BACKGROUND OF THE INVENTION

Pantothenate, also known as pantothenic acid or vitamin B5, is a member of the B complex of vitamins and is a nutritional requirement for mammals, including livestock and humans (e.g., from food sources, as a water soluble vitamin supplement oras a feed additive). In cells, pantothenate is used primarily for the biosynthesis of coenzyme A (CoA) and acyl carrier protein (ACP). These coenzymes function in the metabolism of acyl moieties which form thioesters with the sulfhydryl group of the4'-phosphopantetheine portion of these molecules. These coenzymes are essential in all cells, participating in over 100 different intermediary reactions in cellular metabolism.

The conventional means of synthesizing pantothenate (in particular, the bioactive D isomer) is via chemical synthesis from bulk chemicals, a process which is hampered by excessive substrate cost as well as the requirement for optical resolutionof racemic intermediates. Accordingly, researchers have recently looked to bacterial or microbial systems that produce enzymes useful in pantothenate biosynthesis processes (as bacteria are themselves capable of synthesizing pantothenate). Inparticular, bioconversion processes have been evaluated as a means of favoring production of preferred isomer of pantothenic acid. Moreover, methods of direct microbial synthesis have recently been examined as a means of facilitating D-pantothenateproduction.

There is still, however, significant need for improved pantothenate production processes, in particular, for microbial processes optimized to produce higher yields of desired product.

SUMMARY OF THE INVENTION

The present invention relates to improved processes (e.g., microbial syntheses) for the production of pantothenate. In particular, the present inventors have discovered that deregulation of the pantothenate biosynthetic pathway and/orderegulation of the isoleucine-valine (ilv) pathway in microorganisms, in addition to producing significantly increased pantoate and/or pantothenate titers, results in the synthesis of an alternate product, namely[R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid or 3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid ("HMBPA"), referred to interchangeably herein as ".beta.-alanine 2-(R)-hydroxyisolvalerate", ".beta.-alanine 2-hydroxyisolvalerate",".beta.-alanyl-.alpha.-hydroxyisovalerate" and/or "fantothenate". The pathway leading to HMBPA (referred to herein as the "HMBPA biosynthetic pathway") involves certain enzymes conventionally associated with pantothenate and/or isoleucine-valine (ilv)biosynthesis, which when overexpressed, are capable of additionally participating in the HMBPA biosynthetic pathway. In particular, the pathway includes conversion of .alpha.-ketoisovalerate to [R]-2-hydroxyisovalarate (.alpha.-HIV), catalyzed by areductase activity (e.g., PanE1, PanE2 and/or IlvC activities), followed by condensation of .alpha.-HIV with .beta.-alanine, catalyzed by PanC activity. As the alternative HMBPA biosynthetic pathway competes for key precursors of pantothenatebiosynthesis, namely .alpha.-ketoisovalerate (.alpha.-KIV) and .beta.-alanine, and also competes for enzymes conventionally associated with pantothenate biosynthesis, it is desirable to decrease or eliminate HMBPA biosynthesis in order to effectivelyincrease pantothenate biosynthesis.

Accordingly, in one aspect the present invention features a process for the production of a HMBPA-free pantothenate composition that includes culturing a microorganism having a deregulated pantothenate biosynthetic pathway under conditions suchthat a HMBPA-free pantothenate composition is produced. In another aspect, the invention features a process for the production of a HMBPA-free pantothenate composition that involves culturing a microorganism having a deregualted pantothenatebiosynthetic pathway and a deregulated isoleucine-valine (ilv) biosynthetic pathway, said microorganism having PanB activity regulated such that a HMBPA-free pantothenate composition is produced. Yet another aspect of the invention features a processfor the production of a HMBPA-free pantothenate composition that involves culturing a microorganism having a deregualted pantothenate biosynthetic pathway and a deregulated isoleucine-valine (ilv) biosynthetic pathway, the microorganism having PanEactivity regulated such that a HMBPA-free pantothenate composition is produced. In yet another aspect, the invention features a process for the production of a HMBPA-free pantothenate composition that involves culturing a microorganism having aderegualted pantothenate biosynthetic pathway and a deregulated isoleucine-valine (ilv) biosynthetic pathway, the microorganism having IlvC activity regulated such that a HMBPA-free pantothenate composition is produced. In yet another aspect, theinvention features a process for the production of a HMBPA-free pantothenate composition that involves culturing a microorganism having a deregualted pantothenate biosynthetic pathway and a deregulated isoleucine-valine (ilv) biosynthetic pathway, saidmicroorganism having PanB and PanE activites regulated such that a HMBPA-free pantothenate composition is produced. In yet another aspect, the invention features a process for the production of a HMBPA-free pantothenate composition that involvesculturing a microorganism having a deregualted pantothenate biosynthetic pathway and a deregulated isoleucine-valine (ilv) biosynthetic pathway, said microorganism having PanB and IlvC activites regulated such that a HMBPA-free pantothenate compositionis produced. Compositions produced according to the above-described methodologies are also featured as are microorganisms utilized in said methodologies. Also featured are processes for the production of a selectively mixed pantothenate:HMBPAcompositions.

Other features and advantages of the invention will be apparent from the following detailed description and claims.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic representation of the pantothenate and isoleucine-valine (ilv) biosynthetic pathways. Pantothenate biosynthetic enzymes are depicted in bold and their corresponding genes indicated in italics. Isoleucine-valine (ilv)biosynthetic enzymes are depicted in bold italics and their corresponding genes indicated in italics.

FIG. 2 is a schematic representation of the biosynthetic pathway leading to the formation [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid ("HMBPA") in B. subtilis.

FIG. 3 is a schematic depiction of the structure of [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid ("HMBPA").

FIG. 4 is a HPLC chromatogram of a sample of medium from a 14 L fermentation of PAS24.

FIG. 5 is a mass spectrum depicting the relative monoisotopic mass of 3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid.

FIG. 6 depicts an alignment of the C-terminal amino acids from known or suspected PanB proteins.

FIG. 7 is a schematic representation of the construction of the plasmid pAN624.

FIG. 8 is a schematic representation of the construction of the plasmid pAN620.

FIG. 9 is a schematic representation of the construction of the plasmid pAN636.

FIG. 10 is a schematic representation of the construction of the plasmid pAN637 which allows selection for single or multiple copies using chloramphenicol.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is based, at least in part, on the discovery of an alternative biosynthetic pathway in recombinant microorganisms which utilizes certain pantothenate and/or isoleucine-valine (ilv) biosynthetic enzymes and precursors to makea byproduct or side product called [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid ("HMBPA"). In particular, it has been discovered that bacteria that have been engineered to have deregulated pantothenate biosynthetic and/or isoleucine-valine(ilv) biosynthetic pathways are capable of generating HMBPA from .alpha.-ketoisovalerate (.alpha.-KIV), a key product of the isoleucine-valine (ilv) biosynthetic pathway and precursor of the pantothenate biosynthetic pathway. Production of HMBPA inbacteria utilizes at least the pantothenate biosynthetic enzymes ketopantoate reductase (the panE gene product), the panE2 gene product and/or acetohydroxyisomeroreductase (the ilvC gene product) and results from the condensation of[R]-2-hydroxyisovaleric acid (.alpha.-HIV), formed by reduction of .alpha.-KIV, and .beta.-alanine, the latter reaction being catalyzed by the pantothenate biosynthetic enzyme pantothenate synthetase (the panC gene product). The substrates .alpha.-KIVand .beta.-alanine can be utilized for both pantothenate production and HMBPA production, .beta.-alanine being provided, for example, by feeding and/or increased aspartate-.alpha.-decarboxylate activity (the panD gene product).

In order to decrease or eliminate competition for pantothenate biosynthesis precursors and/or biosynthetic enzymes, it is desireable to selectively regulate certain enzymes such that production is shifted away from HMBPA and towardspantoate/pantothenate. Preferably, microorganisms having a deregulated pantothenate biosynthetic pathway and/or a deregulated isoleucine-valine (ilv) biosynthetic pathway are further engineered such that PanB and/or PanE are selectively regulated. Selective regulation of PanB and/or PanE includes an optimization of levels of these enzymes such that production flows towards pantoate/pantothenate.

In particular, the invention features methods of producing compositions having increased ratios of pantothenate to HMBPA, preferably HMBPA-free pantothenate compositions. As used herein, the phrase "HMBPA-free pantothenate composition" describesa composition including pantothenate which is free of HMBPA and/or substantially free of HMBPA such that said composition includes insignificant amounts of HMBPA (i e., if HMBPA is present, it is present at a sufficiently low level or concentrationrelative to the level or concentration of pantothanate such that the composition can be considered HMBPA-free for technological, scientific and/or industrial purposes). Preferably, an HMBPA-free pantothenate composition includes pantothenate and, ifHMBPA is present, it is present at a ratio of 10:100 (i.e., 10% HMBPA versus 90% pantothenate, for example, as determined by comparing the peak areas when a sample of product is analyzed by HPLC) or less. More preferably, an HMBPA-free pantothenatecomposition includes pantothenate and, if HMBPA is present, it is present at a ratio of 9:100 (i.e., 9% HMBPA versus 91% pantothenate) or less. Even more preferably, a HMBPA-free pantothenate composition includes pantothenate and, if HMBPA is present,it is present at a ratio of 8:100 (i e., 8% HMBPA versus 92% pantothenate) or less, 7:100 (i.e., 7% HMBPA versus 93% pantothenate) or less, 6:100 (i.e., 6% HMBPA versus 94% pantothenate) or less or 5:100 (i.e., 5% HMBPA versus 95% pantothenate) or less. Even more preferably, a HMBPA-free pantothenate composition includes pantothenate and, if HMBPA is present, it is present at a ratio of 0.5:100 (i.e., 0.5% HMBPA versus 99.5% pantothenate) or less, 0.2:100 (i.e., 0.2% HMBPA versus 99.8% pantothenate) orless or 0.1:100 (i.e., 0.1% HMBPA versus 99.9% pantothenate) or less. Values and ranges included and/or intermediate of the values set forth herein are also intended to be within the scope of the present invention.

In one embodiment, the invention features a process for the production of a HMBPA-free pantothenate that includes culturing a microorganism having a deregulated pantothenate biosynthetic pathway under conditions such that a HMBPA-freepantothenate composition is produced. The term "pantothenate biosynthetic pathway" includes the biosynthetic pathway involving pantothenate biosynthetic enzymes (e.g., polypeptides encoded by biosynthetic enzyme-encoding genes), compounds (e.g.,substrates, intermediates or products), cofactors and the like utilized in the formation or synthesis of pantothenate. The term "pantothenate biosynthetic pathway" includes the biosynthetic pathway leading to the synthesis of pantothenate inmicroorganisms (e.g., in vivo) as well as the biosynthetic pathway leading to the synthesis of pantothenate in vitro.

As used herein, a microorganism "having a deregulated pantothenate biosynthetic pathway" includes a microorganism having at least one pantothenate biosynthetic enzyme deregulated (e.g., overexpressed) (both terms as defined herein) such thatpantothenate production is enhanced (e.g., as compared to pantothenate production in said microorganism prior to deregulation of said biosynthetic enzyme or as compared to a wild-type microorganism). The term "pantothenate" includes the free acid formof pantothenate, also referred to as "pantothenic acid" as well as any salt thereof (e.g., derived by replacing the acidic hydrogen of pantothenate or pantothenic acid with a cation, for example, calcium, sodium, potassium, ammonium), also referred to asa "pantothenate salt". The term "pantothenate" also includes alcohol derivatives of pantothenate. Preferred pantothenate salts are calcium pantothenate or sodium pantothenate. A preferred alcohol derivative is pantothenol; Pantothenate salts and/oralcohols of the present invention include salts and/or alcohols prepared via conventional methods from the free acids described herein. In another embodiment, a pantothenate salt is synthesized directly by a microorganism of the present invention. Apantothenate salt of the present invention can likewise be converted to a free acid form of pantothenate or pantothenic acid by conventional methodology. Preferably, a microorganism "having a deregulated pantothenate biosynthetic pathway" includes amicroorganism having at least one pantothenate biosynthetic enzyme deregulated (e.g., overexpressed) such that pantothenate production is 1 g/L or greater. More preferably, a microorganism "having a deregulated pantothenate biosynthetic pathway"includes a microorganism having at least one pantothenate biosynthetic enzyme deregulated (e.g., overexpressed) such that pantothenate production is 2 g/L or greater.

The term "pantothenate biosynthetic enzyme" includes any enzyme utilized in the formation of a compound (e.g., intermediate or product) of the pantothenate biosynthetic pathway. For example, synthesis of pantoate from .alpha.-ketoisovalerate(.alpha.-KIV) proceeds via the intermediate, ketopantoate. Formation of ketopantoate is catalyzed by the pantothenate biosynthetic enzyme PanB or ketopantoate hydroxymethyltransferase (the panB gene product). Formation of pantoate is catalyzed by thepantothenate biosynthetic enzyme PanE1 or ketopantoate reductase (the panE1 gene product). Synthesis of .beta.-alanine from aspartate is catalyzed by the pantothenate biosynthetic enzyme PanD or aspartate-.alpha.-decarboxylase (the panD gene product). Formation of pantothenate from pantoate and .beta.-alanine (e.g., condensation) is catalyzed by the pantothenate biosynthetic enzyme PanC or pantothenate synthetase (the panC gene product). Pantothenate biosynthetic enzymes may also perform analternative function as enzymes in the HMBPA biosynthetic pathway described herein.

Accordingly, in one embodient, the invention features a process for the production of a HMBPA-free composition of pantothenate that includes culturing a microorganism having at least one pantothenate biosynthetic enzyme deregulated (e.g.,deregulated such that pantothenate production is enhanced), said enzyme being selected, for example, from the group consisting of PanB (or ketopantoate hydroxymethyltransferase), PanC (or pantothenate synthetase), PanD (oraspartate-.alpha.-decarboxylase), PanE1 (or ketopantoate reductase). In another embodiment, the invention features a process for the production of a HMBPA-free composition of pantothenate that includes culturing a microorganism having at least twopantothenate biosynthetic enzymes deregulated, said enzymes being selected, for example, from the group consisting of PanB (or ketopantoate hydroxymethyltransferase), PanC (or pantothenate synthetase), PanD (or aspartate-.alpha.-decarboxylase), and PanE1(or ketopantoate reductase). In another embodiment, the invention features a process for the production of a HMBPA-free composition of pantothenate that includes culturing a microorganism having at least three pantothenate biosynthetic enzymesderegulated, said enzymes being selected, for example, from the group consisting of PanB (or ketopantoate hydroxymethyltransferase), PanC (or pantothenate synthetase), PanD (or aspartate-.alpha.-decarboxylase), and PanE1 (or ketopantoate reductase). Inanother embodiment the invention features a process for the production of a HMBPA-free composition of pantothenate that includes culturing a microorganism having at least four pantothenate biosynthetic enzymes deregulated, for example, a microorganismhaving panB (or ketopantoate hydroxymethyltransferase), PanC (or pantothenate synthetase), PanD (or aspartate-a-decarboxylase), and PanE1 (or ketopantoate reductase) deregulated.

In another aspect, the invention features a process for the production of a HMBPA-free pantothenate that includes culturing a microorganism having a deregulated pantothenate biosynthetic pathway under conditions such that a HMBPA-freepantothenate composition is produced, the microorganism further having a deregulated isoleucine-valine biosynthetic pathway. The term "isoleucine-valine biosynthetic pathway" includes the biosynthetic pathway involving isoleucine-valine biosyntheticenzymes (e.g., polypeptides encoded by biosynthetic enzyme-encoding genes), compounds (e.g., substrates, intermediates or products), cofactors and the like utilized in the formation or synthesis of conversion of pyruvate to valine or isoleucine. Theterm "isoleucine-valine biosynthetic pathway" includes the biosynthetic pathway leading to the synthesis of valine or isoleucine in microorganisms (e.g., in vivo) as well as the biosynthetic pathway leading to the synthesis of valine or isoleucine invitro.

As used herein, a microorganism "having a deregulated isoleucine-valine (ilv) pathway" includes a microorganism having at least one isoleucine-valine (ilv) biosynthetic enzyme deregulated (e.g., overexpressed) (both terms as defined herein) suchthat isoleucine and/or valine and/or the valine precursor, (.alpha.-ketoisovaerate (.alpha.-KIV) production is enhanced (e.g., as compared to isoleucine and/or valine and/or .alpha.-KIV production in said microorganism prior to deregulation of saidbiosynthetic enzyme or as compared to a wild-type microorganism). FIG. 1 includes a schematic representation of the isoleucine-valine biosynthetic pathway. Isoleucine-valine biosynthetic enzymes are depicted in bold italics and their correspondinggenes indicated in italics. The term "isoleucine-valine biosynthetic enzyme" includes any enzyme utilized in the formation of a compound (e.g., intermediate or product) of the isoleucine-valine biosynthetic pathway. According to FIG. 1, synthesis ofvaline from pyruvate proceeds via the intermediates, acetolactate, .alpha.,.beta.-dihydroxyisovalerate (.alpha.,.beta.-DHIV) and .alpha.-ketoisovalerate (.alpha.-KIV). Formation of acetolactate from pyruvate is catalyzed by the isoleucine-valinebiosynthetic enzyme acetohydroxyacid synthetase (the ilvBN gene products, or alternatively, the alsS gene product). Formation of .alpha.,.beta.-DHIV from acetolactate is catalyzed by the isoleucine-valine biosynthetic enzyme acetohydroxyacidisomeroreductase (the ilvC gene product). Synthesis of .alpha.-KIV from .alpha.,.beta.-DHIV is catalyzed by the isoleucine-valine biosynthetic enzyme dihydroxyacid dehydratase (the ilvD gene product). Moreover, valine and isoleucine can beinterconverted with their respective .alpha.-keto compounds by branched chain amino acid transaminases. Isoleucine-valine biosynthetic enzymes may also perform an alternative function as enzymes in the HMBPA biosynthetic pathway described herein.

Accordingly, in one embodient, the invention features a process for the production of a HMBPA-free composition of pantothenate that includes culturing a microorganism having at least one isoleucine-valine (ilv) biosynthetic enzyme deregulated(e.g., deregulated such that valine and/or isoleucine and/or .alpha.-KIV production is enhanced), said enzyme being selected, for example, from the group consisting of IlvBN, AlsS (or acetohydroxyacid synthetase), IlvC (or acetohydroxyacidisomeroreductase) and IlvD (or dihydroxyacid dehydratase). In another embodiment, the invention features a process for the production of a HMBPA-free composition of pantothenate that includes culturing a microorganism having at least twoisoleucine-valine (ilv) biosynthetic enzymes deregulated, said enzyme being selected, for example, from the group consisting of IlvBN, AlsS (or acetohydroxyacid synthetase), IlvC (or acetohydroxyacid isomeroreductase) and IlvD (or dihydroxyaciddehydratase). In another embodiment, the invention features a process for the production of a HMBPA-free composition of pantothenate that includes culturing a microorganism having at least three isoleucine-valine (ilv) biosynthetic enzymes deregulated,for example, said microorganism having IlvBN or AlsS (or acetohydroxyacid synthetase), IlvC (or acetohydroxyacid isomeroreductase) and IlvD (or dihydroxyacid dehydratase) deregulated.

As mentioned herein, enzymes of the pantothenate biosynthetic pathway and/or the isoleucine-valine (ilv) pathway have been discovered to have an alternative activity in the synthesis of [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid("HMBPA") or the [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid ("HMBPA") biosynthetic pathway. The term "[R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid ("HMBPA") biosynthetic pathway" includes the alternative biosynthetic pathwayinvolving biosynthetic enzymes and compounds (e.g., substrates and the like) traditionally associated with the pantothenate biosynthetic pathway and/or isoleucine-valine (ilv) biosynthetic pathway utilized in the formation or synthesis of HMBPA. Theterm "HMBPA biosynthetic pathway" includes the biosynthetic pathway leading to the synthesis of HMBPA in microorganisms (e.g., ;i? vivo) as well as the biosynthetic pathway leading to the synthesis of HMBPA in vitro.

The term "HMBPA biosynthetic enzyme" includes any enzyme utilized in the formation of a compound (e.g., intermediate or product) of the HMBPA biosynthetic pathway. For example, synthesis of 2-hydroxyisovaleric acid (.alpha.-HIV) from.alpha.-ketoisovalerate (.alpha.-KIV) is catalyzed by the panE1 or panE2 gene product (PanE1 is alternatively referred to herein as ketopantoate reductase) and/or is catalyzed by the ilvC gene product (alternatively referred to herein as acetohydroxyacidisomeroreductase). Formation of HMBPA from .beta.-alanine and .alpha.-HIV is catalyzed by the panC gene product (alternatively referred to herein as pantothenate synthetase).

The term "[R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid ("HMBPA")" includes the free acid form of HMBPA, also referred to as "[R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionate" as well as any salt thereof (e.g., derived by replacing theacidic hydrogen of 3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid or 3-(2-hydroxy-3-methyl-butyrylamino)-propionate with a cation, for example, calcium, sodium, potassium, ammonium), also referred to as a"3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid salt" or "HMBPA salt". Preferred HMBPA salts are calcium HMBPA or sodium HMBPA. HMBPA salts of the present invention include salts prepared via conventional methods from the free acids describedherein. An HMBPA salt of the present invention can likewise be converted to a free acid form of 3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid or 3-(2-hydroxy-3-methyl-butyrylamino)-propionate by conventional methodology.

