Gly Glu Ala Pro Lys 275 28t Thr Pro Ile Pro Leu Glu Thr Ile Arg Thr Phe 29Artificial SequenceDescription of Artificial Sequenceconsensus MREide 5Gly Asp Leu Phe His TArtificial SequenceDescription of Artificial Sequenceconsensus MREide 6Asn Lys Pro Ser Xaa Lys Xaa Leu Xaa TArtificialSequenceDescription of Artificial Sequenceconsensus MREide 7Cys Met Gly Asp Xaa Pro TArtificial SequenceDescription of Artificial Sequenceconsensus MREide 8Glu Xaa Leu Ser Asp TArtificial SequenceDescription of ArtificialSequenceconsensus MREide 9Val Asn Tyr Glx Asp RTArtificial SequenceDescription of Artificial Sequenceconsensus MREide le Ser Ile Pro Val Phe RTArtificial SequenceDescription of Artificial Sequenceconsensus MREidesn His Asp Asp RTArtificial SequenceDescription of Artificial Sequenceconsensus MREide sn His Phe Gly Xaa PRTArtificial SequenceDescription of Artificial Sequenceconsensus MREide ys Gly Ser Thr Lys Xaa AlaLeu Tyr Gly Leu 46PRTArtificial SequenceDescription of Artificial Sequenceconsensus MREide lu Arg Leu Xaa Arg RTArtificial SequenceDescription of Artificial Sequenceconsensus MREide he Asn Leu ArtificialSequenceDescription of Artificial Sequenceconsensus MREide aa Pro Glu Gln Phe Leu PRTArtificial SequenceDescription of Artificial Sequenceconsensus MREide he Xaa Asp Xaa Val Ile Trp Gly His Glu His Glu Cys 86PRTArtificial SequenceDescription of Artificial Sequenceconsensus MREide ro Gly Ser Ser Val DNAArtificial SequenceDescription of Artificial Sequence oligonucleotide duplex substrate for MREe-based assay agacagtggagtact accacbngtg tggcccaggn c 4AArtificial SequenceDescription of Artificial Sequence oligonucleotide duplex substrate for MREe-based assay 2ggcc acacagtggt agtactccac tgtctggctg 4RTArtificial SequenceDescription ofArtificial Sequencepoly Gly flexible linker 2y Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly ly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 2Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly35 4 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 5Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 65 7Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 85 9 Gly Gly Gly Gly Gly GlyGly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly GlyGly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly

* * * * *