Based at least in part on the discovery that overexpression or deregulation of the pantothenate biosynthetic pathway and/or isoleucine-valine (ilv) pathway can result in alternative production of HMBPA (as compared to desired pantothenateproduction), the present invention features processes for the production of HMBPA-free pantothenate that involve culturing microorganisms that not only have the pantothenate biosynthetic pathway and/or the isoleucine-valine (ilv) pathway deregulated, butthat further have certain enzymes selectively regulated such that production of HMBPA-free pantothenate compositions is favored. As defined herein, the term "selectively regulated" includes selecting for regulation or targeting a particular enzyme orenzymes from the pantothenate biosynthetic pathway or the isoleucine-valine (ilv) pathway known to be involved in both pantothenate and HMBPA synthesis in a manner that favors pantothenate production over HMBPA production. Preferred enzymes selected ortargeted for regulation include PanE1, PanE2, PanB and/or IlvC.

In one embodiment, Pan E1 is selectively regulated. For example, the present inventors have discovered that overexpression of PanE1 can catalyze HMBPA precursor formation, therefore selectively regulating the amount or activity (e.g., toslightly decrease PanE1 levels or activity) can shift formation from HMBPA production to pantothenate production (i e., favor pantothenate production over HMBPA production). Moreover, it has been discovered that PanE2 favors HMBPA production. Accordingly, another embodiment, features deleting or regulating panE2.

Likewise, the present inventors have discovered that increasing PanB activity can shift formation from the alternative HMBPA biosynthetic pathway to the pantothenate biosynthetic pathway, therefore selectively regulating the amount or activity ofPanB can favor pantothenate production over HMBPA production. In one embodiment, PanB activity is increased by overexpressing or deregulating the panB gene. In another embodiment, PanB activity is increased by expressing multiple copies of the panBgene. PanB activity can be increased by decreasing feedback inhibtion of PanB. In particular, is has been discovered that PanB activity can be increased by regulating (e.g., selectively regulating) pantothenate kinase, a key enzyme in the formation ofCoenzyme A (CoA) from pantothenate (see e.g., U.S. patent application Ser. No. 09/09/667,569). Regulation of pantothenate kinase (e.g., decreasing the activity or level of pantothenate kinase) reduced the production of CoA, in turn reducing feedbackinhibition of PanB as well as favoring pantothenate accumulation. In one embodiment, pantothenate kinase activity is decreased (and PanB activity is in turn increased) by deleting CoaA and downregulating CoaX activity (CoaA and CoaX are both capable ofcatalyzing the first step in CoA biosynthesis in certain microorganisms). In another embodiment, pantothenate kinase activity is decreased (and PanB activity is in turn increased) by deleting CoaX and downregulating CoaA. In yet another embodiment,pantothenate kinase activity is decreased (and PanB activity is in turn increased) by downregulating CoaA and CoaX activities.

Yet another aspect of the present invention features processes for the production of HMBPA-free pantothenate that include culturing microorganisms under culture conditions selected to favor pantothenate production over HMBPA production. Inparticular, it has been discovered that conditions including, but not limited to, reduced steady state glucose, increased steady state dissolved oxygen and/or excess serine favor pantothenate production over HMBPA production. The term "reduced steadystate glucose" includes steady state glucose levels less or lower that those routinely utilized for culturing the microorganism in question. For example, culturing the Bacillus microorganisms described in the instant Examples is routinely done in thepresence of about 0.2 1.0 g/L steady state glucose. Accordingly, reduced steady state glucose levels preferably include levels of less than 0.2 g.L steady state glucose. The term "increased steady state dissolved oxygen" includes steady state dissolvedoxygen levels increased or higher than those routinely utilized for culturing the microorganism in question and, for example, inversely correlates with reduced steady state glucose levels. For example, culturing the Bacillus microorganisms described inthe instant Examples is routinely done in the presence of about 10 30% dissolved oxygen. Accordingly, increased steady state dissolved oxygen can include levels of greater that 30% dissolved oxygen, preferably as great as 95% dissolved oxygen. The term"excess serine" includes serine levels increased or higher that those routinely utilized for culturing the microorganism in question. For example, culturing the Bacillus microorganisms described in the instant Examples is routinely done in the presenceof about 0 2.5 g/L serine. Accordingly, excess serine levels can include levels of greater than 2.5 g/L serine, preferably between about 2.5 and 20 g/L serine.

In yet another embodiment, HMBPA production is favored by increasing pantothenate and/or isoleucine-valine (ilv) biosynthetic pathway precursors and/or intermediates as defined herein (e.g., culturing microorganisms in the presence of excess.beta.-alanine, valine and/or .alpha.-KIV) or, alternatively, culturing microorganisms capable of producing significant levels of .beta.-alanine in the absence of a .beta.-alanine feed (i e., .beta.-alanine independent microorganisms, as described inU.S. patent application Ser. No. 09/09/667,569).

Various aspects of the invention are described in further detail in the following subsections.

I. Targeting Genes Encoding Various Pantothenate and/or Isoleucine-Valine(ilv) and/or HMBPA Biosynthetic Enzymes

In one embodiment, the present invention features targeting or modifying various biosynthetic enzymes of the pantothenate and/or isoleucine-valine(ilv) and/or HMBPA biosynthetic pathways. In particular, the invention features modifying variousenzymatic activities associated with said pathways by modifying or altering the genes encoding said biosynthetic enzymes.

The term "gene", as used herein, includes a nucleic acid molecule (e.g., a DNA molecule or segment thereof) that, in an organism, can be separated from another gene or other genes, by intergenic DNA (i.e., intervening or spacer DNA whichnaturally flanks the gene and/or separates genes in the chromosomal DNA of the organism). Alternatively, a gene may slightly overlap another gene (e.g., the 3' end of a first gene overlapping the 5' end of a second gene), the overlapping genes separatedfrom other genes by intergenic DNA. A gene may direct synthesis of an enzyme or other protein molecule (e.g., may comprise coding sequences, for example, a contiguous open reading frame (ORF) which encodes a protein) or may itself be functional in theorganism. A gene in an organism, may be clustered in an operon, as defined herein, said operon being separated from other genes and/or operons by the intergenic DNA. An "isolated gene", as used herein, includes a gene which is essentially free ofsequences which naturally flank the gene in the chromosomal DNA of the organism from which the gene is derived (i.e., is free of adjacent coding sequences that encode a second or distinct protein, adjacent structural sequences or the like) and optionallyincludes 5' and 3' regulatory sequences, for example promoter sequences and/or terminator sequences. In one embodiment, an isolated gene includes predominantly coding sequences for a protein (e.g., sequences which encode Bacillus proteins). In anotherembodiment, an isolated gene includes coding sequences for a protein (e.g., for a Bacillus protein) and adjacent 5' and/or 3' regulatory sequences from the chromosomal DNA of the organism from which the gene is derived (e.g., adjacent 5' and/or 3'Bacillus regulatory sequences). Preferably, an isolated gene contains less than about 10 kb, 5 kb, 2 kb, 1 kb, 0.5 kb, 0.2 kb, 0.1 kb, 50 bp, 25 bp or 10 bp of nucleotide sequences which naturally flank the gene in the chromosomal DNA of the organismfrom which the gene is derived.

The term "operon" includes at least two adjacent genes or ORFs, optionally overlapping in sequence at either the 5' or 3' end of at least one gene or ORF. The term "operon" includes a coordinated unit of gene expression that contains a promoterand possibly a regulatory element associated with one or more adjacent genes or ORFs (e.g., structural genes encoding enzymes, for example, biosynthetic enzymes). Expression of the genes (e.g., structural genes).can be coordinately regulated, forexample, by regulatory proteins binding to the regulatory element or by anti-termination of transcription. The genes of an operon (e.g., structural genes) can be transcribed to give a single mRNA that encodes all of the proteins.

A "gene having a mutation" or "mutant gene" as used herein, includes a gene having a nucleotide sequence which includes at least one alteration (e.g., substitution, insertion, deletion) such that the polypeptide or protein encoded by said mutantexhibits an activity that differs from the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene. In one embodiment, a gene having a mutation or mutant gene encodes a polypeptide or protein having an increased activity ascompared to the polypeptide or protein encoded by the wild-type gene, for example, when assayed under similar conditions (e.g.,assayed in microorganisms cultured at the same temperature). As used herein, an "increased activity" or "increased enzymaticactivity" is one that is at least 5% greater than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene, preferably at least 5 10% greater, more preferably at least 10 25% greater and even more preferably at least 2550%, 50 75% or 75 100% greater than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene. Ranges intermediate to the above-recited values, e.g., 75 85%, 85 90%, 90 95%, are also intended to be encompassed by thepresent invention. As used herein, an "increased activity" or "increased enzymatic activity" can also include an activity that is at least 1.25-fold greater than the activity of the polypeptide or protein encoded by the wild-type gene, preferably atleast 1.5-fold greater, more preferably at least 2-fold greater and even more preferably at least 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold greater than the activity of the polypeptide or protein encoded by the wild-type gene.

In another embodiment, a gene having a mutation or mutant gene encodes a polypeptide or protein having a reduced activity as compared to the polypeptide or protein encoded by the wild-type gene, for example, when assayed under similar conditions(e.g., assayed in microorganisms cultured at the same temperature). A mutant gene also can encode no polypeptide or have a reduced level of production of the wild-type polypeptide. As used herein, a "reduced activity" or "reduced enzymatic activity" isone that is at least 5% less than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene, preferably at least 5 10% less, more preferably at least 10 25% less and even more preferably at least 25 50%, 50 75% or 75 100%less than that of the polypeptide or protein encoded by the wild-type nucleic acid molecule or gene. Ranges intermediate to the above-recited values, e.g., 75 85%, 85 90%, 90 95%, are also intended to be encompassed by the present invention. As usedherein, a "reduced activity" or "reduced enzymatic activity" can also include an activity that has been deleted or "knocked out" (e.g., approximately 100% less activity than that of the polypeptide or protein encoded by the wild-type nucleic acidmolecule or gene).

Activity can be determined according to any well accepted assay for measuring activity of a particular protein of interest. Activity can be measured or assayed directly, for example, measuring an activity of a protein isolated or purified from acell or microorganism. Alternatively, an activity can be measured or assayed within a cell or microorganism or in an extracellular medium. For example, assaying for a mutant gene (i.e., said mutant encoding a reduced enzymatic activity) can beaccomplished by expressing the mutated gene in a microorganism, for example, a mutant microorganism in which the enzyme is a temperature-sensitive, and assaying the mutant gene for the ability to complement a temperature sensitive (Ts) mutant forenzymatic activity. A mutant gene that encodes an "increased enzymatic activity" can be one that complements the. Ts mutant more effectively than, for example, a corresponding wild-type gene. A mutant gene that encodes a "reduced enzymatic activity"is one that complements the Ts mutant less effectively than, for example, a corresponding wild-type gene.

It will be appreciated by the skilled artisan that even a single substitution in a nucleic acid or gene sequence (e.g., a base substitution that encodes an amino acid change in the corresponding amino acid sequence) can dramatically affect theactivity of an encoded polypeptide or protein as compared to the corresponding wild-type polypeptide or protein. A mutant gene (e.g., encoding a mutant polypeptide or protein), as defined herein, is readily distinguishable from a nucleic acid or geneencoding a protein homologue in that a mutant gene encodes a protein or polypeptide having an altered activity, optionally observable as a different or distinct phenotype in a microorganism expressing said mutant gene or producing said mutant protein orpolypeptide (i.e., a mutant microorganism) as compared to a corresponding microorganism expressing the wild-type gene. By contrast, a protein homologue can have an identical or substantially similar activity, optionally phenotypically indiscernable whenproduced in a microorganism, as compared to a corresponding microorganism expressing the wild-type gene. Accordingly it is not, for example, the degree of sequence identity between nucleic acid molecules, genes, protein or polypeptides that serves todistinguish between homologues and mutants, rather it is the activity of the encoded protein or polypeptide that distinguishes between homologues and mutants: homologues having, for example, low (e.g., 30 50% sequence identity) sequence identity yethaving substantially equivalent functional activities, and mutants, for example sharing 99% sequence identity yet having dramatically different or altered functional activities.

It will also be appreciated by the skilled artisan that nucleic acid molecules, genes, protein or polypeptides for use in the instant invention can be derived from any microorganisms having a HMBPA biosynthetic pathway, an ilv biosyntheticpathway or a pantothenate biosynthetic pathway. Such nucleic acid molecules, genes, protein or polypeptides can be identified by the skilled artisan using known techniques such as homology screening, sequence comparison and the like, and can be modifiedby the skilled artisan in such a way that expression or production of these nucleic acid molecules, genes, protein or polypeptides occurs in a recombinant microorganism (e.g., by using appropriate promotors, ribosomal binding sites, expression orintegration vectors, modifying the sequence of the genes such that the transcription is increased (taking into account the preferable codon usage), etc., according to techniques described herein and those known in the art).

In one embodiment, the genes of the present invention are derived from a Gram positive microorganism organism (e.g., a microorganism which retains basic dye, for example, crystal violet, due to the presence of a Gram-positive wall surrounding themicroorganism). The term "derived from" (e.g., "derived from" a Gram positive microorganism) refers to a gene which is naturally found in the microorganism (e.g., is naturally found in a Gram positive microorganism). In a preferred embodiment, thegenes of the present invention are derived from a microorganism belonging to a genus selected from the group consisting of Bacillus, Corynebacterium (e.g., Corynebacterium glutamicum), Lactobacillus, Lactococci and Streptomyces. In a more preferredembodiment, the genes of the present invention are derived from a microorganism is of the genus Bacillus. In another preferred embodiment, the genes of the present invention are derived from a microorganism selected from the group consisting of Bacillussubtilis, Bacillus lentimorbus, Bacillus lentus, Bacillus firmus, Bacillus pantothenticus, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus circulans, Bacillus coagulans, Bacillus licheniformis, Bacillus magaterium, Bacillus pumilus, Bacillusthuringiensis, Bacillus halodurans, and other Group 1 Bacillus species, for example, as characterized by 16S rRNA type. In another preferred embodiment, the gene is derived from Bacillus brevis or Bacillus stearothermophilus. In another preferredembodiment, the genes of the present invention are derived from a microorganism selected from the group consisting of Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis, and Bacillus pumilus. In a particularly preferred embodiment,the gene is derived from Bacillus subtilis (e.g., is Bacillus subtilis-derived). The term "derived from Bacillus subtilis" or "Bacillus subtilis-derived" includes a gene which is naturally found in the microorganism Bacillus subtilis. Included withinthe scope of the present invention are Bacillus-derived genes (e.g., B. subtilis-derived genes), for example, Bacillus or B. subtilis coaX genes, serA genes, glyA genes, coaA genes, pan genes and/or ilv genes.

In another embodiment, the genes of the present invention are derived from a Gram negative (excludes basic dye) microorganism. In a preferred embodiment, the genes of the present invention are derived from a microorganism belonging to a genusselected from the group consisting of Salmonella (e.g., Salmonella typhimurium), Escherichia, Klebsiella, Serratia, and Proteus. In a more preferred embodiment, the genes of the present invention are derived from a microorganism of the genusEscherichia. In an even more preferred embodiment, the genes of the present invention are derived from Escherichia coli. In another embodiment, the genes of the present invention are derived from Saccharomyces (e.g., Saccharomyces cerevisiae).

II Recombinant Nucleic Acid Molecules and Vectors

The present invention further features recombinant nucleic acid molecules (e.g., recombinant DNA molecules) that include genes described herein (e.g., isolated genes), preferably Bacillus genes, more preferably Bacillus subtilis genes, even morepreferably Bacillus subtilis pantothenate biosynthetic genes and/or isoleucine-valine (ilv) biosynthetic genes and/or HMBPA biosynthetic genes. The term "recombinant nucleic acid molecule" includes a nucleic acid molecule (e.g., a DNA molecule) that hasbeen altered, modified or engineered such that it differs in nucleotide sequence from the native or natural nucleic acid molecule from which the recombinant nucleic acid molecule was derived (e.g., by addition, deletion or substitution of one or morenucleotides). Preferably, a recombinant nucleic acid molecule (e.g., a recombinant DNA molecule) includes an isolated gene of the present invention operably linked to regulatory sequences. The phrase "operably linked to regulatory sequence(s)" meansthat the nucleotide sequence of the gene of interest is linked to the regulatory sequence(s) in a manner which allows for expression (e.g., enhanced, increased, constitutive, basal, attenuated, decreased or repressed expression) of the gene, preferablyexpression of a gene product encoded by the gene (e.g., when the recombinant nucleic acid molecule is included in a recombinant vector, as defined herein, and is introduced into a microorganism).

The term "regulatory sequence" includes nucleic acid sequences which affect (e.g., modulate or regulate) expression of other nucleic acid sequences (i.e., genes). In one embodiment, a regulatory sequence is included in a recombinant nucleic acidmolecule in a similar or identical position and/or orientation relative to a particular gene of interest as is observed for the regulatory sequence and gene of interest as it appears in nature, e.g., in a native position and/or orientation. For example,a gene of interest can be included in a recombinant nucleic acid molecule operably linked to a regulatory sequence which accompanies or is adjacent to the gene of interest in the natural organism (e.g., operably linked to "native" regulatory sequences(e.g. to the "native" promoter). Alternatively, a gene of interest can be included in a recombinant nucleic acid molecule operably linked to a regulatory sequence which accompanies or is adjacent to another (e.g., a different) gene in the naturalorganism. Alternatively, a gene of interest can be included in a recombinant nucleic acid molecule operably linked to a regulatory sequence from another organism. For example, regulatory sequences from other microbes (e.g., other bacterial regulatorysequences, bacteriophage regulatory sequences and the like) can be operably linked to a particular gene of interest.

In one embodiment, a regulatory sequence is a non-native or non-naturally-occurring sequence (e.g., a sequence which has been modified, mutated, substituted, derivatized, deleted including sequences which are chemically synthesized). Preferredregulatory sequences include promoters, enhancers, termination signals, anti-termination signals and other expression control elements (e.g., sequences to which repressors or inducers bind and/or binding sites for transcriptional and/or translationalregulatory proteins, for example, in the transcribed mRNA). Such regulatory sequences are described, for example, in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, ColdSpring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in a microorganism (e.g., constitutive promoters and strong constitutive promoters), thosewhich direct inducible expression of a nucleotide sequence in a microorganism (e.g., inducible promoters, for example, xylose inducible promoters) and those which attenuate or repress expression of a nucleotide sequence in a microorganism (e.g.,attenuation signals or repressor sequences). It is also within the scope of the present invention to regulate expression of a gene of interest by removing or deleting regulatory sequences. For example, sequences involved in the negative regulation oftranscription can be removed such that expression of a gene of interest is enhanced.

In one embodiment, a recombinant nucleic acid molecule of the present invention includes a nucleic acid sequence or gene that encodes at least one bacterial gene product (e.g., a pantothenate biosynthetic enzyme, an isoleucine-valine biosyntheticenzyme and/or a HMBPA biosynthetic enzyme) operably linked to a promoter or promoter sequence. Preferred promoters of the present invention include Bacillus promoters and/or bacteriophage promoters (e.g., bacteriophage which infect Bacillus). In oneembodiment, a promoter is a Bacillus promoter, preferably a strong Bacillus promoter (e.g., a promoter associated with a biochemical housekeeping gene in Bacillus or a promoter associated with a glycolytic pathway gene in Bacillus). In anotherembodiment, a promoter is a bacteriophage promoter. In a preferred embodiment, the promoter is from the bacteriophage SP01. In a particularly preferred embodiment, a promoter is selected from the group consisting of P.sub.15, P.sub.26 or P.sub.veg,having for example, the following respective sequences: GCTATTGACGACAGCTATGGTTCACTGTCCACCAACCAAAACTGTGCTCAGTACCGCCAATATTTCTCCCTTG- AGGGGTACAAAGAGGTGTCCCTAGAAGAGATCCACGCTGTGTAAAAATTTTACAAAAAGGTATTGACTTTCCCT-ACAGGGTGTGTAATAATTTAATTACAGGCGGGGGCAACCCCGCCTGT(SEQ ID NO: 1), GCCTACCTAGCTTCCAAGAAAGATATCCTAACAGCACAAGAGCGGAAAGATGTTTTGTTCTACATCCAGAACA- ACCTCTGCTAAAATTCCTGAAAAATTTTGCAAAAAGTTGTTGACTTTATCTACAAGGTGTGGTATAATAATCTT- AACAACAGCAGGACGC (SEQ ID NO:2), andGAGGAATCATAGAATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTA- TTTGACAAAAATGGGCTCGTGTTGTACAATAAATGTAGTGAGGTGGATGCAATG (SEQ ID NO:3). Additional preferred promoters include tef (the translational elongation factor (TEF) promoter) and pyc (thepyruvate carboxylase (PYC) promoter), which promote high level expression in Bacillus (e.g., Bacillus subtilis). Additional preferred promoters, for example, for use in Gram positive microorganisms include, but are not limited to, amy and SPO2promoters. Additional preferred promoters, for example, for use in Gram negative microorganisms include, but are not limited to, cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacIQ, T7, T5, T3, gal, trc, ara, SP6, .lamda.-PR or .lamda.-PL.

In another embodiment, a recombinant nucleic acid molecule of the present invention includes a terminator sequence or terminator sequences (e.g., transcription terminator sequences). The term "terminator sequences" includes regulatory sequencesthat serve to terminate transcription of mRNA. Terminator sequences (or tandem transcription terminators) can further serve to stabilize mRNA (e.g., by adding structure to mRNA), for example, against nucleases.

In yet another embodiment, a recombinant nucleic acid molecule of the present invention includes sequences that allow for detection of the vector containing said sequences (i.e., detectable and/or selectable markers), for example, genes thatencode antibiotic resistance sequences or that overcome auxotrophic mutations, for example, trpC, drug markers, fluorescent markers, and/or colorimetric markers (e.g., lacZ/.beta.-galactosidase). In yet another embodiment, a recombinant nucleic acidmolecule of the present invention includes an artificial ribosome binding site (RBS) or a sequence that gets transcribed into an artificial RBS. The term "artificial ribosome binding site (RBS)" includes a site within an mRNA molecule (e.g., codedwithin DNA) to which a ribosome binds (e.g., to initiate translation) which differs from a native RBS (e.g., a RBS found in a naturally-occurring gene) by at least one nucleotide. Preferred artificial RBSs include about 5 6, 7 8, 9 10, 11 12, 13 14, 1516, 17 18, 19 20, 21 22, 23 24, 25 26, 27 28, 29 30 or more nucleotides of which about 1 2, 3 4, 5 6, 7 8, 9 10, 11 12, 13 15 or more differ from the native RBS (e.g., the native RBS of a gene of interest, for example, the native panB RBSTAAACATGAGGAGGAGAAAACATG (SEQ ID NO:4) or the native panD RBS ATTCGAGAAATGGAGAGAATATAATATG (SEQ ID NO:5)). Preferably, nucleotides that differ are substituted such that they are identical to one or more nucleotides of an ideal RBS when optimally alignedfor comparisons. Ideal RBSs include, but are not limited to, AGAAAGGAGGTGA (SEQ ID NO:6), TTAAGAAAGGAGGTGANNNNATG (SEQ ID NO:7), TTAGAAAGGAGGTGANNNNNATG (SEQ ID NO:8), AGAAAGGAGGTGANNNNNNNATG (SEQ ID NO:9), and AGAAAGGAGGTGANMNNATG (SEQ ID NO:10). Artificial RBSs can be used to replace the naturally-occurring or native RBSs associated with a particular gene. Artificial RBSs preferably increase translation of a particular gene. Preferred artificial RBSs (e.g., RBSs for increasing the translationof panB, for example, of B. subtilis panB) include CCCTCTAGAAGGAGGAGAAAACATG (SEQ ID NO:11) and CCCTCTAGAGGAGGAGAAAACATG (SEQ ID NO:12). Preferred artificial RBSs (e.g., RBSs for increasing the translation of panD, for example, of B. subtilis panD)include TTAGAAAGGAGGATTTAAATATG (SEQ ID NO:13), TTAGAAAGGAGGTTTAATTAATG (SEQ ID NO:14), TTAGAAAGGAGGTGATTTAAATG (SEQ ID NO:15), TTAGAAAGGAGGTGTTTAAAATG (SEQ ID NO:16), ATTCGAGAAAGGAGGTGAATATAATATG (SEQ ID NO:17), ATTCGAGAAAGGAGGTGAATAATAATG (SEQ IDNO:18) and ATTCGTAGAAAGGAGGTGAATTAATATG (SEQ ID NO:19).

The present invention further features vectors (e.g., recombinant vectors) that include nucleic acid molecules (e.g., genes or recombinant nucleic acid molecules comprising said genes) as described herein. The term "recombinant vector" includesa vector (e.g., plasmid, phage, phasmid, virus, cosmid or other purified nucleic acid vector) that has been altered, modified or engineered such that it contains greater, fewer or different nucleic acid sequences than those included in the native ornatural nucleic acid molecule from which the recombinant vector was derived. Preferably, the recombinant vector includes a biosynthetic enzyme-encoding gene or recombinant nucleic acid molecule including said gene, operably linked to regulatorysequences, for example, promoter sequences, terminator sequences and/or artificial ribosome binding sites (RBSs), as defined herein. In another embodiment, a recombinant vector of the present invention includes sequences that enhance replication inbacteria (e.g., replication-enhancing sequences). In one embodiment, replication-enhancing sequences function in E. coli. In another embodiment, replication-enhancing sequences are derived from pBR322.

In yet another embodiment, a recombinant vector of the present invention includes antibiotic resistance sequences. The term "antibiotic resistance sequences" includes sequences which promote or confer resistance to antibiotics on the hostorganism (e g, Bacillus). In one embodiment, the antibiotic resistance sequences are selected from the group consisting of cat (chloramphenicol resistance) sequences, tet (tetracycline resistance) sequences, erm (erythromycin resistance) sequences, neo(neomycin resistance) sequences, kan (kanamycin resistence) sequences and spec (spectinomycin resistance) sequences. Recombinant vectors of the present invention can further include homologous recombination sequences (e.g., sequences designed to allowrecombination of the gene of interest into the chromosome of the host organism). For example, bpr; vpr; or amyE sequences can be used as homology targets for recombination into the host chromosome. It will further be appreciated by one of skill in theart that the design of a vector can be tailored depending on such factors as the choice of microorganism to be genetically engineered, the level of expression of gene product desired and the like.

IV Recombinant Microorganisms

The present invention further features microorganisms, i.e., recombinant microorganisms, that include vectors or genes (e.g., wild-type and/or mutated genes) as described herein. As used herein, the term "recombinant microorganism" includes amicroorganism (e.g., bacteria, yeast cell, fungal cell, etc.) that has been genetically altered, modified or engineered (e.g., genetically engineered) such that it exhibits an altered, modified or different genotype and/or phenotype (e.g., when thegenetic modification affects coding nucleic acid sequences of the microorganism) as compared to the naturally-occurring microorganism from which it was derived.

In one embodiment, a recombinant microorganism of the present invention is a Gram positive organism (e.g., a microorganism which retains basic dye, for example, crystal violet, due to the presence of a Gram-positive wall surrounding themicroorganism). In a preferred embodiment, the recombinant microorganism is a microorganism belonging to a genus selected from the group consisting of Bacillus, Corynebacterium, Lactobacillus, Lactococci and Streptomyces. In a more preferredembodiment, the recombinant microorganism is of the genus Bacillus. In another preferred embodiment, the recombinant microorganism is selected from the group consisting of Bacillus subtilis, Bacillus lentimorbus, Bacillus lentus, Bacillus firmus,Bacillus pantothenticus, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus circulans, Bacillus coagulans, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus thuringiensis, Bacillus halodurans, and other Group 1 Bacillus species,for example, as characterized by 16S rRNA type. In another preferred embodiment, the recombinant microorganism is Bacillus brevis or Bacillus stearothermophilus. In another preferred embodiment, the recombinant microorganism is selected from the groupconsisting of Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis, and Bacillus pumilus.

In another embodiment, the recombinant microorganism is a Gram negative (excludes basic dye) organism. In a preferred embodiment, the recombinant microorganism is a microorganism belonging to a genus selected from the group consisting ofSalmonella, Escherichia, Klebsiella, Serratia, and Proteus. In a more preferred embodiment, the recombinant microorganism is of the genus Escherichia. In an even more preferred embodiment, the recombinant microorganism is Escherichia coli. In anotherembodiment, the recombinant microorganism is Saccharomyces (e.g., S. cerevisiae).

A preferred "recombinant" microorganism of the present invention is a microorganism having a deregulated pantothenate biosynthesis pathway or enzyme, a deregulated isoleucine-valine (ilv) biosynthetic pathway or enzyme and/or a modified HMBPAbiosynthetic pathway or enzyme. The term "deregulated" or "deregulation" includes the alteration or modification of at least one gene in a microorganism that encodes an enzyme in a biosynthetic pathway, such that the level or activity of thebiosynthetic enzyme in the microorganism is altered or modified. Preferably, at least one gene that encodes an enzyme in a biosynthetic pathway is altered or modified such that the gene product is enhanced or increased. The phrase "deregulated pathway"can also include a biosynthetic pathway in which more than one gene that encodes an enzyme in a biosynthetic pathway is altered or modified such that the level or activity of more than one biosynthetic enzyme is altered or modified. The ability to"deregulate" a pathway (e.g., to simultaneously deregulate more than one gene in a given biosynthetic pathway) in a microorganism in some cases arises from the particular phenomenon of microorganisms in which more than one enzyme (e.g., two or threebiosynthetic enzymes) are encoded by genes occurring adjacent to one another on a contiguous piece of genetic material termed an "operon" (defined herein). Due to the coordinated regulation of genes included in an operon, alteration or modification ofthe single promoter and/or regulatory element can result in alteration or modification of the expression of each gene product encoded by the operon. Alteration or modification of the regulatory element can include, but is not limited to removing theendogenous promoter and/or regulatory element(s), adding strong promoters, inducible promoters or multiple promoters or removing regulatory sequences such that expression of the gene products is modified, modifying the chromosomal location of the operon,altering nucleic acid sequences adjacent to the operon or! within the operon such as a ribosome binding site, increasing the copy number of the operon, modifying proteins (e.g., regulatory proteins, suppressors, enhancers, transcriptional activators andthe like) involved in transcription of the operon and/or translation of the gene products of the operon, or any other conventional means of deregulating expression of genes routine in the art (including but not limited to use of antisense nucleic acidmolecules, for example, to block expression of repressor proteins). Deregulation can also involve altering the coding region of one or more genes to yield, for example, an enzyme that is feedback resistant or has a higher or lower specific activity.

In another preferred embodiment, a recombinant microorganism is designed or engineered such that at least one pantothenate biosynthetic enzyme, at least one isoleucine-valine biosynthetic enzyme, and/or at least one HMBPA biosynthetic enzyme isoverexpressed. The term "overexpressed" or "overexpression" includes expression of a gene product (e.g., a biosynthetic enzyme) at a level greater than that expressed prior to manipulation of the microorganism or in a comparable microorganism which hasnot been manipulated. In one embodiment, the microorganism can be genetically designed or engineered to overexpress a level of gene product greater than that expressed in a comparable microorganism which has not been engineered.

Genetic engineering can include, but is not limited to, altering or modifying regulatory sequences or sites associated with expression of a particular gene (e.g., by adding strong promoters, inducible promoters or multiple promoters or byremoving regulatory sequences such that expression is constitutive), modifying the chromosomal location of a particular gene, altering nucleic acid sequences adjacent to a particular gene such as a ribosome binding site, increasing the copy number of aparticular gene, modifying proteins (e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like) involved in transcription of a particular gene and/or translation of a particular gene product, or any other conventionalmeans of deregulating expression of a particular gene routine in the art (including but not limited to use of antisense nucleic acid molecules, for example, to block expression of repressor proteins). Genetic engineering can also include deletion of agene, for example, to block a pathway or to remove a repressor.

In another embodiment, the microorganism can be physically or environmentally manipulated to overexpress a level of gene product greater than that expressed prior to manipulation of the microorganism or in a comparable microorganism which has notbeen manipulated. For example, a microorganism can be treated with or cultured in the presence of an agent known or suspected to increase transcription of a particular gene and/or translation of a particular gene product such that transcription and/ortranslation are enhanced or increased. Alternatively, a microorganism can be cultured at a temperature selected to increase transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation areenhanced or increased.

V. Culturing and Fermenting Recombinant Microorganisms

The term "culturing" includes maintaining and/or growing a living microorganism of the present invention (e.g., maintaining and/or growing a culture or strain). In one embodiment, a microorganism of the invention is cultured in liquid media. Inanother embodiment, a microorganism of the invention is cultured in solid media or semi-solid media. In a preferred embodiment, a microorganism of the invention is cultured in media (e.g., a sterile, liquid medium) comprising nutrients essential orbeneficial to the maintenance and/or growth of the microorganism (e.g., carbon sources or carbon substrate, for example carbohydrate, hydrocarbons, oils, fats, fatty acids, organic acids, and alcohols; nitrogen sources, for example, peptone, yeastextracts, meat extracts, malt extracts, urea, ammonium sulfate, ammonium chloride, ammonium nitrate and ammonium phosphate; phosphorus sources, for example, phosphoric acid, sodium and potassium salts thereof; trace elements, for example, magnesium,iron, manganese, calcium, copper, zinc, boron, molybdenum, and/or cobalt salts; as well as growth factors such as amino acids, vitamins, growth promoters and the like).

Preferably, microorganisms of the present invention are cultured under controlled pH. The term "controlled pH" includes any pH which results in production of the desired product (e.g., pantoate and/or pantothenate). In one embodimentmicroorganisms are cultured at a pH of about 7. In another embodiment, microorganisms are cultured at a pH of between 6.0 and 8.5. The desired pH may be maintained by any number of methods known to those skilled in the art.

Also preferably, microorganisms of the present invention are cultured under controlled aeration. The term "controlled aeration" includes sufficient aeration (e.g., oxygen) to result in production of the desired product (e.g., pantoate and/orpantothenate). In one embodiment, aeration is controlled by regulating oxygen levels in the culture, for example, by regulating the amount of oxygen dissolved in culture media. Preferably, aeration of the culture is controlled by agitating the culture. Agitation may be provided by a propeller or similar mechanical agitation equipment, by revolving or shaking the cuture vessel (e.g., tube or flask) or by various pumping equipment. Aeration may be further controlled by the passage of sterile air oroxygen through the medium (e.g., through the fermentation mixture). Also preferably, microorganisms of the present invention are cultured without excess foaming (e.g., via addition of antifoaming agents).

Moreover, microorganisms of the present invention can be cultured under controlled temperatures. The term "controlled temperature" includes any temperature which results in production of the desired product (e.g., pantoate and/or pantothenate). In one embodiment, controlled temperatures include temperatures between 15.degree. C. and 95.degree. C. In another embodiment, controlled temperatures include temperatures between 15.degree. C. and 70.degree. C. Preferred temperatures are between20.degree. C. and 55.degree. C., more preferably between 30.degree. C. and 50.degree. C.

Microorganisms can be cultured (e.g., maintained and/or grown) in liquid media and preferably are cultured, either continuously or intermittently, by conventional culturing methods such as standing culture, test tube culture, shaking culture(e.g., rotary shaking culture, shake flask culture, etc.), aeration spinner culture, or fermentation. In a preferred embodiment, the microorganisms are cultured in shake flasks. In a more preferred embodiment, the microorganisms are cultured in afermentor (e.g., a fermentation process). Fermentation processes of the present invention include, but are not limited to, batch, fed-batch and continuous processes or methods of fermentation. The phrase "batch process" or "batch fermentation" refersto a system in which the composition of media, nutrients, supplemental additives and the like is set at the beginning of the fermentation and not subject to alteration during the fermentation, however, attempts may be made to control such factors as pHand oxygen concentration to prevent excess media acidification and/or microorganism death. The phrase "fed-batch process" or "fed-batch" fermentation refers to a batch fermentation with the exception that one or more substrates or supplements are added(e.g., added in increments or continuously) as the fermentation progresses. The phrase "continuous process" or "continuous fermentation" refers to a system in which a defined fermentation media is added continuously to a fermentor and an equal amount ofused or "conditioned" media is simultaneously removed, preferably for recovery of the desired product (e.g., pantoate and/or pantothenate). A variety of such processes have been developed and are well-known in the art.

The phrase "culturing under conditions such that a desired compound is produced" includes maintaining and/or growing microorganisms under conditions (e.g., temperature, pressure, pH, duration, etc.) appropriate or sufficient to obtain productionof the desired compound or to obtain desired yields of the particular compound being produced. For example, culturing is continued for a time sufficient to produce the desired amount of a compound (e.g., pantoate and/or pantothenate). Preferably,culturing is continued for a time sufficient to substantially reach suitable production of the compound (e.g., a time sufficient to reach a suitable concentration of pantoate and/or pantothenate or suitable ratio of pantoate and/or pantothenate:HMBPA). In one embodiment, culturing is continued for about 12 to 24 hours. In another embodiment, culturing is continued for about 24 to 36 hours, 36 to 48 hours, 48 to 72 hours, 72 to 96 hours, 96 to 120 hours, 120 to 144 hours, or greater than 144 hours. Inyet another embodiment, microorganisms are cultured under conditions such that at least about 5 to 10 g/L of compound are produced in about 36 hours, at least about 10 to 20 g/L compound are produced in about 48 hours, or at least about 20 to 30 g/Lcompound in about 72 hours. In yet another embodiment, microorganisms are cultured under conditions such that at least about 5 to 20 g/L of compound are produced in about 36 hours, at least about 20 to 30 g/L compound are produced in about 48 hours, orat least about 30 to 50. or 60 g/L compound in about 72 hours. In another embodiment, microorganisms are cultured under conditions such that a ratio of HMBPA:HMBPA+pantothenate of 0.1:100 or less is achieved (i.e., 0.1% HMBPA versus 99.9% pantothenate,for example, as determined by comparing the peak areas when a sample of product is analyzed by HPLC), preferably such that a ratio of 0.2:100 or less is achieved (0.2% HMBPA versus 99.8% pantotheante), more preferably such that a ratio of 0.5:100 or lessis achieved (0.5% HMBPA versus 99.5% pantotheante). In yet another embodiment, microorganisms are cultured under conditions such that a ratio of HMBPA:HMBPA+pantothenate of 1:100 or less is achieved (i. e., 1% HMBPA versus 99% pantothenate, for example,as determined by comparing the peak areas whena sample of product is analyzed be HPLC), preferably such that a ratio of 2:100 or less is achieved (2% HMBPA versus 98% pantotheante), more preferably such that a ratio of 3:100 or less is achieved (3% HMBPAversus 97% pantotheante), more preferably at least 4:100 or less (4% HMBPA versus 96% pantotheante), 5:100 or less (5% HMBPA versus 95% pantotheante), 6:100 or less (6% HMBPA versus 94% pantotheante), 7:100 or less (7% HMBPA versus 93% pantotheante),8:100 or less (8% HMBPA versus 92% pantotheante), 9:100 or less (9% HMBPA versus 91% pantotheante), or 10:100 or less (10% HMBPA versus 90% pantotheante).

The methodology of the present invention can further include a step of recovering a desired compound (e.g., pantoate and.or pantothenate). The term "recovering" a desired compound includes extracting, harvesting, isolating or purifying thecompound from culture media. Recovering the compound can be performed according to any conventional isolation or purification methodology known in the art including, but not limited to, treatment with a conventional resin (e.g., anion or cation exchangeresin, non-ionic adsorption resin, etc.), treatment with a conventional adsorbent (e.g., activated charcoal, silicic acid, silica gel, cellulose, alumina, etc.), alteration of pH, solvent extraction (e.g., with a conventional solvent such as an alcohol,ethyl acetate, hexane and the like), dialysis, filtration, concentration, crystallization, recrystallization, pH adjustment, lyophilization and the like. For example, a compound can be recovered from culture media by first removing the microorganismsfrom the culture. Media are then passed through or over a cation exchange resin to remove cations and then through or over an anion exchange resin to remove inorganic anions and organic acids having stronger acidities than the compound of interest. Theresulting compound can subsequently be converted to a salt (e.g., a calcium salt) as described herein.

Preferably, a desired compound of the present invention is "extracted", "isolated" or "purified" such that the resulting preparation is substantially free of other media components (e.g., free of media components and/or fermentation byproducts). The language "substantially free of other media components" includes preparations of the desired compound in which the compound is separated from media components or fermentation byproducts of the culture from which it is produced. In one embodiment,the preparation has greater than about 80% (by dry weight) of the desired compound (e.g., less than about 20% of other media components or fermentation byproducts), more preferably greater than about 90% of the desired compound (e.g., less than about 10%of other media components or fermentation byproducts), still more preferably greater than about 95% of the desired compound (e.g., less than about 5% of other media components or fermentation byproducts), and most preferably greater than about 98 99%desired compound (e.g., less than about 1 2% other media components or fermentation byproducts). When the desired compound has been derivatized to a salt, the compound is preferably further free of chemical contaminants associated with the formation ofthe salt. When the desired compound has been derivatized to an alcohol, the compound is preferably further free of chemical contaminants associated with the formation of the alcohol.

In an alternative embodiment, the desired compound is not purified from the microorganism, for example, when the microorganism is biologically non-hazardous (e.g., safe). For example, the entire culture (or culture supernatant) can be used as asource of product (e.g., crude product). In one embodiment, the culture (or culture supernatant) is used without modification. In another embodiment, the culture (or culture supernatant) is concentrated. In yet another embodiment, the culture (orculture supernatant) is dried or lyophilized.

Preferably, a production method of the present invention results in production of the desired compound at a significantly high yield. The phrase "significantly high yield" includes a level of production or yield which is sufficiently elevated orabove what is usual for comparable production methods, for example, which is elevated to a level sufficient for commercial production of the desired product (e.g., production of the product at a commercially feasible cost). In one embodiment, theinvention features a production method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g., pantoate and/or pantothenate) is produced at a level greater than 2 g/L. In another embodiment, the inventionfeatures a production method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g., pantoate and/or pantothenate) is produced at a level greater than 10 g/L. In another embodiment, the invention featuresa production method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g., pantoate and/or pantothenate) is produced at a level greater than 20 g/L. In yet another embodiment, the invention features aproduction method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g., pantoate and/or pantothenate) is produced at a level greater than 30 g/L. In yet another embodiment, the invention features aproduction method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g., pantoate and/or pantothenate) is produced at a level greater than 40 g/L. In yet another embodiment, the invention features aproduction method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g., pantoate and/or pantothenate) is produced at a level greater than 50 g/L. In yet another embodiment, the invention features aproduction method that includes culturing a recombinant microorganism under conditions such that the desired product (e.g., pantoate and/or pantothenate) is produced at a level greater than 60 g/L. The invention further features a production method forproducing the desired compound that involves culturing a recombinant microorganism under conditions such that a sufficiently elevated level of compound is produced within a commercially desirable period of time.

Depending on the biosynthetic enzyme or combination of biosynthetic enzymes manipulated, it may be desirable or necessary to provide (e.g., feed) microorganisms of the present invention at least one biosynthetic precursor such that the desiredcompound or compounds are produced. The term "biosynthetic precursor" or "precursor" includes an agent or compound which, when provided to, brought into contact with, or included in the culture medium of a microorganism, serves to enhance or increasebiosynthesis of the desired product. In one embodiment, the biosynthetic precursor or precursor is aspartate. In another embodiment, the biosynthetic precursor or precursor is .beta.-alanine. The amount of aspartate or .beta.-alanine added ispreferably an amount that results in a concentration in the culture medium sufficient to enhance productivity of the microorganism (e.g., a concentration sufficient to enhance production of pantoate and/or pantothenate). Biosynthetic precursors of thepresent invention can be added in the form of a concentrated solution or suspension (e.g., in a suitable solvent such as water or buffer) or in the form of a solid (e.g., in the form of a powder). Moreover, biosynthetic precursors of the presentinvention can be added as a single aliquot, continuously or intermittently over a given period of time. The term "excess .beta.-alanine" includes .beta.-alanine levels increased or higher that those routinely utilized for culturing the microorganism inquestion. For example, culturing the Bacillus microorganisms described in the instant Examples is routinely done in the presence of about 0 0.01 g/L .beta.-alanine. Accordingly, excess .beta.-alanine levels can include levels of about 0.01 1,preferably about 1 20 g/L.

In yet another embodiment, the biosynthetic precursor is valine. In yet another embodiment, the biosynthetic precursor is .alpha.-ketoisovalerate. Preferably, valine or .alpha.-ketoisovalerate is added in an amount that results in aconcentration in the medium sufficient for production of the desired product (e.g., pantoate and/or pantothenate) to occur. The term "excess .alpha.-KIV" includes .alpha.-KIV levels increased or higher that those routinely utilized for culturing themicroorganism in question. For example, culturing the Bacillus microorganisms described in the instant Examples is routinely done in the presence of about 0 0.01 g/L .alpha.-KIV. Accordingly, excess .alpha.-KIV levels can include levels of about 0.011, preferably about 1 20 g/L .alpha.-KIV. The term "excess valine" includes valine levels increased or higher that those routinely utilized for culturing the microorganism in question. For example, culturing the Bacillus microorganisms described in theinstant Examples is routinely done in the presence of about 0 0.5 g/L valine. Accordingly, excess valine levels can include levels of about 0.5 5 g/L, preferably about 5 20 g/L valine. Biosynthetic precursors are also referred to herein as"supplemental biosynthetic substrates".

Another aspect of the present invention includes biotransformation processes which feature the recombinant microorganisms described herein. The term "biotransformation process", also referred to herein as "bioconversion processes", includesbiological processes which results in the production (e.g., transformation or conversion) of appropriate substrates and/or intermediate compounds into a desired product (e.g., pantoate and/or pantothenate).

The microorganism(s) and/or enzymes used in the biotransformation reactions are in a form allowing them to perform their intended function (e.g., producing a desired compound). The microorganisms can be whole cells, or can be only those portionsof the cells necessary to obtain the desired end result. The microorganisms can be suspended (e.g., in an appropriate solution such as buffered solutions or media), rinsed (e.g., rinsed free of media from culturing the microorganism), acetone-dried,immobilized (e.g., with polyacrylamide gel or k-carrageenan or on synthetic supports, for example, beads, matrices and the like), fixed, cross-linked or permeablized (e.g., have permeablized membranes and/or walls such that compounds, for example,substrates, intermediates or products can more easily pass through said membrane or wall).

VI Processes for the Production of Selectively Mixed Compositions of Pantothenate and HMBPA

The present invention further features processes and microorganisms for the production of selectively mixed compositions of pantothenate and HMBPA. As defined herein, the phrase "selectively mixed composition" includes a composition produced ina manner such that the ratio of pantothenate to HMBPA is a controlled feature, i.e., the ratio of pantothenate to HMBPA is selected. The selection can occur by manipulating the microorganism producing the composition (i.e., the production strain) suchthat one component is favored for production over the other.

In one aspect, the invention features a process for the production of a selectively mixed pantothenate:HMBPA composition that includes culturing a microorganism having a deregulated pantothenate biosynthetic pathway under conditions such that aselectively mixed pantothenate:HMBPA composition is produced. In one embodiment, the microorganism is cultured under conditions that favor pantothenate production. In another embodiment, the microorganism is cultured under conditions that favor HMBPAproduction. In another embodiment, the microorganism is cultured under conditions of controlled steady state glucose that favor pantothenate production. In another embodiment, the microorganism is cultured under conditions of controlled steady stateglucose that favor HMBPA production. In yet another embodiment, the microorganism is cultured under conditions of controlled steady state dissolved oxygen that favor pantothenate production. In yet another embodiment, the microorganism is culturedunder conditions of controlled steady state dissolved oxygen that favor HMBPA production. In yet another embodiment, the microorganism is cultured under conditions of controlled serine levels that favor pantothenate production. In one embodiment, thecomposition comprises pantothenate and HMBPA at a ratio of 75 mol pantothenate to 25 mol HMBPA or greater. In another embodiment, the composition comprises pantothenate and HMBPA at a ratio of 90 mol pantothenate to 10 mol HMBPA or greater. In anotherembodiment, the composition comprises pantothenate and HMBPA at a ratio of 75 mol HMBPA to 25 mol pantothenate or greater. In yet another embodiment, the composition comprises pantothenate and HMBPA at a ratio of 90 mol HMBPA to 10 mol pantothenate orgreater. Values and ranges included and/or intermediate of the values set forth herein are also intended to be within the scope of the present invention.

This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application are incorporated herein byreference.

EXAMPLES

Example I

Discovery and Characterization of the [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid (HMBPA) Biosynthetic Pathway

In developing Bacillus strains for the production of pantothenate, various genetic manipulations are made to genes and enzymes involved in the pantothenate biosynthetic pathway and the isoleucine-valine (ilv) pathway (FIG. 1) as described in U.S. patent application Ser. No. 09/400,494 and U.S. patent application Ser. No. 09/667,569. For example, strains having a deregulated panBCD operon and/or having deregulated panE1 exhibit enhanced pantothenate production (when cultured in the presence of.beta.-alanine and .alpha.-ketoisovalerate (.alpha.-KIV)). Strains further deregulated for ilvBNC and ilvD exhibit enhanced pantothenate production in the presence of only .beta.-alanine. Moreover, it is possible to achieve .beta.-alanine independenceby further deregulating panD.

An exemplary strain is PA824, a tryptophan prototroph, Spec and Tet resistant, deregulated for panBCD at the panBCD locus, deregulated for panE1 at the panE1 locus (two genes in the B. subtilis genome are homologous to E. coli panE, panE1 andpan2, the former encoding the major ketopantoate reductase involved in pantothenate production, while panE2 does not contribute to pantothenate synthesis (U.S. patent application Ser. No. 09/400,494), deregulated for ilvD at the ilvD locus,overexpressing an ilvBNC cassette at the amyE locus, and overexpressing panD at the bpr locus.

Under the following fermentation conditions, PA824 routinely yields approximately 20 30 g/L pantothenate. The production of pantothenate by PA824 in this example is accomplished in 14 L fermentor vessels. The composition of the batch and feedmedia are as follows.

TABLE-US-00001 BATCH MATERIAL g/L (final) 1 Yeast extract 10 2 Na Glutamate 5 3 (NH.sub.4).sub.2SO.sub.4 8 4 KH.sub.2PO.sub.4 5 5 K.sub.2HPO.sub.4 7.6 Added After Sterilization and Cool Down 1 Glucose 2.5 2 CaCl.sub.2 0.1 3 MgCl.sub.2 1 4 SodiumCitrate 1 5 FeSO.sub.4 7 H.sub.2O 0.01 5 SM-1000X 1 ml

The final volume of the batch medium is 6 L. The trace element solution SM-1000X has following composition: 0.15 g Na.sub.2MoO.sub.4.2 H.sub.2O, 2.5 g H.sub.3BO.sub.3, 0.7 g CoCl.sub.2.6 H.sub.2O, 0.25 g CuSO.sub.4.5 H.sub.2O, 1.6 g MnCl.sub.2.4H.sub.2O, 0.3 g ZnSO.sub.4.7 H.sub.2O are dissolved in water (final volume 1 L).

The batch medium was inoculated with 60 ml of shake flask PA824 culture (OD=10 in SVY medium: Difco Veal Infusion broth 25 g, Difco Yeast extract 5 g, Sodium Glutamate 5 g, (NH.sub.4).sub.2SO.sub.4 2.7 g in 740 ml H.sub.2O, autoclave; add 200 mlsterile 1 M K.sub.2HPO.sub.4 (pH 7) and 60 ml sterile 50% Glucose solution (final volume 1L)). The fermentation was run at 43.degree. C. at an air flow rate of 12 L/min as a glucose limited fed batch. The initial batched glucose (2.5 g/L) was consumedduring exponential growth. Afterwards glucose concentrations were maintained between 0.2 1 g/L by continuous feeding of FEED solution as follows.

TABLE-US-00002 FEED MATERIAL g/L (final) 1 Glucose 550 2 CaCl.sub.2 0.1 3 SM-1000X 3 ml

The variable feed rate pump was computer controlled and linked to the glucose concentration in the tank by an algorithm. In this example the total feeding was 6 L.

During fermentation the pH was set at 7.2. Control was achieved by pH measurements linked to computer control. The pH value was maintained by feeding either a 25% NH.sub.3-solution or a 20% H.sub.3PO.sub.4-solution. NH.sub.3 actssimultaneously as a N-source for the fermentation. The dissolved oxygen concentration [pO.sub.2] was set at 30% by regulation of the agitation and aeration rate. Foaming was controlled by addition of silicone oil. After the stop of the addition of thefeed solution, in this example after 48 hours, the fermentation was continued until the [pO.sub.2] value reached 95%. Then the fermentation was stopped by killing the microorganism through sterilization for 30 min. The successful sterilization wasproven by plating a sample of the fermentation broth on agar plates. The pantothenate titer in the fermentation broth was 21.7 g/L after sterilization and removal of the cells by centrifugation (determined by HPLC analysis).

For HPLC analysis the fermentation broth sample was diluted with sterile water (1:40). 5 .mu.l of this dilution was injected into a HPLC column (Aqua C18, 5 .mu.m, 150.times.2.0 mm, Phenomenex.TM.). Temperature of the column was held at40.degree. C. Mobile phase A was 14.8 mM H.sub.3PO.sub.3, mobile phase B 100% Acetonitrile. Flow rate was constant at 0.5 mL/min. A gradient was applied:

TABLE-US-00003 start: 2% mobile phase B 0 3 min linear increase to 3% mobile phase B 3 3.5 min linear increase to 20% mobile phase B

The detection was carried out by an UV-detector (210 nm). Run time was 7 min with an additional 3 min posttime. The retention time for pantothenic acid is 3.9 minutes. The HPLC chromatogram for the above mentioned sample is given in FIG. 4.

Identification of a Compound Related to the Peak with Retention Time 4.7 Minutes

In addition to producing significant quantities of pantothenate, it was discovered a second compound eluted with an approximate retention time of 4.7 minutes in this system. The second prominent product formed in the fermentation was shown to be3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid (HMBPA) (also referred to herein as ".beta.-alanine 2-(R)-hydroxyisolvalerate", ".beta.-alanine 2-hydroxyisolvalerate", ".beta.-alanyl-.alpha.-hydroxyisovalarate" and/or "fantothenate"). It wasidentified by its mass spectrum (FIG. 5; relative monoisotopic mass 189), and by .sup.1- and 13C-NMR after chromatographic purification by reverse phase flash chromatography (mobile phase 10 mM KH.sub.2PO.sub.4, with increasing contents of acetonitrile(1 50%)) (data not shown). The compound was presumed to have the R configuration at the assymetric carbon by analogy with [R]-pantothenate.

In order to verify the identity of the compound, deliberate synthesis of racemic .beta.-alanine 2-hydroxyisolvalerate was preformed as follows. .beta.-alanine (2.73 g/30 mmol) and sodium methoxide (5.67 g of a 30% solution in methanol/31.5 mmol)were dissolved in methanol (40 mL). Methyl 2-hydroxyisovalerate (2-hydroxy-3-methylbutyric acid methyl ester) (3.96 g/30 mmol) was added and refluxed for 18 hours. Methanol was then removed by rotavap and replaced by tert-butanol (50 mL). Potassiumtert-butoxide was added (50 mg) and refluxed for 26 hours. The solvent was removed in vacuo, the residue dissolved in water (50 mL) and passed through a strongly acidic ion-exchange resin (H+-form Lewatite.TM. S 100 G1; 100 mL). More water is used torinse the ion exchanger. The aqueous eluates are combined and the water removed in vacuo. The residue is subjected to flash chromatography (silica gel; 2% acetic acid in ethyl acetate as eluent) and the product fractions evaporated to give a solidresidue. The residue was recrystallized from ethyl acetate/toluene (10 mL/20 mL, respectively) and analytically pure HMBPA (.beta.-alanine 2-hydroxyisolvalerate) was obtained, which showed a relative monoisotopic mass of 190 (189+H.sup.+) in the massspectrometer and the same .sup.1H-NMR resonances as the product obtained from fermentation.

The biosynthetic pathway resulting in HMBPA production is set forth in FIG. 2. The chemical structure of [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid (HMBPA) is depicted in FIG. 3. As depicted in FIG. 2, HMBPA is the condensationproduct of [R]-.alpha.-hydroxyisovaleric acid (.alpha.-HIV) and .beta.-alanine, catalyzed by the PanC enzyme. .alpha.-HIV is generated by reduction of .alpha.-KIV, a reaction that is catalyzed by the .alpha.-keto reductases PanE (e.g., PanE1 and/orPanE2) and/or IlvC.

Based on the chemical structure and biosynthetic pathway leading to HMBPA production, the present inventors have formulated the following model to describe the interaction between the previously known pantothenate and isoleucine-valine (ilv)pathways and the newly characterized HMBPA biosynthetic pathway. In at least one aspect, the model states that there exist at least two pathways in microorganisms that compete for .alpha.-KIV, the substrate for the biosynthetic enzyme PanB, namely thepantothenate biosynthetic pathway and the HMBPA biosynthetic pathway. (A third and fourth pathway competing for .alpha.-KIV are those resulting in the production of valine or leucine from .alpha.-KIV, see e.g., FIG. 1). At least the pantothenatebiosynthetic pathway and the HMBPA biosynthetic pathway further produce competitive substrates for the enzyme PanC, namely .alpha.-HIV and pantoate. Production of HMBPA hassignificant effects on pantothenate production. Most importantly, the HMBPApathway competes with the pantothenate pathway for precursors (.alpha.-KIV and .beta.-alanine) and for some of the enzymes (PanC, PanD, PanE1, and/or IlvC). In addition, because the structure of HMBPA is similar to that of pantothenate, it may have theundesirable property of negatively regulating one or more steps in the pantothenate pathway. The model predicts that production of pantothenate can be improved or optimized by any means which favor use of substrates (.alpha.-KIV and .beta.-alanine)and/or enzymes (PanC, PanD, PanE1, and/or IlvC) in pantothenate biosynthetic processes as compared to HMBPA biosynthetic processes.

A preferred approach to maximize pantoate and/or pantothenate production while minimizing HMBPA production is to increase the activity of PanB in the cells because this will decrease the availability of .alpha.-KIV for .alpha.-HIV synthesis whilepromoting the synthesis of ketopantoate and pantoate. Methods of increasing activity include overexpressing the panB gene, increasing the copy number of the gene, increasing the specific activity of the enzyme and/or relieving inhibition of the enzymeby mutation or by lowering Coenzyme A levels. Higher pantoate levels in turn increase pantothenate synthesis and decrease HMBPA synthesis by out competing .alpha.-HIV for PanC.

Another approach to maximize pantothenate synthesis is to optimize the level of panE1 expression. It is demonstrated herein that increasing production of PanE1 increases the synthesis of HMBPA at the expense of pantothenate. Accordingly,effecting a moderate decrease in the level of panE1 expression in PA824 or PA668 (i e., precisely regulating the level of panE1 expression) will result in a decrease in HMBPA synthesis and an increase in pantothenate synthesis. Moreover, as shown inExample II, deletion of panE2 significantly decreases HMBPA synthesis.

Other approaches to increasing pantoate and/or pantothenate synthesis versus HMBPA synthesis include optimizing .alpha.-KIV production levels in the cells and/or isolating a modified PanC protein with increased preference for pantoate as asubstrate.

The following examples provide experimental support for the model described herein and further exemplify processes for increasing the production of pantoate and/or pantothenate (relative to HMBPA levels) based on the model.

Examples II VIII

For Examples II VI, quantitation of pantothenate and/or HMBPA was performed as follows. Aliquots of fermentation media were diluted 1:100 and aliquots of test tube cultures were diluted 1:10 in water or 5% acetonitrile prior to injection on aPhenomenex Aqua.TM. 5 .mu.C18 HPLC column (250.times.4.60 mm, 125A). Mobile phases were A=5% acetonitrile, 50 mM monosodium phosphate buffer adjusted to pH 2.5 with phosphoric acid; and B=95% acetonitrile, 5% H.sub.2O.

Linear gradients were as follows.

TABLE-US-00004 Minutes Solvent A Solvent B 0 100% 0% 16 100% 0% 17 0% 100% 20 0% 100% 21 100% 0%

Additional parameters and apparatus were as follows: Flow rate=1.0 ml/min; Injection volume=20 .mu.l; Detector=Hewlett Packard 1090 series DAD UV detector-3014, Signal A=197 nm, ref.=450 nm, Firmware revision E; Column heater=Oven temperature40.degree. C.; Hardware=Hewlett Packard Kayak.TM. XA; and Software=Hewlett Packard Chemstation Plus.TM. family revision A.06.03[509].

HMBPA elutes at approximately 13 minutes in this system.

Example II

Decreasing HMBPA Synthesis by Deleting PanE2 from Pantothenate Production Strains

As described in Example I, HMBPA production was first observed in microorganisms overexpressing panE1 indicating that ketopantoate reductase is capable of catalyzing not only the reduction of ketopantoate to pantoate but also the reduction of.alpha.-ketoisovalerate to 2-hydroxyisovalerate. As mentioned previously, two genes in the B. subtilis genome are homologous to the E. coli panE gene encoding ketopantoate reductase and have been named panE1 and panE2. In Bacillus, it has beendemonstrated that the panE1 gene encodes the major ketopantoate reductase involved in pantothenate production, whereas panE2 does not contribute to pantothenate synthesis. Moreover, overexpression of panE2 from a P.sub.26panE2 cassette in pAN238 (SEQ IDNO:25) leads to a reduction in pantothenate titer (see e.g., U.S. patent application Ser. No. 09/400,494). Given the homology between the panE2 and panE1 gene products and the fact that overexpression of panE2 shifted production away frompantoate/pantothenate, it was tested whether panE2 contributed in any significant manner to the production of HMBPA. It was hypothesized that the panE2 gene product is an enzyme capable of reducing .alpha.-KIV to .alpha.-HIV, but incapable ofsignificantly reducing ketopantoate to pantoate.

To test the hypothesis, panE2 was deleted from pantothenate production strain PA824 (described in Example I) by transforming with a .DELTA.panE2::cat cassette from chromosomal DNA of strain PA248 (.DELTA.panE2::cat) (set forth as SEQ ID NO:24,for construction see e.g., U.S. patent application Ser. No. 09/400,494) to give strain PA919. Three isolates of PA919 were compared to PA824 for pantothenate and HMBPA production in test tube cultures grown in SVY plus .beta.-alanine.

TABLE-US-00005 TABLE 1 Production of pantothenate and HMBPA by derivatives of PA824 and PA880 grown at 43.degree. C. in 48 hour test tube cultures of SVY glucose + .beta.-alanine.sup.5. [HMBPA] Strain new trait parent OD.sub.600 [pan] g/l g/lPA824 -- 13.9 4.3 0.64 PA880 .DELTA.coaX PA824 16.4 5.1 0.48 PA894 .DELTA.coaX, PA880 14.9 4.9 0.47 coaA(S151L), cat PA911-5 P.sub.26panB @ vpr, PA880 13.4 5.3 0.40 .DELTA.coaX PA911-8 P.sub.26panB @ panB, '' 13.8 6.1 0.45 .DELTA.coaX PA919-1.DELTA.panE2::cat PA824 13.2 4.2 0.15 PA919-2 '' '' 14.8 3.8 0.13 PA919-3 '' '' 18.0 5.5 0.14

As indicated by the data in Table 1, all three isolates of PA919 produced about four-fold lower HMBPA than PA824 demonstrating that the panE2 gene product contributed to HMBPA production and demonstrating that HMBPA production can be at leastpartially eliminated by simply deleting panE2, without sacrificing pantothenate production.

Example III

HMBPA Production and Pantothenate Production are Inversely Correlated

Strains derived from PA365 (the RL-1 lineage equivalent of PA377, described in U.S. patent applcation Ser. No. 09/667,569) which are deleted for the P.sub.26 panBCD cassette and which contain a P.sub.26panC*D cassette amplified at the vpr locusand either the wild type P.sub.26panB cassette (PA666) or a P.sub.26 .DELTA.panB cassette (PA664) amplified at the bpr locus were constructed as follows. An alignment of the C-terminal amino acids of known or suspected PanB proteins is shown in FIG. 6. Three regions called 1, 2 and 3 were identified having conserved or semi-conserved amino acid residues that are indicated by arrows at the top of the figure. The B. subtilis PanB protein (RBS02239) is underlined. Two of the PanB proteins (RCY14036 andCAB56202.1) are missing region 3 while the latter PanB protein is also missing region 2 and has non-conserved amino acid residues occupying region 1.

B. subtilis PanB variants were created that were missing regions 1, 2 and 3. The desired variants were created by designing 3' PCR primers to amplify the B. subtilis pan B gene such that region 3, regions 2 and 3, or all three regions would bemissing from the final product. The PCR products were generated and cloned into E. coli expression vector pASK-1BA3, creating plasmids pAN446, pAN447, and pAN448, respectively. The plasmids were then transformed into E. coli strain SJ2 that containsthe panB6 mutation to test for complementation. Only pAN446, which is missing region 3, was able to complement. This indicates that region 3 is not essential for B. subtilis PanB activity but that region 2 is required for activity or stability.

The next step in this analysis was to transfer the panB gene from pAN446 to a B. subtilis expression vector and then introduce it into a strain appropriate for testing activity of the encoded PanB protein in B. subtilis. To do this, a strainthat is deleted for the P.sub.26panBCD operon was first created. This was accomplished by first inserting a cat gene between the BseRI site located just upstream of the panB RBS and the Bg/II site located in panD, creating plasmid pAN624, SEQ ID NO:20(FIG. 7).

The resulting deletion-substitution mutation (.DELTA.panBCD::cat624), which removes all of panB and panC, was crossed into PA354 by transformation, with selection for resistance to chloramphenicol on plates supplemented with 1 mM pantothenate. One of the transformants was saved and named PA644. Chromosomal DNA isolated from PA644 was analyzed by PCR and was shown to contain the deletion-substitution mutation. As expected, PA644 requires pantothenate for growth but retains the engineered ilvgenes (P.sub.26ilvBNC P.sub.26ilvD) as well as the P.sub.26pan E1 gene originally present in PA354. Thus, it has all the enzymes involved in pantoate synthesis overproduced except PanB. The gene containing the shortest panB deletion was inserted intoB. subtilis expression vector pOTP61 (described in U.S. patent application Ser. No. 09/667,569), creating plasmid pAN627. At the same time, a wild-type panB control gene was inserted into pOTP61, creating plasmid pAN630. The NotI fragments of eachplasmid, lacking E. coli vector sequences, were ligated and transformed into PA644, with selection for resistance to tetracycline.

One transformant from each transformation was saved and further transformed with chromosomal DNA from PA628 with selection for Pan.sup.+. PA628 contains a multicopy P.sub.26panC*D expression plasnmid (pAN620) integrated at the vpr locus. Inorder to determine the effects of the panB gene mutation directly on pantothenate production, plasmid pAN620 SEQ ID NO:21, which is illustrated in FIG. 8, provides the remaining two enzymes required for pantothenate synthesis (PanC and PanD). Fourtransformants from each transformation were isolated, grown in SVY medium containing 10 g/L aspartate for 48 hours, then assayed for pantothenate production. Transformants with the 3' deleted panB gene were named PA664 and those containing the wild-typegene were called PA666. The data showed that the 3' deleted panB gene in PA664 encodes a PanB protein with greatly reduced activity. To test for HMBPA production, test tube cultures of PA365, PA666, and PA664 were grown in SVY+aspartate medium with andwithout added .alpha.-KIV or pantoate for 48 hours and then assayed for HMBPA and pantothenate as described previously.

TABLE-US-00006 TABLE 2 Effect of PanB activity and addition of precursors on HMBPA and pantothenate production, 48 hour test tube culture data, SVY + aspartate (10 g/L) medium. +.alpha.-KIV +pantoate no additions (5 g/L) (5 g/L) panC*D panB[pan] HMBPA [pan] HMBPA [pan] HMBPA Strain pan operon plasmid plasmid (g/L) peak* (g/L) peak (g/L) peak PA365 P.sub.26panBCD NONE NONE 3.0 0.71 3.2 1.28 4.8 0.38 PA666 .DELTA.panBCD::cat pAN620 pAN630 3.7 0.55 3.3 1.70 5.2 0.26 PA664 .DELTA.panBCD::catpAN620 pAN627 0.3 1.39 0.6 1.76 2.5 0.74 *HMBPA peak = peak area X 10.sup.-3

The data presented in Table 2 demonstrate that in the absence of supplements, PA666 produced the least HMBPA whereas PA664 produced the most, indicating an inverse correlation between PanB activity and HMBPA production. This is consistent withthe model which predicts that the two pathways compete for .alpha.-KIV, the substrate for PanB, and produce competitive substrates for PanC; lowering PanB activity would be expected to increase .alpha.-KIV availability for .alpha.-HIV synthesis andcorrespondingly decrease the amount of pantoate synthesized. When .alpha.-KIV is added to the medium, all three strains produced significantly more HMBPA. This result implies that .alpha.-KIV is a precursor to HMBPA, as described in FIG. 2, anid thatexcess .alpha.-KIV favors HMBPA production. This result also suggests that synthesis of HMBPA is at least partially due to an overflow effect of excess .alpha.-KIV production. When pantoate was added to the medium, HMBPA was reduced by roughly 50percent in all three strains. Conversely, the strains each produced significantly more pantothenate. This result is also consistent with the model that the two pathways produce competing substrates for PanC (.alpha.-HIV and pantoate). Taken togetherthe above results further indicate that increasing pantoate synthesis should be beneficial in promoting pantothenate production as well as reducing HMBPA levels. Moreover, factors that decrease pantoate synthesis negatively affect pantothenatesynthesis.

Example IV

Effect of Increasing PanB and/or Regulating PanE1 on Production of Pantothenate

PA668 is a derivative of PA824 that contains extra copies of P.sub.26panB amplified at the vpr or panB locus. PA668 was constructed using the panB expression vector (pAN636, SEQ ID NO:22) which allows for selection of multiple copies usingchloramphenicol (FIG. 9). The pAN636 NotI restriction fragment, missing the E. coli vector sequences, was ligated and then used to transform PA824 with selection on plates containing 5 .mu.g/ml chloramphenicol. Transformants resistant to 30 .mu.g/mlchloramphenicol were isolated and screened for pantothenate production in 48 hour test tube cultures. The isolates shown produce less HMBPA that PA824 (conversely producing about 10 percent more pantothenate than PA824). A second strain, called PA669,was constructed which is PA824 with extra copies of P.sub.26panE1 amplified at the vpr or panE1 locus. Strain PA669 was constructed by transforming PA824 with the self-ligated NotI fragment of plasmid pAN637, SEQ ID NO:23 (FIG. 10) with selection forresistance to chloramphenicol. Two isolates of PA669 were chosen for further study; PA669-5 produces less PanE1 than PA669-7 as judged by SDS-PAGE analysis of total cell extracts made from the two strains.

Test tube cultures of strains PA824, PA668-2, PA668-24, and the two isolates of PA669 (PA669-5 and PA669-7) were grown in three different media (SVY, SVY+aspartate, and SVY+aspartate+pantoate) for 48 hours and then assayed for pantothenate,HMBPA, and .beta.-alanine (Table 3).

TABLE-US-00007 TABLE 3 Effect of extra copies of panB and panE1 on pantothenate and HMBPA production by PA824, 48 hour test tube culture data, SVY medium. +aspartate (10 g/L) no additions +aspartate (10 g/L) & pantoate (5 g/L) panB panE [pan][.beta.-ala] HMBPA [pan] [.beta.-ala] [pan] [.beta.-ala]- Strain plasmid plasmid (g/L) (g/L) * (g/L) (g/L) HMBPA (g/L) (g/L) HMBPA PA824 NONE NONE 1.8 0.05 <0.1 4.7 2.5 0.53 5.6 2.5 <0.10 PA668-2 pAN636 NONE 1.5 <0.04 <0.1 5.0 1.6 <0.104.9 1.2 <0.10- PA668-24 pAN636 NONE 1.8 0.05 <0.1 4.9 2.8 0.34 6.1 2.6 <0.10 PA669-5 NONE pAN637 1.8 0.04 <0.1 4.2 3.1 0.74 5.8 2.6 0.30 PA669-7 NONE pAN637 1.8 0.06 <0.1 3.7 3.2 1.41 5.2 2.5 0.75 *HMBPA = peak area X 10.sup.-3

None of the strains produced detectable quantities of HMBPA in SVY medium. All strains produced roughly equivalent amounts of pantothenate and low amounts of .beta.-alanine indicating that .beta.-alanine is limiting for both pantothenate andHMBPA synthesis in these cultures and that .beta.-alanine is a precursor for both compounds. When grown in SVY+aspartate medium, the two PA669 isolates produced more HMBPA than PA824 whereas both PA668 isolates produced less HMBPA than PA824. It isnoteworthy that the strain that produces the most PanE1 (PA669-7) produced the most HMBPA (and the least pantothenate). This suggests that high levels of PanE1 favor the production of HMBPA at the expense of lower pantothenate synthesis. It is alsointeresting that PA668-24 produced more HMBPA than PA668-2, even though SDS-PAGE analysis of extracts from the two strains showed that they produce roughly equivalent levels of PanB. The SDS-PAGE analysis also showed that PA668-24 makes much more IlvCthan PA668-2. Based on these data, it is proposed that IlvC influences HMBPA synthesis by increasing steady state levels of .alpha.-KIV and/or by catalyzing .alpha.-HIV formation from .alpha.-KIV, thereby accounting for the observed shift towardsproduction of HMBPA.

The final set of data in Table 3 shows that adding pantoate to the growth medium decreased HMBPA production by all strains that had previously produced detectable levels, e.g., by shifting synthesis towards pantothenate. This further supportsthe model that .alpha.-HIV and pantoate are competitive substrates for PanC.

Example V

Increasing Pantothenate Synthesis by Reduction of Pantothenate Kinase in Production Strains

One strategy to increase pantothenate production is to reduce the amount of pantothenate kinase activity in production strains. Pantothenate kinase is the first enzyme in the pathway from pantothenate to Coenzyme A. It was hypothesized thatlower pantothenate kinase activity would lead to lower steady state levels of Coenzyme A, which could in turn lead to higher PanB enzyme activity and higher titers of pantothenate. As described in U.S. patent application Ser. No. 09/667,569, twounlinked genes have been identified in B. subtilis that both encode pantothenate kinase, 1) coaA, which is homologous to the essential E. coli pantothenate kinase gene, and 2) coaX, which represents a novel class of bacterial pantothenate kinase genes.

Either coaA or coaX can be deleted from a wild type B. subtilis strain without any apparent effect on growth on rich or minimal medium. However, it is not possible to generate strains having a deletion in both genes, suggesting that one or theother is necessary for viability. Therefore, a strain was constructed having a deleted coaX and then coaA was mutated to reduce the specific activity of the CoaA enzyme. Although the phenotypes of the .DELTA.coaX, mutated coaA strains are subtle, thedata is consistent with the hypothesis that PanB activity can be increased by restricting pantothenate kinase activity. This in turn decreases HMBPA production and increases pantothenate production.

Installation of .DELTA.coaX and Mutated coaA Alleles into PA824.

Deletion of coaX from PA824 was accomplished in a single step by transforming PA824 to kanamycin resistance with chromosomal DNA from PA876 (PY79 .DELTA.coaX::kan), described in U.S. patent application Ser. No. 09/667,569, to give PA880. ThecaaX deletion in PA880 and PA876 was derived ultimately from plasmid pAN336 (SEQ ID NO:26, see U.S. patent application Ser. No. 09/667,569). Next, a control version of a wild type coaA gene and two mutated alleles of coaA were introduced as follows. The control and two mutated alleles were first introduced into the chromosome of wild type strain PY.sub.79 using transformation to chloramphenicol resistance by plasmids, and then chromosomal DNA from these intermediate strains was used to transformPA880 to chloramphenicol resistance. The plasmids used to integrate the control and mutant alleles were pAN294 (SEQ ID NO:27, see U.S. patent application Ser. No. 09/667,569), pAN34A, and pAN344. pAN343 is almost identical to pAN294, except that itcontains a T to C base change at base number 3228 of pAN294. Similarly, pAN344 has a CC to TA change at base numbers 3217 and 3218 of pAN294. All three plasmids have a chloramphenicol resistance gene (cat) substituting for the dispensable gene ofunkown funtion, yqjT, that lies just downstrean from coaA. The intermediate strains derived from PY79 by double crossovers of pAN294 (wild type coaA, yqjT::cat), pAN343 (coaA2 Y155H, yqjT::cat), and pAN344 (coaA2 S151L, yqjT::cat), are named PA886,PA887, and PA888, repectively. Next, PA880 was transformed to chloramphenicol resistance with chromosomal DNA from PA886, PA887, or PA888, to give strains PA892 (wild type coaA, cat), PA893 (coaA Y155H, cat), and PA894 (coaA S151 L, cat), respectively. Eight candidates for PA893 were checked for acquisition of the Y155H mutation by PCR of the coaA gene and NlaIII digestion, and all eight were correct.

Several candidates for each new strain, including PA880, were assayed for pantothenate production at 43.degree. in standard test tube cultures grown in SVY medium plus 5 g/l .beta.-alanine (see Table 4).

TABLE-US-00008 TABLE 4 Production of pantothenate and fantothenate by derivatives of PA824 that have been deleted for coaX and mutated for coaA, grown at 43.degree. C. in 48 hour test tube cultures of SVY glucose + .beta.-alanine. Strain coaAcoaX OD.sub.600 [pan] g/l [HMBPA] g/l PA824 wt wt 11.1 4.4 0.77 PA824 wt wt 11.4 4.1 0.70 PA880 wt .DELTA. 11.6 5.5 0.33 PA880 wt .DELTA. 12.7 5.1 0.33 PA892-1 wt, cat .DELTA. 11.7 4.5 0.26 PA892-2 wt, cat .DELTA. 13.4 4.5 0.26 PA892-3 wt, cat.DELTA. 12.9 4.8 0.25 PA893-1 Y155H, cat .DELTA. 10.7 4.3 0.24 PA893-2 Y155H, cat .DELTA. 12.0 4.5 0.25 PA893-3 Y155H, cat .DELTA. 11.9 4.7 0.23 PA893-4 Y155H, cat .DELTA. 12.8 4.3 0.20 PA893-5 Y155H, cat .DELTA. 11.6 4.7 0.28 PA893-8 Y155H, cat.DELTA. 10.0 4.7 0.25 PA894-1 S151L ?, cat .DELTA. 11.6 4.6 0.29 PA894-2 S151L ?, cat .DELTA. 15.6 4.5 0.27 PA894-3 S151L ?, cat .DELTA. 12.3 5.0 0.31 PA894-4 S151L ?, cat .DELTA. 12.2 5.0 0.27 PA894-5 S151L ?, cat .DELTA. 11.8 4.5 0.26 PA894-6S151L ?, cat .DELTA. 11.2 4.7 0.27 PA894-7 S151L ?, cat .DELTA. 13.1 4.7 0.26 PA894-8 S151L ?, cat .DELTA. 13.2 4.8 0.32

In medium containing .beta.-alanine, PA894 (S151L), but not PA893 (Y155M) gave, on average, slightly higher pantothenate levels than PA892 (the isogenic strain with wild type coaA). PA880 gave significantly higher pantothenate (5.5 and 5.1 g/l)than its isogenic parent, PA824 (4.4 and 4.1 g/l), and slightly higher pantothenate levels than PA894 (average about 4.7 g/l). It is possible that the .DELTA.yqjT::cat insertion present in PA892, PA893, and PA894 (but not PA880) has an effect thatcounteracts any gain that might result from the mutated coaA alleles.

Despite the narrow range of pantothenate titers from the new strains, a highly significant pattern was observed for production of HMBPA. In all strains where coaX was deleted, the HMBPA titer was two- to three-fold lower than for PA824. This isconsistent with the principle that HMBPA production results in part from a limitation in PanB activity. Consequently, .DELTA.coaX leads to increased PanB activity.

Example VI

Increasing Pantothenate Synthesis by Combined Increase in PanB and Reduction of Pantothenate Kinase in Production Strains

PA668, which contains an extra PanB expression cassette that is designed to be amplified by chloramphenicol (see Example IV), produces more pantothenate and less HMBPA than its predecessor, PA824. Since deletion of coaX from PA824 also reducesHMBPA production and moderately improves pantothenate production PA880), a strain combining the two modifications was constructed and tested for pantothenate production. Plasmid pAN636 (FIG. 9) was digested with NotI, ligated into circles, and used totransform PA880 to chloramphenicol resistance to give strain PA911. Several isolates of PA911 were tested by PCR to determine whether the plasmid had integrated at vpr as intended, or at panB, where it can also integrate. Both types were found. Oneisolate of each type of PA911, PA911-5 and PA911-8, were amplified on tetracycline (panD cassette) and chloramphenicol panB cassette) and tested for pantothenate production in test tube cultures grown in SVY plus .beta.-alanine (see Table 1). Bothisolates produced more pantothenate, and slightly less HMBPA than their parent, PA880. Moreover, consistent with the PA668 isolates, PA911-8, which has the panB cassette integrated at panB, produced the highest level of pantothenate.

Example VII

Increasing Pantothenate Production by Increasing Serine Availability

It was hypothesized that the ratio of pantothenate to HMBPA production could also be controlled by regulating the availability of serine in the microorganism cultures. In particular, it was proposed that increasing the availability of serinecould increase pantothenate production relative to HMBPA production, whereas decreasing the availability of serine would decrease the production of pantothenate relative to HMBPA production. This method is based on the understanding that the PanBsubstrate, methylenetetrahydrofolate, is derived from serine. Thus, regulating serine levels should effectively regulate PanB substrate levels. To test this hypothesis, PA824 was grown in test tube cultures of SVY glucose plus 5 g/L .beta.-alanine and.+-.5 g/L serine for 48 hours and 43.degree. C.

TABLE-US-00009 TABLE 5 Production of pantothenate and HMBPA by PA824 with and without the addition of serine serine added at 5 g/L OD.sub.600 [pan] g/L [HMBPA] g/L - 16.3 4.9 0.84 - 14.0 4.5 0.80 + 13.1 6.4 0.56 + 12.9 6.0 0.62

As demonstrated by the data presented in Table 5, addition of serine increases the level of production of pantothenate while conversely decreasing HMBPA production. As an alternative to feeding serine, another method of increasing serine andmethylenetetrahydrofolate levels in order to regulate pantothenate production levels is to increase synthesis or the activity of 3-phosphoglycerate dehydrogenase or of serine hydroxymethyl transferase (the serA and glyA gene products, respectively),thereby increasing serine and methylenetetrahydrofolate biosynthesis in appropriately engineered microorganisms.

Example VIII

Pantothenate Production with Strains PA668-2A and PA668-24 in 10-Liter Fermentors with Soy Flour Based Medium

Stains PA668-2A and PA668-24 were each grown twice in 10 liter fermentors. The medium was PFM-155 and the composition is as follows.

TABLE-US-00010 MATERIAL g/L (final) BATCH 1 Amberex 1003 5 2 Cargill 200/20 (soy flour) 40 3 Na Glutamate 5 4 (NH.sub.4).sub.2SO.sub.4 8 5 MgSO.sub.4.7H.sub.2O 1 6 MAZU DF204C 1 7 H.sub.2O qs to 4 L Added After Sterilization and Cool Down 1KH.sub.2PO.sub.4 10 2 K.sub.2HPO.sub.4.3H.sub.2O 20 3 H.sub.2O qs to 400 ml 1 80% Glucose 20 2 CaCl.sub.2.2H.sub.2O 0.1 1 Sodium Citrate 1 2 FeSO.sub.4.7H.sub.2O 0.01 3 SM-1000X 1 X FEED 1 80% Glucose 800 2 CaCl.sub.2.2H.sub.2O 0.8 3 H.sub.2O qs to 3500ml Added After Sterilization and Cool Down 1 Sodium Citrate 2.0 2 FeSO.sub.4.7H.sub.2O 0.02 3 SM-1000X 2 X 4 Glutamate Na 5.0 5 H.sub.2O qs to 500 ml

The pantothenate production by PA668-2A was 45 g/L and 51 g/L at 36 hours, similar to routine PA824 fermentations in the same medium. After 36 hours, when pantothenate production routinely begins to slow with PA824, both PA668-2A fermentationscontinued production to yield 63 g/l pantothenate at 48 hours. Most significantly, the production of HMPBA at 48 hours was reduced to 3 5 g/L, and was less than 5% of the pantothenate during most of the earlier fermentation. Clear benefits topantothenate synthesis are evident from the increased levels of PanB in strain PA668. Strain PA668-24 produced pantothenate at an even faster rate with the two fermentations averaging 58 g/L after 36 hours.

EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by thefollowing claims.

>

27 NA Artificial Sequence Description of Artificial Sequencepromoter sequence tgacg acagctatgg ttcactgtcc accaaccaaa actgtgctca gtaccgccaa 6ctccc ttgaggggta caaagaggtg tccctagaagagatccacgc tgtgtaaaaa tacaaaa aggtattgac tttccctaca gggtgtgtaa taatttaatt acaggcgggg accccgc ctgt 63 DNA Artificial Sequence Description of Artificial Sequencepromoter sequence 2 gcctacctag cttccaagaa agatatccta acagcacaag agcggaaagatgttttgttc 6ccaga acaacctctg ctaaaattcc tgaaaaattt tgcaaaaagt tgttgacttt tacaagg tgtggtataa taatcttaac aacagcagga cgc 27 DNA Artificial Sequence Description of Artificial Sequencepromoter sequence 3 gaggaatcat agaattttgt caaaataattttattgacaa cgtcttatta acgttgatat 6aaatt ttatttgaca aaaatgggct cgtgttgtac aataaatgta gtgaggtgga aatg 4 DNA Artificial Sequence Description of Artificial Sequenceribosome binding site 4 taaacatgag gaggagaaaa catg 24 5 28 DNA ArtificialSequence Description of Artificial Sequenceribosome binding site 5 attcgagaaa tggagagaat ataatatg 28 6 Artificial Sequence Description of Artificial Sequenceribosome binding site 6 agaaaggagg tga DNA Artificial Sequence Description ofArtificial Sequenceribosome binding site 7 ttaagaaagg aggtgannnn atg 23 8 23 DNA Artificial Sequence Description of Artificial Sequenceribosome binding site 8 ttagaaagga ggtgannnnn atg 23 9 23 DNA Artificial Sequence Description of ArtificialSequenceribosome binding site 9 agaaaggagg tgannnnnnn atg 23 NA Artificial Sequence Description of Artificial Sequenceribosome binding site aggagg tgannnnnna tg 22 NA Artificial Sequence Description of Artificial Sequenceribosomebinding site ctagaa ggaggagaaa acatg 25 NA Artificial Sequence Description of Artificial Sequenceribosome binding site ctagag gaggagaaaa catg 24 NA Artificial Sequence Description of Artificial Sequenceribosome binding site aaagga ggatttaaat atg 23 NA Artificial Sequence Description of Artificial Sequenceribosome binding site aaagga ggtttaatta atg 23 NA Artificial Sequence Description of Artificial Sequenceribosome binding site aaaggaggtgatttaa atg 23 NA Artificial Sequence Description of Artificial Sequenceribosome binding site aaagga ggtgtttaaa atg 23 NA Artificial Sequence Description of Artificial Sequenceribosome binding site gagaaa ggaggtgaatataatatg 28 NA Artificial Sequence Description of Artificial Sequenceribosome binding site gagaaa ggaggtgaat aataatg 27 NA Artificial Sequence Description of Artificial Sequenceribosome binding site gtagaa aggaggtgaa ttaatatg28 2DNA Artificial Sequence Description of Artificial Sequence vector 2accaa ttgtccatat tgcatcagac attgccgtca ctgcgtcttt tactggctct 6ctaac caaaccggta accccgctta ttaaaagcat tctgtaacaa agcgggacca ccatgac aaaaacgcgt aacaaaagtgtctataatca cggcagaaaa gtccacattg atttgca cggcgtcaca ctttgctatg ccatagcatt tttatccata agattagcgg 24acctg acgcttttta tcgcaactct ctactgtttc tccatacccg tttttttggg 3caggag gaattaacca tggatccgag ctcgacagta tcaagcactt cacaatctgg 36gaaag cccgccttat gtagctcata cttgacaaat ccaaggtcaa aatggatatt 42cgaca aaataagcgc cgtcaagcaa ttggaatact tcttcagcaa ctgcttcaaa 48gttca ttctcgacca tttgattaga gattccagta agctgctcaa taaaagcagg 54attta tttggattaa tgtattttga aaaccgctcagtaatttgtc cattttcgat 6accgct gcgatttgta tgattttatc gcctttcttc ggcgaattcc ctgttgtctc 66ctata acaacgaacc gttgcttatt cattaaaatg gacacctcaa ttcttgcata 72aaagt gtaacacgtt ttgtacggaa atggagcggc aaaaccgttt tactctcaaa 78aaaagaaaacccccg ataaaggggg cttttcttct acaaaattgt acgggctggt 84cccca gcatttgttc aattttgttt tgatcattca gaacagccac tttcggctca 9ttgccg cttcttgatc agacatcatt ttgtaggaaa taataatgac cttatctcct 96cacaa ggcgtgcggc tgcaccgttt aagcatatga cgccgcttccccgtttacca aataatat acgtttcaag acgtgctcca ttattattat tcacaatttg tactttttca aggaagca ttcccacagc atcaatgaga tcctctagag tcgacctgca ggcatgcaag tccgtcga cgctctccct tatgcgactc ctgcattagg aagcagccca gtagtaggtt ggccgttg agcaccgccgccgcaaggaa tggtgcatgc aaggagatgg cgcccaacag ccccggcc acggggcctg ccaccatacc cacgccgaaa caagcgctca tgagcccgaa ggcgagcc cgatcttccc catcggtgat gtcggcgata taggcgccag caaccgcacc tggcgccg gtgatgccgg ccacgatgcg tccggcgtag aggatcaatcttcatccatt aaggtaaa tcccccttcg ccgtttctgt taccattata caccttttga accttaacgt acgttaag ttttaaaaaa caataaaaaa gacgagcagc atacagcacc cgtctttcac tcctgttt aagctaaact tcccgccact gacagagact ctttttgaag gctttcagaa cactcgat acgcgatctggagctgtaat ataaaaacct tcttcaacta acggggcagg agtgacat tagaaaaccg actgtaaaaa gtacagtcgg cattatctca tattataaaa cagtcatt aggcctatct gacaattcct gaatagagtt cataaacaat cctgcatgat ccatcaca aacagaatga tgtacctgta aagatagcgg taaatatattgaattacctt ttaatgaa ttttcctgct gtaataatgg gtagaaggta attactatta ttattgatat aagttaaa cccagtaaat gaagtccatg gaataataga aagagaaaaa gcattttcag ataggtgt tttgggaaac aatttccccg aaccattata tttctctaca tcagaaaggt 2aatcata aaactctttgaagtcattct ttacaggagt ccaaatacca gagaatgttt 2atacacc atcaaaaatt gtataaagtg gctctaactt atcccaataa cctaactctc 2cgctatt gtaaccagtt ctaaaagctg tatttgagtt tatcaccctt gtcactaaga 222aatgc agggtaaaat ttatatcctt cttgttttat gtttcggtataaaacactaa 228atttc tgtggttata ctaaaagtcg tttgttggtt caaataatga ttaaatatct 234ctctt ccaattgtct aaatcaattt tattaaagtt catttgatat gcctcctaaa 24tatcta aagtgaattt aggaggctta cttgtctgct ttcttcatta gaatcaatcc 246taaaa gtcaatattactgtaacata aatatatatt ttaaaaatat cccactttat 252tttcg tttgttgaac taatgggtgc tttagttgaa gaataaagac cacattaaaa 258ggtct tttgtgtttt tttaaaggat ttgagcgtag cgaaaaatcc ttttctttct 264tgata ataagggtaa ctattgcatg ataagctgtc aaacatgagaattcccgttt 27ctgcaa gccaaaaaac cttccgttac aacgagaagg attcttcact ttctaaagtt 276agttt catccctctg tcccagtcct tttttggatc aaggcagact gctgcaatgt 282tattt taataatagg tgcagttcgc aggcgatact gcccaatgga agtataccaa 288acggg cttgtaccaacacattagcc caattcgata tcggcagaat agattttttt 294cttcg ttcgtttcta aaagcagaac gccttcatca tctataccta acgccttacc 3aaaggtt ccgtttaacg ttctggctct catattagtg ccaataccga gcgcatagct 3ccataaa agcttaatcg gcgtaaatcc gtgcgtcata taatcccggtaccgtttctc 3gcatagt aaaatatgct ggatgacgcc ggcccgatca attttttccc cagcagcttg 3gaggctt gtcgcgatgt ccttcaattc atctggaaaa tcattaggct gctggttaaa 324tccag cttggctgtt ttggcggatg agagaagatt ttcagcctga tacagattaa 33gaacgc agaagcggtctgataaaaca gaatttgcct ggcggcagta gcgcggtggt 336ctgac cccatgccga actcagaagt gaaacgccgt agcgccgatg gtagtgtggg 342cccat gcgagagtag ggaactgcca ggcatcaaat aaaacgaaag gctcagtcga 348tgggc ctttcgtttt atctgttgtt tgtcggtgaa cgctctcctgagtaggacaa 354ccggg agcggatttg aacgttgcga agcaacggcc cggagggtgg cgggcaggac 36gccata aactgccagg catcaaatta agcagaaggc catcctgacg gatggccttt 366tttct acaaactctt tttgtttatt tttctaaata cattcaaata tgtatccgct 372gacaa taaccctgataaatgcttca ataatattga aaaaggaaga gtatgagtat 378atttc cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc 384cagaa acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg 39atcgaa ctggatctca acagcggtaa gatccttgag agttttcgccccgaagaacg 396caatg atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtgttga 4cgggcaa gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta 4accagtc acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc 4cataacc atgagtgataacactgcggc caacttactt ctgacaacga tcggaggacc 42gagcta accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg 426cggag ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc 432caaca acgttgcgca aactattaac tggcgaacta cttactctagcttcccggca 438taata gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct 444ctggc tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat 45gcagca ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg 456aggca actatggatgaacgaaatag acagatcgct gagataggtg cctcactgat 462attgg taactgtcag accaagttta ctcatatata ctttagattg atttaaaact 468tttaa tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat 474aacgt gagttttcgt tccactgagc gtcagacccc gtagaaaagatcaaaggatc 48tgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct 486cggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg 492gcaga gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca 498agaac tctgtagcaccgcctacata cctcgctctg ctaatcctgt taccagtggc 5tgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga 5ggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac 5ctacacc gaactgagat acctacagcg tgagctatga gaaagcgccacgcttcccga 522gaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag 528ttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg 534agcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag 54gcggcc tttttacggttcctggcctt ttgctggcct tttgctcaca tgttctttcc 546tatcc cctgattctg tggataaccg tattaccgcc tttgagtgag ctgataccgc 552gcagc cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg aagagcgcct 558ggtat tttctcctta cgcatctgtg cggtatttca caccgcatatggtgcactct 564caatc tgctctgatg ccgcatagtt aagccagtat acactccgct atcgctacgt 57gggtca tggctgcgcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct 576gctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt 582gtttt caccgtcatcaccgaaacgc gcgaggcagc agatcaattc gcgcgcgaag 588gcggc atgcataatg tgcctgtcaa atggacgaag cagggattct gcaaacccta 594ctccg tcaagccgtc aattgtctga ttcgttacca attatgacaa cttgacggct 6tcattca ctttttcttc acaaccggca cggaactcgc tcgggctggccccggtgcat 6ttaaata cccgcgagaa atagagttga tcgtcaaaac caacattgcg accgacggtg 6ataggca tccgggtggt gctcaaaagc agcttcgcct ggctgatacg ttggtcctcg 6cagctta agacgctaat ccctaactgc tggcggaaaa gatgtgacag acgcgacggc 624gcaaa catgctgtgcgacgctggcg atatcaaaat tgctgtctgc caggtgatcg 63tgtact gacaagcctc gcgtacccga ttatccatcg gtggatggag cgactcgtta 636ttcca tgcgccgcag taacaattgc tcaagcagat ttatcgccag cagctccgaa 642ccctt ccccttgccc ggcgttaatg atttgcccaa acaggtcgctgaaatgcggc 648cgctt catccgggcg aaagaacccc gtattggcaa atattgacgg ccagttaagc 654atgcc agtaggcgcg cggacgaaag taaacccact ggtgatacca ttcgcgagcc 66gatgac gaccgtagtg atgaatctct cctggcggga acagcaaaat atcacccggt 666aacaa attctcgtccctgatttttc accaccccct gaccgcgaat ggtgagattg 672ataac ctttcattcc cagcggtcgg tcgataaaaa aatcgagata accgttggcc 678cggcg ttaaacccgc caccagatgg gcattaaacg agtatcccgg cagcagggga 684ttgcg cttcagccat acttttcata ctcccgccat tcagag 6886 2DNA Artificial Sequence Description of Artificial Sequence vector 2ggccg cttcgtcgac cgaaacagca gttataaggc atgaagctgt ccggtttttg 6gtggc tgtgactgta aaaagaaatc gaaaaagacc gttttgtgtg aaaacggtct tgtttcc ttttaaccaa ctgccataac tcgaggcctacctagcttcc aagaaagata taacagc acaagagcgg aaagatgttt tgttctacat ccagaacaac ctctgctaaa 24tgaaa aattttgcaa aaagttgttg actttatcta caaggtgtgg tataataatc 3caacag caggacgctc tagattagaa aggaggattt aaatatgaga cagattactg 36tcacagctgaaagaa gccataaaac aataccattc agagggcaag tcaatcggat 42ccgac gatggggttt ctgcatgagg ggcatttaac cttagcagac aaagcaagac 48aacga cgccgttatt atgagtattt ttgtgaatcc tgcacaattc ggccctaatg 54tttga agcatatccg cgcgatattg agcgggatgc agctcttgcagaaaacgccg 6cgatat tctttttacg ccagatgctc atgatatgta tcccggtgaa aagaatgtca 66catgt agaaagacgc acagacgtgt tatgcgggcg ctcaagagaa ggacattttg 72gtcgc gatcgtactg acgaagcttt tcaatctagt caagccgact cgtgcctatt 78ttaaa agatgcgcagcaggtagctg ttgttgatgg gttaatcagc gacttcttca 84attga attggttcct gtcgatacgg tcagagagga agacggctta gccaaaagct 9caatgt atacttaaca gctgaggaaa gaaaagaagc gcctaagctg tatcgggccc 96acaag tgcggaactt gtccaagccg gtgaaagaga tcctgaagcg gtgataaaaggcaaaaga tatcattgaa acgactagcg gaaccataga ctatgtagag ctttattcct ccggaact cgagcctgtg aatgaaattg ctggaaagat gattctcgct gttgcagttg ttttcaaa agcgcgttta atagataata tcattattga tattcgtaga aaggaggtga taatatgt atcgtacgat gatgagcggcaaacttcaca gggcaactgt tacggaagca cctgaact atgtgggaag cattacaatt gatgaagatc tcattgatgc tgtgggaatg tcctaatg aaaaagtaca aattgtgaat aataataatg gagcacgtct tgaaacgtat tattcctg gtaaacgggg aagcggcgtc atatgcttaa acggtgcagc cgcacgcctt gcaggaag gagataaggt cattattatt tcctacaaaa tgatgtctga tcaagaagcg aagccatg agccgaaagt ggctgttctg aatgatcaaa acaaaattga acaaatgctg gaacgaac cagcccgtac aattttgtaa aggatcctgt tttggcggat gagagaagat tcagcctg atacagatta aatcagaacgcagaagcggt ctgataaaac agaatttgcc gcggcagt agcgcggtgg tcccacctga ccccatgccg aactcagaag tgaaacgccg gcgccgat ggtagtgtgg ggtctcccca tgcgagagta gggaactgcc aggcatcaaa aaacgaaa ggctcagtcg aaagactggg cctttcgttt tatctgttgt ttgtcggtga gctctcct gagtaggaca aatccgccgg gagcggattt gaacgttgcg aagcaacggc ggagggtg gcgggcagga cgcccgccat aaactgccag gcatcaaatt aagcagaagg atcctgac ggatggcctt tttgcgtttc tacaaactct tggtaccgag acgatcgtcc 2ttgttgt agcccatcac ttttgctgaagagtaggagc cgaaagtgac ggcgtattca 2agcggca gctgagtcgc accgacagaa atcgcttctc ttgatgtgcc cggcgatccg 2gtccagc cgttcggtcc gctgttgccg tttgaggtaa cagcgacaac gccttctgac 222ccagt caagcgctgt gcttgtcgcc cagtccgggt tgtttaaaga gtttccgaga 228gttca tcacatctgc cccgtcctgc actgcacgtt ccacgcccgc gatgacgttt 234tgtgc cgcttccgcc aggccctaac acacgataag caagaagtgt ggcatcaggc 24cgcctt taatcgttcc gtttgcagcc acagttccgg ctacgtgtgt gccatggtca 246ctcgc ccctcggatc gccggttggtgtttcttttg gatcgtaatc attgtccaca 252gtatc ctttatattg tccaaagttt ttcttcagat ctgggtgatt gtattcaacc 258gtcaa taatcgccac cttgatgcct tttcctgtgt agcctaaatc ccatgcatcg 264tccga tataaggcgc actgtcatcc atttgcggag atacggcgtc ttcggagatt 27ggaatt ctcatgtttg acagcttatc atgcaatagt tacccttatt atcaagataa 276aaaag gatttttcgc tacgctcaaa tcctttaaaa aaacacaaaa gaccacattt 282tgtgg tctttattct tcaactaaag cacccattag ttcaacaaac gaaaattgga 288tggga tatttttaaa atatatatttatgttacagt aatattgact tttaaaaaag 294attct aatgaagaaa gcagacaagt aagcctccta aattcacttt agataaaaat 3ggaggca tatcaaatga actttaataa aattgattta gacaattgga agagaaaaga 3atttaat cattatttga accaacaaac gacttttagt ataaccacag aaattgatat 3tgtttta taccgaaaca taaaacaaga aggatataaa ttttaccctg catttatttt 3agtgaca agggtgataa actcaaatac agcttttaga actggttaca atagcgacgg 324taggt tattgggata agttagagcc actttataca atttttgatg gtgtatctaa 33ttctct ggtatttgga ctcctgtaaagaatgacttc aaagagtttt atgatttata 336ctgat gtagagaaat ataatggttc ggggaaattg tttcccaaaa cacctatacc 342atgct ttttctcttt ctattattcc atggacttca tttactgggt ttaacttaaa 348ataat aatagtaatt accttctacc cattattaca gcaggaaaat tcattaataa 354attca atatatttac cgctatcttt acaggtacat cattctgttt gtgatggtta 36gcagga ttgtttatga actctattca ggaattgtca gataggccta atgactggct 366aatat gagataatgc cgactgtact ttttacagtc ggttttctaa tgtcactaac 372ccgtt agttgaagaa cgaagcggccgcaattcttg aagacgaaag ggcctcgtga 378ctatt tttataggtt aatgtcatga taataatggt ttcttagacg tcaggtggca 384cgggg aaatgtgcgc ggaaccccta tttgtttatt tttctaaata cattcaaata 39tccgct catgagacaa taaccctgat aaatgcttca ataatattga aaaaggaaga 396agtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca ttttgccttc 4tttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat cagttgggtg 4gagtggg ttacatcgaa ctggatctca acagcggtaa gatccttgag agttttcgcc 4aagaacg ttttccaatg atgagcacttttaaagttct gctatgtggc gcggtattat 42tattga cgccgggcaa gagcaactcg gtcgccgcat acactattct cagaatgact 426gagta ctcaccagtc acagaaaagc atcttacgga tggcatgaca gtaagagaat 432agtgc tgccataacc atgagtgata acactgcggc caacttactt ctgacaacga 438ggacc gaaggagcta accgcttttt tgcacaacat gggggatcat gtaactcgcc 444cgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt gacaccacga 45tgcagc aatggcaaca acgttgcgca aactattaac tggcgaacta cttactctag 456cggca acaattaata gactggatggaggcggataa agttgcagga ccacttctgc 462gccct tccggctggc tggtttattg ctgataaatc tggagccggt gagcgtgggt 468ggtat cattgcagca ctggggccag atggtaagcc ctcccgtatc gtagttatct 474acggg gagtcaggca actatggatg aacgaaatag acagatcgct gagataggtg 48actgat taagcattgg taactgtcag accaagttta ctcatatata ctttagattg 486aaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatctca 492BR> tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga 498ggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa 5caccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga 5taactgg cttcagcaga gcgcagataccaaatactgt ccttctagtg tagccgtagt 5gccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt 522gtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat 528ccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct 534cgaac gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca 54tcccga agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag 546acgag ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc 552ctctg acttgagcgt cgatttttgtgatgctcgtc aggggggcgg agcctatgga 558gccag caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca 564tttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc tttgagtgag 57taccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg 576cgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatat 582actct cagtacaatc tgctctgatg ccgcatagtt aagccagtat acactccgct 588tacgt gactgggtca tggctgcgcc ccgacacccg ccaacacccg ctgacgcgcc 594gggct tgtctgctcc cggcatccgcttacagacaa gctgtgaccg tctccgggag 6catgtgt cagaggtttt caccgtcatc accgaaacgc gcgaggcagc tgcggtaaag 6atcagcg tggtcgtgaa gcgattcaca gatgtctgcc tgttcatccg cgtccagctc 6gagtttc tccagaagcg ttaatgtctg gcttctgata aagcgggcca tgttaagggc 6tttttcc tgtttggtca cttgatgcct ccgtgtaagg gggaatttct gttcatgggg 624gatac cgatgaaacg agagaggatg ctcacgatac gggttactga tgatgaacat 63ggttac tggaacgttg tgagggtaaa caactggcgg tatggatgcg gcgggaccag 636aatca ctcagggtca atgccagcgcttcgttaata cagatgtagg tgttccacag 642ccagc agcatcctgc gatgcagatc cggaacataa tggtgcaggg cgctgacttc 648ttcca gactttacga aacacggaaa ccgaagacca ttcatgttgt tgctcaggtc 654cgttt tgcagcagca gtcgcttcac gttcgctcgc gtatcggtga ttcattctgc 66cagtaa ggcaaccccg ccagcctagc cgggtcctca acgacaggag cacgatcatg 666ccgtg gccaggaccc aacgctgccc gagatgcgcc gcgtgcggct gctggagatg 672cgcga tggatatgtt ctgccaaggg ttggtttgcg cattcacagt tctccgcaag 678attgg ctccaattct tggagtggtgaatccgttag cgaggtgccg ccggcttcca 684gtcga ggtggcccgg ctccatgcac cgcgacgcaa cgcggggagg cagacaaggt 69ggcggc gcctacaatc catgccaacc cgttccatgt gctcgccgag gcggcataaa 696gtgac gatcagcggt ccagtgatcg aagttaggct ggtaagagcc gcgagcgatc 7gaagctg tccctgatgg tcgtcatcta cctgcctgga cagcatggcc tgcaacgcgg 7tcccgat gccgccggaa gcgagaagaa tcataatggg gaaggccatc cagcctcgcg 76725 DNA Artificial Sequence Description of Artificial Sequence vector 22 tcggcggccg cttcgtcgac cgaaacagcagttataaggc atgaagctgt ccggtttttg 6gtggc tgtgactgta aaaagaaatc gaaaaagacc gttttgtgtg aaaacggtct tgtttcc ttttaaccaa ctgccataac tcgaggccta cctagcttcc aagaaagata taacagc acaagagcgg aaagatgttt tgttctacat ccagaacaac ctctgctaaa 24tgaaa aattttgcaa aaagttgttg actttatcta caaggtgtgg tataataatc 3caacag caggacgctc tagaaggagg agaaaacatg aaaacaaaac tggattttct 36tgaag gagtctgaag aaccgattgt catgctgacc gcttatgatt atccggcagc 42ttgct gaacaagcgg gagttgacat gattttagtcggtgattcac ttggaatggt 48tcggc cttgattcaa ctgtcggtgt gacagttgcg gacatgatcc atcatacaaa 54ttaaa aggggtgcgc cgaatacctt tattgtgaca gatatgccgt ttatgtctta 6ctgtct aaggaagata cgctgaaaaa tgcagcggct atcgttcagg aaagcggagc 66cactgaagcttgagg gcggagaagg cgtgtttgaa tccattcgcg cattgacgct 72gcatt ccagtagtca gtcacttagg tttgacaccg cagtcagtcg gcgtactggg 78ataaa gtacagggca aagacgaaca aagcgccaaa aaattaatag aagacagtat 84gcgaa gaagcaggag ctatgatgct tgtgctggaa tgtgtgccggcagaactcac 9aaaatt gccgagacgc taagcatacc ggtcattgga atcggggctg gtgtgaaagc 96gacaa gttctcgttt atcatgatat tatcggccac ggtgttgaga gaacacctaa ttgtaaag caatatacgc gcattgatga aaccatcgaa acagcaatca gcggatatgt aggatgta agacatcgtgctttccctga acaaaagcat tcctttcaaa tgaaccagac tgcttgac ggcttgtacg ggggaaaata agggggggat cctgttttgg cggatgagag gattttca gcctgataca gattaaatca gaacgcagaa gcggtctgat aaaacagaat gcctggcg gcagtagcgc ggtggtccca cctgacccca tgccgaactcagaagtgaaa ccgtagcg ccgatggtag tgtggggtct ccccatgcga gagtagggaa ctgccaggca aaataaaa cgaaaggctc agtcgaaaga ctgggccttt cgttttatct gttgtttgtc tgaacgct ctcctgagta ggacaaatcc gccgggagcg gatttgaacg ttgcgaagca ggcccgga gggtggcgggcaggacgccc gccataaact gccaggcatc aaattaagca aggccatc ctgacggatg gcctttttgc gtttctacaa actcttggta ccgagacgat tcctcttt gttgtagccc atcacttttg ctgaagagta ggagccgaaa gtgacggcgt tcattgag cggcagctga gtcgcaccga cagaaatcgc ttctcttgatgtgcccggcg ccgactgt ccagccgttc ggtccgctgt tgccgtttga ggtaacagcg acaacgcctt gacatggc ccagtcaagc gctgtgcttg tcgcccagtc cgggttgttt aaagagtttc agagacag gttcatcaca tctgccccgt cctgcactgc acgttccacg cccgcgatga ttttccgt tgtgccgcttccgccaggcc ctaacacacg ataagcaaga agtgtggcat ggcgctac gcctttaatc gttccgtttg cagccacagt tccggctacg tgtgtgccat 2cagttgc ctcgcccctc ggatcgccgg ttggtgtttc ttttggatcg taatcattgt 2caaaatc gtatccttta tattgtccaa agtttttctt cagatctgggtgattgtatt 2ccccagt gtcaataatc gccaccttga tgccttttcc tgtgtagcct aaatcccatg 222tttgc tccgatataa ggcgcactgt catccatttg cggagatacg gcgtcttcgg 228gtggg gaattctcat gtttgacagc ttatcatgca atagttaccc ttattatcaa 234gaaag aaaaggatttttcgctacgc tcaaatcctt taaaaaaaca caaaagacca 24ttttaa tgtggtcttt attcttcaac taaagcaccc attagttcaa caaacgaaaa 246taaag tgggatattt ttaaaatata tatttatgtt acagtaatat tgacttttaa 252gattg attctaatga agaaagcaga caagtaagcc tcctaaattcactttagata 258ttagg aggcatatca aatgaacttt aataaaattg atttagacaa ttggaagaga 264gatat ttaatcatta tttgaaccaa caaacgactt ttagtataac cacagaaatt 27ttagtg ttttataccg aaacataaaa caagaaggat ataaatttta ccctgcattt 276cttag tgacaagggtgataaactca aatacagctt ttagaactgg ttacaatagc 282agagt taggttattg ggataagtta gagccacttt atacaatttt tgatggtgta 288aacat tctctggtat ttggactcct gtaaagaatg acttcaaaga gttttatgat 294ccttt ctgatgtaga gaaatataat ggttcgggga aattgtttcccaaaacacct 3cctgaaa atgctttttc tctttctatt attccatgga cttcatttac tgggtttaac 3aatatca ataataatag taattacctt ctacccatta ttacagcagg aaaattcatt 3aaaggta attcaatata tttaccgcta tctttacagg tacatcattc tgtttgtgat 3tatcatg caggattgtttatgaactct attcaggaat tgtcagatag gcctaatgac 324tttat aatatgagat aatgccgact gtacttttta cagtcggttt tctaatgtca 33cctgcc ccgttagttg aagaacgaag cggccgcaat tcttgaagac gaaagggcct 336tacgc ctatttttat aggttaatgt catgataata atggtttcttagacgtcagg 342ctttt cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc 348tgtat ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag 354gtatg agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg 36cctgtt tttgctcacccagaaacgct ggtgaaagta aaagatgctg aagatcagtt 366cacga gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt 372ccgaa gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt 378cccgt attgacgccg ggcaagagca actcggtcgc cgcatacactattctcagaa 384tggtt gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag 39ttatgc agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac 396tcgga ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac 4ccttgat cgttgggaaccggagctgaa tgaagccata ccaaacgacg agcgtgacac 4gatgcct gcagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac 4agcttcc cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact 42cgctcg gcccttccgg ctggctggtt tattgctgat aaatctggagccggtgagcg 426ctcgc ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt 432acacg acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat 438cctca ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta 444attta aaacttcatttttaatttaa aaggatctag gtgaagatcc tttttgataa 45atgacc aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga 456tcaaa ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac 462aacca ccgctaccag cggtggtttg tttgccggat caagagctaccaactctttt 468aggta actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc 474taggc caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat 48ttacca gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag 486agtta ccggataaggcgcagcggtc gggctgaacg gggggttcgt gcacacagcc 492tggag cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag 498cgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac 5agagcgc acgagggagc ttccaggggg aaacgcctgg tatctttatagtcctgtcgg 5tcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct 5gaaaaac gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc 522tgttc tttcctgcgt tatcccctga ttctgtggat aaccgtatta ccgcctttga 528ctgat accgctcgccgcagccgaac gaccgagcgc agcgagtcag tgagcgagga 534aagag cgcctgatgc ggtattttct ccttacgcat ctgtgcggta tttcacaccg 54tggtgc actctcagta caatctgctc tgatgccgca tagttaagcc agtatacact 546atcgc tacgtgactg ggtcatggct gcgccccgac acccgccaacacccgctgac 552ctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc 558ctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg 564ctcat cagcgtggtc gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc 57cgttga gtttctccagaagcgttaat gtctggcttc tgataaagcg ggccatgtta 576ggttt tttcctgttt ggtcacttga tgcctccgtg taagggggaa tttctgttca 582gtaat gataccgatg aaacgagaga ggatgctcac gatacgggtt actgatgatg 588gcccg gttactggaa cgttgtgagg gtaaacaact ggcggtatggatgcggcggg 594agaaa aatcactcag ggtcaatgcc agcgcttcgt taatacagat gtaggtgttc 6agggtag ccagcagcat cctgcgatgc agatccggaa cataatggtg cagggcgctg 6tccgcgt ttccagactt tacgaaacac ggaaaccgaa gaccattcat gttgttgctc 6tcgcaga cgttttgcagcagcagtcgc ttcacgttcg ctcgcgtatc ggtgattcat 6gctaacc agtaaggcaa ccccgccagc ctagccgggt cctcaacgac aggagcacga 624cgcac ccgtggccag gacccaacgc tgcccgagat gcgccgcgtg cggctgctgg 63ggcgga cgcgatggat atgttctgcc aagggttggt ttgcgcattcacagttctcc 636aattg attggctcca attcttggag tggtgaatcc gttagcgagg tgccgccggc 642ttcag gtcgaggtgg cccggctcca tgcaccgcga cgcaacgcgg ggaggcagac 648atagg gcggcgccta caatccatgc caacccgttc catgtgctcg ccgaggcggc 654tcgcc gtgacgatcagcggtccagt gatcgaagtt aggctggtaa gagccgcgag 66ccttga agctgtccct gatggtcgtc atctacctgc ctggacagca tggcctgcaa 666gcatc ccgatgccgc cggaagcgag aagaatcata atggggaagg ccatccagcc 672 6725 23 68Artificial Sequence Description ofArtificial Sequence vector 23 tcggcggccg cttcgtcgac cgaaacagca gttataaggc atgaagctgt ccggtttttg 6gtggc tgtgactgta aaaagaaatc gaaaaagacc gttttgtgtg aaaacggtct tgtttcc ttttaaccaa ctgccataac tcgaggccta cctagcttcc aagaaagata taacagcacaagagcgg aaagatgttt tgttctacat ccagaacaac ctctgctaaa 24tgaaa aattttgcaa aaagttgttg actttatcta caaggtgtgg tataataatc 3caacag caggacgctc tagacaattg agatcttaag aaaggaggtg ttaattaatg 36tggaa tcattggcgg aggctccgtt ggtcttttat gcgcctattatttgtcactt 42cgacg tgactgttgt gacgaggcgg caagaacagg ctgcggccat tcagtctgaa 48ccggc tttataaagg cggggaggaa ttcagggctg attgcagtgc ggacacgagt 54ttcgg actttgacct gcttgtcgtg acagtgaagc agcatcagct tcaatctgtt 6cgtcgc ttgaacgaatcgggaagacg aatatattat ttttgcaaaa cggcatgggg 66ccacg acctaaaaga ctggcacgtt ggccattcca tttatgttgg aatcgttgag 72agctg taagaaaatc ggatacagct gttgatcata caggcctagg tgcgataaaa 78cgcgt tcgacgatgc tgaaccagac cggctgaaca tcttgtttca gcataaccat84ttttc cgatttatta tgagacggat tggtaccgtc tgctgacggg caagctgatt 9atgcgt gtattaatcc tttaactgcg ttattgcaag tgaaaaatgg agaactgctg 96gccag cttatctggc ttttatgaag ctggtatttc aggaggcatg ccgcatttta acttgaaa atgaagaaaa ggcttgggagcgggttcagg ccgtttgtgg gcaaacgaaa gaatcgtt catcaatgct ggttgacgtc attggaggcc ggcagacgga agctgacgcc tatcggat acttattgaa ggaagcaagt cttcaaggtc ttgatgccgt ccacctagag tttatatg gcagcatcaa agcattggag cgaaatacca acaaagtggt ttactaagga ctgttttg gcggatgaga gaagattttc agcctgatac agattaaatc agaacgcaga cggtctga taaaacagaa tttgcctggc ggcagtagcg cggtggtccc acctgacccc gccgaact cagaagtgaa acgccgtagc gccgatggta gtgtggggtc tccccatgcg agtaggga actgccaggc atcaaataaaacgaaaggct cagtcgaaag actgggcctt gttttatc tgttgtttgt cggtgaacgc tctcctgagt aggacaaatc cgccgggagc atttgaac gttgcgaagc aacggcccgg agggtggcgg gcaggacgcc cgccataaac ccaggcat caaattaagc agaaggccat cctgacggat ggcctttttg cgtttctaca ctcttggt accgagacga tcgtcctctt tgttgtagcc catcactttt gctgaagagt gagccgaa agtgacggcg tattcattga gcggcagctg agtcgcaccg acagaaatcg tctcttga tgtgcccggc gatccgactg tccagccgtt cggtccgctg ttgccgtttg gtaacagc gacaacgcct tctgacatggcccagtcaag cgctgtgctt gtcgcccagt gggttgtt taaagagttt ccgagagaca ggttcatcac atctgccccg tcctgcactg cgttccac gcccgcgatg acgttttccg ttgtgccgct tccgccaggc cctaacacac 2aagcaag aagtgtggca tcaggcgcta cgcctttaat cgttccgttt gcagccacag 2cggctac gtgtgtgcca tggtcagttg cctcgcccct cggatcgccg gttggtgttt 2ttggatc gtaatcattg tccacaaaat cgtatccttt atattgtcca aagtttttct 222tctgg gtgattgtat tcaaccccag tgtcaataat cgccaccttg atgccttttc 228tagcc taaatcccat gcatcgtttgctccgatata aggcgcactg tcatccattt 234gatac ggcgtcttcg gagattgtgg ggaattctca tgtttgacag cttatcatgc 24gttacc cttattatca agataagaaa gaaaaggatt tttcgctacg ctcaaatcct 246aaaac acaaaagacc acatttttta atgtggtctt tattcttcaa ctaaagcacc 252gttca acaaacgaaa attggataaa gtgggatatt tttaaaatat atatttatgt 258taata ttgactttta aaaaaggatt gattctaatg aagaaagcag acaagtaagc 264aaatt cactttagat aaaaatttag gaggcatatc aaatgaactt taataaaatt 27tagaca attggaagag aaaagagatatttaatcatt atttgaacca acaaacgact 276tataa ccacagaaat tgatattagt gttttatacc gaaacataaa acaagaagga 282atttt accctgcatt tattttctta gtgacaaggg tgataaactc aaatacagct 288aactg gttacaatag cgacggagag ttaggttatt gggataagtt agagccactt 294aattt ttgatggtgt atctaaaaca ttctctggta tttggactcc tgtaaagaat 3ttcaaag agttttatga tttatacctt tctgatgtag agaaatataa tggttcgggg 3ttgtttc ccaaaacacc tatacctgaa aatgcttttt ctctttctat tattccatgg 3tcattta ctgggtttaa cttaaatatcaataataata gtaattacct tctacccatt 3acagcag gaaaattcat taataaaggt aattcaatat atttaccgct atctttacag 324tcatt ctgtttgtga tggttatcat gcaggattgt ttatgaactc tattcaggaa 33cagata ggcctaatga ctggctttta taatatgaga taatgccgac tgtacttttt 336cggtt ttctaatgtc actaacctgc cccgttagtt gaagaacgaa gcggccgcaa 342gaaga cgaaagggcc tcgtgatacg cctattttta taggttaatg tcatgataat 348tttct tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg 354ttttc taaatacatt caaatatgtatccgctcatg agacaataac cctgataaat 36caataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat 366ttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt 372atgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag 378agatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa 384tgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg 39atacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct 396atggc atgacagtaa gagaattatgcagtgctgcc ataaccatga gtgataacac 4ggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca 4catgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat 4aaacgac gagcgtgaca ccacgatgcc tgcagcaatg gcaacaacgt tgcgcaaact 42actggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc 426aagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga 432ctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg 438cctcc cgtatcgtag ttatctacacgacggggagt caggcaacta tggatgaacg 444gacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca 45tactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta 456agatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca 462cgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 468tctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 474agcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 48gtcctt ctagtgtagc cgtagttaggccaccacttc aagaactctg tagcaccgcc 486acctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 492ccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 498gttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 5gcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 5aagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg 5tctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 522caggg gggcggagcc tatggaaaaacgccagcaac gcggcctttt tacggttcct 528tttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga 534gtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg 54gagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca 546gcggt atttcacacc gcatatggtg cactctcagt acaatctgct ctgatgccgc 552taagc cagtatacac tccgctatcg ctacgtgact gggtcatggc tgcgccccga 558gccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac 564agctg tgaccgtctc cgggagctgcatgtgtcaga ggttttcacc gtcatcaccg 57gcgcga ggcagctgcg gtaaagctca tcagcgtggt cgtgaagcga ttcacagatg 576ctgtt catccgcgtc cagctcgttg agtttctcca gaagcgttaa tgtctggctt 582aaagc gggccatgtt aagggcggtt ttttcctgtt tggtcacttg atgcctccgt 588gggga atttctgttc atgggggtaa tgataccgat gaaacgagag

aggatgctca 594cgggt tactgatgat gaacatgccc ggttactgga acgttgtgag ggtaaacaac 6cggtatg gatgcggcgg gaccagagaa aaatcactca gggtcaatgc cagcgcttcg 6atacaga tgtaggtgtt ccacagggta gccagcagca tcctgcgatg cagatccgga 6taatggtgcagggcgct gacttccgcg tttccagact ttacgaaaca cggaaaccga 6ccattca tgttgttgct caggtcgcag acgttttgca gcagcagtcg cttcacgttc 624cgtat cggtgattca ttctgctaac cagtaaggca accccgccag cctagccggg 63caacga caggagcacg atcatgcgca cccgtggccaggacccaacg ctgcccgaga 636cgcgt gcggctgctg gagatggcgg acgcgatgga tatgttctgc caagggttgg 642gcatt cacagttctc cgcaagaatt gattggctcc aattcttgga gtggtgaatc 648gcgag gtgccgccgg cttccattca ggtcgaggtg gcccggctcc atgcaccgcg 654acgcggggaggcaga caaggtatag ggcggcgcct acaatccatg ccaacccgtt 66gtgctc gccgaggcgg cataaatcgc cgtgacgatc agcggtccag tgatcgaagt 666tggta agagccgcga gcgatccttg aagctgtccc tgatggtcgt catctacctg 672acagc atggcctgca acgcgggcat cccgatgccgccggaagcga gaagaatcat 678ggaag gccatccagc ctcgcg 68867 DNA Artificial Sequence Description of Artificial Sequence vector 24 aagctttctc aagaagcgaa caagaaaaaa gaagagcaga ttaaacagct tcaagagttt 6tagat tcagcgccaa tgcgtctaaa tctaagcaggctacatcaag aaagaaactt gaaaaaa tcacgctgga tgatattaaa ccgtcttccc gccgctatcc ttatgttaac acgccgg aacgggaaat cggaaatgat gttcttcgcg tggaaggctt aacaaaaaca 24tggcg taaaggtgct tgacaatgtc agctttatta tgaatcgaga agataaaatt 3tcactggccgaaatga acttgctgtt actacgctgt ttaaaatcat ttccggggaa 36agctg acagcggaac gtttaaatgg ggtgttacca catctcaagc gtattttcca 42caaca gcgaatattt cgaaggcagt gatctgaacc ttgtagactg gcttcgccaa 48tccgc acgaccaaag tgagagcttt ttacgcggtt tcttaggacgcatgctgttc 54agaag aagtccacaa aaaagcaaat gtactttccg ggggagaaaa ggtccgctgt 6tgtcga aagcgatgct ttctggcgcc aatattttaa ttttggatga gccgaccaac 66agacc tagagtccat tacagcgctc aataacggct taatcagctt taaaggcgct 72gttta cttcccatgaccatcagttt gtgcagacca ttgccaacag aattatagaa 78accta acggcatcgt cgataagcaa atgagctatg acgagttcct tgaaaatgct 84gcaga aaaaattgac tgaactatac gccgaataaa aaagcagaga tttctctgct 9ttgata cctaaatgtg aaaggagatc acaacatgaa atttttggtt gtcggagcag96gtagg cgggtatatt ggcggacggc tttcggagaa aggaaatgat gtgacatttc gtgcgcca aaaacgagct gagcagctta aaaaaaccgg gcttgtcatc catagtgaaa gggaatgt atcatttcag cccgaactaa tcagtgccgg agaaacaggg caatttgatg gttatcat tgcttctaaa gcatactcgcttggtcaagt gatagaggat gtcaaaccat atccatca agaatctgtc attatccctt ttttaaatgg gtaccgccac tatgagcagc tttgcggc attttcaaaa gaacaggtgc tgggcggcct gtgttttata gaaagtgctt gacaacaa aggagaaatt catcatacga gcgcatcgca tcgttttgta tttggagaat aacggcga gcgtacggag cggataagag cgcttgaaga ggcattttca ggtgtgaagg gaagtcat cattagcggg catatcgaga agatcccctg cagcaatagt tacccttatt caagataa gaaagaaaag gatttttcgc tacgctcaaa tcctttaaaa aaacacaaaa ccacattt tttaatgtgg tctttattcttcaactaaag cacccattag ttcaacaaac aaattgga taaagtggga tatttttaaa atatatattt atgttacagt aatattgact taaaaaag gattgattct aatgaagaaa gcagacaagt aagcctccta aattcacttt ataaaaat ttaggaggca tatcaaatga actttaataa aattgattta gacaattgga agaaaaga gatatttaat cattatttga accaacaaac gacttttagt ataaccacag attgatat tagtgtttta taccgaaaca taaaacaaga aggatataaa ttttaccctg tttatttt cttagtgaca agggtgataa actcaaatac agcttttaga actggttaca agcgacgg agagttaggt tattgggataagttagagcc actttataca atttttgatg 2tatctaa aacattctct ggtatttgga ctcctgtaaa gaatgacttc aaagagtttt 2atttata cctttctgat gtagagaaat ataatggttc ggggaaattg tttcccaaaa 2ctatacc tgaaaatgct ttttctcttt ctattattcc atggacttca tttactgggt 222ttaaa tatcaataat aatagtaatt accttctacc cattattaca gcaggaaaat 228aataa aggtaattca atatatttac cgctatcttt acaggtacat cattctgttt 234ggtta tcatgcagga ttgtttatga actctattca ggaattgtca gataggccta 24ctggct tttataatat gagataatgccgactgtact ttttacagtc ggttttctaa 246ctaac ctgccccgtt agttgaagaa ggtttttata ttacagctcc cgggagatct 252cacta gtccaaacga cagaaggcga ccacctgcat ggatttttga ttgaaaaagc 258gttta tctctcgctg caccagtatt agaaaccgtt tatgcgaatc tgcaaatgta 264cagaa aaataaaaaa aggaggcgga aaagcctcct tttatttact taaaaagccc 27tccgtt tctgaagata ggctctcttt tcccgtctgc cgtaattccg tcaatattca 276ttaga accgatcata aagtccacgt gtgtaatgct ttcatttagg ccttctttga 282tcttc acgagacatc tgctttccgccttcaatatt aaaggcatag gcgcttccga 288aaatg atttgacgcg ttttcatcaa acagcgtgtt atagaaaaga atgtttgatt 294atagg cgaatcgtaa ggaacaagtg ccacttcacc taaatagtga gaaccttcat 3tttccac cagttctttt aaaatatcct cacctttttc agctttaatg tcgactatac 3cattttc aaacgtcagg gtgaaatttt caataatatt tccgccgtag cttaatggtt 3tgcttga taccactccg tcaaccccgt ctttttgcgg cagcgtgaac acttcttctg 3gcatatt ggccataaac tcatggccac tttcattcac gcttcccgca cctgcccaaa 324ttcct aggcagctta attgttagatcagttccttc tgcttgataa tgtaaggcag 33atgtct ctcgttcaaa tggtcaactt tttcatgaag attttggtca tgattgatcc 336tgaac cgggttgtct tcatttacgc gcgtcgcttt aaaaatttct tcccacagaa 342atcgc ttcctcctct gatttgccag gaaacacctt gtgagcccag cctgctgatg 348cctac gacagtccag ctgactttgt ctgattgaat atattgtctg tatgtatgta 354ttgcc tgctgctttt tggaatgccg caatccgttt ggaatctata ccttttagca 36tgggtt cgacgacaca acagaaatga aagcagctcc atttttggca agctcttctc 366tttgc ttcccattca ggatattcttcaaatgcttc aaacggcgca agttcgtatt 372ttggc gacttcgtca tcctgccaat tcacggtgac gttttttgcg cccttttcat 378tgttt tacaattaaa cggacaaaat cccgaacgtc tgttgaagca tttacgacta 384tggcc tttttggaca ttaacgc 3867 25 87Artificial SequenceDescription of Artificial Sequence vector 25 gcggccgctt cgtcgaccga aacagcagtt ataaggcatg aagctgtccg gtttttgcaa 6gctgt gactgtaaaa agaaatcgaa aaagaccgtt ttgtgtgaaa acggtctttt ttccttt taaccaactg ccataactcg aggcctacct agcttccaag aaagatatcc cagcaca agagcggaaa gatgttttgt tctacatcca gaacaacctc tgctaaaatt 24aaaat tttgcaaaaa gttgttgact ttatctacaa ggtgtggtat aataatctta 3cagcag gacgctctag aggaggagac taacatgaaa tttttggttg tcggagcagg 36taggc gggtatattg gcggacggct ttcggagaaaggaaatgatg tgacatttct 42gccaa aaacgagctg agcagcttaa aaaaaccggg cttgtcatcc atagtgaaaa 48atgta tcatttcagc ccgaactaat cagtgccgga gaaacagggc aatttgatgt 54tcatt gcttctaaag catactcgct tggtcaagtg atagaggatg tcaaaccatt 6catcaagaatctgtca ttatcccttt tttaaatggg taccgccact atgagcagct 66cggca ttttcaaaag aacaggtgct gggcggcctg tgttttatag aaagtgcttt 72acaaa ggagaaattc atcatacgag cgcatcgcat cgttttgtat ttggagaatg 78gcgag cgtacggagc ggataagagc gcttgaagag gcattttcaggtgtgaaggc 84tcatc attagcgggc atatcgagaa ggacatttgg aaaaagtatc tctttattgc 9caagcg gggatcacaa cgttatttca acgaccgctt ggcccaatcc tcgccacaga 96gacgt cacacggccc aaactcttat tggggaaatt tgcactgttt tacgaaaaga gtgttccg gctgatccggctcttgagga agagagcttt cgtacgatga ccagcatgtc accatatg aagtcctcca tgcttcggga tatggaaaac ggccaaacga cagaaggcga acctgcat ggatttttga ttgaaaaagc aaaacgttta tctctcgctg caccagtatt aaaccgtt tatgcgaatc tgcaaatgta tgaagcagaa aaataaaaaaaggaggcgga agcctcct tttatttact taaaaagccc aatttccgtt tctgaagata ggctctcttt ccgtctgc cgggatcctg ttttggcgga tgagagaaga ttttcagcct gatacagatt atcagaac gcagaagcgg tctgataaaa cagaatttgc ctggcggcag tagcgcggtg cccacctg accccatgccgaactcagaa gtgaaacgcc gtagcgccga tggtagtgtg gtctcccc atgcgagagt agggaactgc caggcatcaa ataaaacgaa aggctcagtc aagactgg gcctttcgtt ttatctgttg tttgtcggtg aacgctctcc tgagtaggac atccgccg ggagcggatt tgaacgttgc gaagcaacgg cccggagggtggcgggcagg gcccgcca taaactgcca ggcatcaaat taagcagaag gccatcctga cggatggcct ttgcgttt ctacaaactc ttggtaccca gaaaaagcgg caaaagcggc tgttaaaaaa gaaatcga agaagctgtc tgccgctaag acggaatatc aaaagcgttc tgctgttgtg atctttaa aagtcacagccgatgaatcc cagcaagatg tcctaaaata cttgaacacc gaaagata aaggaaatgc agaccaaatt cattcttatt atgtggtgaa cgggattgct tcatgcct caaaagaggt tatggaaaaa gtggtgcagt ttcccgaagt ggaaaaggtg 2cctaatg agaaacggca gctttttaag tcatcctccc catttaatatgaaaaaagca 2aaagcta ttaaagcaac tgacggtgtg gaatggaatg tagaccaaat cgatgcccca 2gcttggg cacttggata tgatggaact ggcacggttg ttgcgtccat tgataccggg 222atgga atcatccggc attaaaagag aaatatcgcg gatataatcc ggaaaatcct 228gcctg aaaatgaaatgaactggtat gatgccgtag caggcgaggc aagcccttat 234tttgg ctcatggaac ccacgtgaca ggcacgatgg tgggctctga acctgatgga 24atcaaa tcggtgtagc acctggcgca aaatggattg ctgttaaagc gttctctgaa 246cggca ctgatgctga cattttggaa gctggtgaat gggttttagcaccaaaggac 252aggaa atccccaccc ggaaatggct cctgatgttg tcaataactc atggggaggg 258tggac ttgatgaatg gtacagagac atggtcaatg cctggcgttc ggccgatatt 264tgagt tttcagcggg gaatacggat ctctttattc ccggcgggcc tggttctatc 27atccgg caaactatccagaatcgttt gcaactggag cgactgagaa ttccaattcc 276gagag aaaagaaaat cgctaatgtt gattactttg aacttctgca tattcttgaa 282aaagg ctgaaagagt aaaagattgt gctgaaatat tagagtataa acaaaatcgt 288aggcg aaagaaagtt gtatcgagtg tggttttgta aatccaggctttgtccaatg 294ctgga ggagagcaat gaaacatggc attcagtcac aaaaggttgt tgctgaagtt 3aaacaaa agccaacagt tcgttggttg tttctcacat taacagttaa aaatgtttat 3ggcgaag aattaaataa gagtttgtca gatatggctc aaggatttcg ccgaatgatg 3tataaaa aaattaataaaaatcttgtt ggttttatgc gtgcaacgga agtgacaata 3aataaag ataattctta taatcagcac atgcatgtat tggtatgtgt ggaaccaact 324taaga atacagaaaa ctacgtgaat caaaaacaat ggattcaatt ttggaaaaag 33tgaaat tagactatga tccaaatgta aaagttcaaa tgattcgaccgaaaaataaa 336atcgg atatacaatc ggcaattgac gaaactgcaa aatatcctgt aaaggatacg 342tatga ccgatgatga agaaaagaat ttgaaacgtt tgtctgattt ggaggaaggt 348ccgta aaaggttaat ctcctatggt ggtttgttaa aagaaataca taaaaaatta 354tgatg acacagaagaaggcgatttg attcatacag atgatgacga aaaagccgat 36atggat tttctattat tgcaatgtgg aattgggaac ggaaaaatta ttttattaaa 366gttca acaaacgggc catattgttg tataagtgat gaaatactga atttaaaact 372tatat gtggtaaaat gttttaatca agtttaggag gaattaattatgaagtgtaa 378gtaac agggttcaat taaaagaggg aagcgtatca ttaaccctat aaactacgtc 384tcatt attggagggt gaaatgtgaa tacatcctat tcacaatcga atttacgaca 39caaatt ttaatttggc tttgcatttt atcttttttt agcgtattaa atgaaatggt 396acgtc tcattacctgatattgcaaa tgattttaat aaaccacctg cgagtacaaa 4ggtgaac acagccttta tgttaacctt ttccattgga acagctgtat atggaaagct 4tgatcaa ttaggcatca aaaggttact cctatttgga attataataa attgtttcgg 4ggtaatt gggtttgttg gccattcttt cttttcctta cttattatggctcgttttat 42ggggct ggtgcagctg catttccagc actcgtaatg gttgtagttg cgcgctatat 426aggaa aataggggta aagcatttgg tcttattgga tcgatagtag ccatgggaga 432tcggt ccagcgattg gtggaatgat agcccattat attcattggt cctatcttct 438ttcct atgataacaattatcactgt tccgtttctt atgaaattat taaagaaaga 444ggata aaaggtcatt ttgatatcaa aggaattata ctaatgtctg taggcattgt 45tttatg ttgtttacaa catcatatag catttctttt cttatcgtta gcgtgctgtc 456tgata tttgtaaaac atatcaggaa agtaacagat ccttttgttgatcccggatt 462aaaat atacctttta tgattggagt tctttgtggg ggaattatat ttggaacagt 468ggttt gtctctatgg ttccttatat gatgaaagat gttcaccagc taagtactgc 474tcgga agtgtaatta ttttccctgg aacaatgagt gtcattattt tcggctacat 48gggata cttgttgatagaagaggtcc tttatacgtg ttaaacatcg gagttacatt 486ctgtt agctttttaa ctgcttcctt tcttttagaa acaacatcat ggttcatgac 492taatc gtatttgttt taggtgggct ttcgttcacc aaaacagtta tatcaacaat 498caagt agcttgaaac agcaggaagc tggtgctgga atgagtttgcttaactttac 5cttttta tcagagggaa caggtattgc aattgtaggt ggtttattat ccataccctt 5tgatcaa aggttgttac ctatggaagt tgatcagtca acttatctgt atagtaattt 5attactt ttttcaggaa tcattgtcat tagttggctg gttaccttga atgtatataa 522ctcaa agggatttctaaatcgttaa gggatcaact ttgggagaga gttcaaaatt 528ttttt ttataacagt tcgaagcggc cgcaattctt gaagacgaaa gggcctcgtg 534cctat ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc 54ttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaatacattcaaat 546tccgc tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag 552gagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt 558ttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt 564agtgg gttacatcgaactggatctc aacagcggta agatccttga gagttttcgc 57aagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta 576tattg acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac 582tgagt actcaccagt cacagaaaag catcttacgg atggcatgacagtaagagaa 588cagtg ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg 594aggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc 6gatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg 6cctgcag caatggcaacaacgttgcgc aaactattaa ctggcgaact acttactcta 6tcccggc aacaattaat agactggatg gaggcggata aagttgcagg accacttctg 6tcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg 624cggta tcattgcagc actggggcca gatggtaagc cctcccgtatcgtagttatc 63cgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt 636actga ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt 642aaaac ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc 648caaaa tcccttaacgtgagttttcg ttccactgag cgtcagaccc cgtagaaaag 654aggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa 66caccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg 666aactg gcttcagcag agcgcagata ccaaatactg tccttctagtgtagccgtag 672ccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg 678agtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga 684accgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc 69agcgaa cgacctacaccgaactgaga tacctacagc gtgagctatg agaaagcgcc 696tcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga 7cgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt 7cacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcggagcctatgg 7aacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac 72tctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc ctttgagtga 726taccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag cgaggaagcg 732gcgcc tgatgcggtattttctcctt acgcatctgt gcggtatttc acaccgcata 738cactc tcagtacaat ctgctctgat gccgcatagt taagccagta tacactccgc 744ctacg tgactgggtc atggctgcgc cccgacaccc gccaacaccc gctgacgcgc 75acgggc ttgtctgctc ccggcatccg cttacagaca agctgtgaccgtctccggga 756atgtg tcagaggttt tcaccgtcat caccgaaacg cgcgaggcag ctgcggtaaa 762tcagc gtggtcgtga agcgattcac agatgtctgc ctgttcatcc gcgtccagct 768agttt ctccagaagc gttaatgtct ggcttctgat aaagcgggcc atgttaaggg 774ttttc ctgtttggtcacttgatgcc tccgtgtaag ggggaatttc tgttcatggg 78atgata ccgatgaaac gagagaggat gctcacgata cgggttactg atgatgaaca 786ggtta ctggaacgtt gtgagggtaa acaactggcg gtatggatgc ggcgggacca 792aaatc actcagggtc aatgccagcg cttcgttaat acagatgtaggtgttccaca 798gccag cagcatcctg cgatgcagat ccggaacata atggtgcagg gcgctgactt 8cgtttcc agactttacg aaacacggaa accgaagacc attcatgttg ttgctcaggt 8agacgtt ttgcagcagc agtcgcttca cgttcgctcg cgtatcggtg attcattctg 8accagta aggcaaccccgccagcctag ccgggtcctc aacgacagga gcacgatcat 822cccgt ggccaggacc caacgctgcc cgagatgcgc cgcgtgcggc tgctggagat 828acgcg atggatatgt tctgccaagg gttggtttgc gcattcacag ttctccgcaa 834gattg gctccaattc ttggagtggt gaatccgtta gcgaggtgccgccggcttcc 84aggtcg aggtggcccg gctccatgca ccgcgacgca acgcggggag gcagacaagg 846ggcgg cgcctacaat ccatgccaac ccgttccatg tgctcgccga ggcggcataa 852cgtga cgatcagcgg tccagtgatc gaagttaggc tggtaagagc cgcgagcgat 858aagct gtccctgatggtcgtcatct acctgcctgg acagcatggc ctgcaacgcg 864cccga tgccgccgga agcgagaaga atcataatgg ggaaggccat ccagcctcgc 87 87688 DNA Artificial Sequence Description of Artificial Sequence vector 26 tgcgccgcta cagggcgcgt ccattcgcca ttcaggctgcgcaactgttg ggaagggcga 6gcggg cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga agttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgaa taatacg actcactata gggcgaattg ggcccgacgt cgcatgcacc aggcttctca 24tgacttagaaaacct cttgaatgaa gctgcgcttg tagcggctcg tcaaaacaag 3aaatcg atgcgcgtga tattgacgaa gcgacggacc gtgtaattgc cggacccgct 36gagcc gcgttatctc caagaaagaa cgcaatatcg tggcttatca cgaaggcgga 42cgtta tcggtctcgt tttagatgag gcagatatgg ttcataaagtaacgattgtt 48gggcc aggctggcgg ttatgctgtt atgctgccaa gagaagaccg ttatttccaa 54gccgg agctgcttga taaaattgtc ggcctcttgg gcggacgtgt tgctgaagag 6tcttcg gtgaagtcag cacaggggcg cacaatgact tccagcgtgc gacgaatatt 66acgaa tggttacagaattcggtatg tcagaaaaac tgggaccgtt gcaatttgga 72tcagg gcggtcaggt attcttaggc cgtgatttca acaacgaaca gaactacagt 78aatcg cttacgaaat tgatcaggaa attcagcgca tcatcaaaga atgttatgag 84gaaac aaatcctgac tgaaaatcgt gacaagcttg aattgattgc ccaaacgctt9aagttg aaacgcttga cgctgaacaa atcaaacacc ttatcgatca tggaacatta 96gcgta atttctcaga tgatgaaaag aacgatgatg tgaaagtaaa cattctgaca aacagaag aaaagaaaga cgatacgaaa gagtaattcg ctttctttct aaaaaaactg ggctgacg ctggcagttt ttttatgtaaatgattggct cagctgcggc ttttacaatc ccaattct ggtatcgatt tgtttacaaa tgagccgctg atcgtgtatg gtattgtaga gtttgtaa aaagtaaagt agagaaacta ttcaaaagtg gtgatagagg ttgttactgg atcgatgt ggggaacacc

ctgcagctcg agtgaaatac cgcacagatg cgtaaggaga ataccgca tcaggcgata aacccagcga accatttgag gtgataggta agattatacc ggtatgaa aacgagaatt ggacctttac agaattactc tatgaagcgc catatttaaa gctaccaa gacgaagagg atgaagagga tgaggaggca gattgccttgaatatattga atactgat aagataatat atcttttata tagaagatat cgccgtatgt aaggatttca gggcaagg cataggcagc gcgcttatca atatatctat agaatgggca aagcataaaa ttgcatgg actaatgctt gaaacccagg acaataacct tatagcttgt aaattctatc aattgtgg tttcaaaatcggctccgtcg atactatgtt atacgccaac tttcaaaaca tttgaaaa agctgttttc tggtatttaa ggttttagaa tgcaaggaac agtgaattgg ttcgtctt gttataatta gcttcttggg gtatctttaa atactgtaga aaagaggaag aataataa atggctaaaa tgagaatatc accggaattg aaaaaactgatcgaaaaata gctgcgta aaagatacgg aaggaatgtc tcctgctaag gtatataagc tggtgggaga atgaaaac ctatatttaa aaatgacgga cagccggtat aaagggacca cctatgatgt 2acgggaa aaggacatga tgctatggct ggaaggaaag ctgcctgttc caaaggtcct 2ctttgaa cggcatgatggctggagcaa tctgctcatg agtgaggccg atggcgtcct 2ctcggaa gagtatgaag atgaacaaag ccctgaaaag attatcgagc tgtatgcgga 222tcagg ctctttcact ccatcgacat atcggattgt ccctatacga atagcttaga 228gctta gccgaattgg attacttact gaataacgat ctggccgatgtggattgcga 234gggaa gaagacactc catttaaaga tccgcgcgag ctgtatgatt ttttaaagac 24aagccc gaagaggaac ttgtcttttc ccacggcgac ctgggagaca gcaacatctt 246aagat ggcaaagtaa gtggctttat tgatcttggg agaagcggca gggcggacaa 252atgac attgccttctgcgtccggtc gatcagggag gatatcgggg aagaacagta 258agcta ttttttgact tactggggat caagcctgat tgggagaaaa taaaatatta 264tactg gatgaattgt tttagtacct agatttagat gtctaaaaag ctttaactac 27ttttta gacatctaat cttttctgaa gtacatccgc aactgtccatactctgatgt 276atctt ttctaaaagt tcgctagata ggggtcccga gcgcctacga ggaatttgta 282attcg ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc ggtcgactgg 288aaaac aggacccaag gtcattgcga caggaggcct ggcgccgctc attgcgaacg 294gattg tatagacatcgttgatccat tcttaaccct aaaagggctg gaattgattt 3aaagaaa ccgcgtagga agtgtatagg aggtttagta atggattatt tagtaaaagc 3tgcgtat gacggaaaag ttcgggctta tgcagcgaga acgactgata tggtaaatga 3gcagaga cgccatggta cgtggccgac agcatccgct gcactaggccgtacaatgac 3ttcactt atgctcggcg ctatgctgaa gggcgatgat aagctgaccg tgaaaatcga 324gaggt ccgatcggag ctattgtagc tgatgccaat gccaaaggag aagtcagagc 33gtctct aacccgcaag ttcattttga tttaaatgaa caaggtaagc ttgatgtcag 336cggtt ggaacaaacggaacgttaag tgtcgtaaaa gatttaggtt tgcgcgagtt 342cagga caagtagaaa tcgtttcagg agaattagga gatgatttta cttactatct 348catct gagcaggttc cttcatcagt gggcgtaggt gtgctcgtaa atcctgacaa 354ttctt gcggcagggg gctttattat tcagctgatg ccgggaacagatgatgaaac 36acaaaa attgaacagc gtctatctca agtagagccg atttctaagc tcatccaaaa 366tgaca ccagaagaaa ttttagaaga agtcctaggc gagaaacctg agattttgga 372tgcct gtcagattcc attgcccttg ttcaaaagaa cggttcgaaa cagccatttt 378taggc aaaaaagaaattcaagatat gatagaagaa gatggacaag ccgaagcagt 384atttt tgtaatgaaa agtacttatt tacaaaagaa gagctggaag ggcttcgtga 39actacc cgctaagctc tttagcgggt ttttaatttg agaaaagggg ctgaaagcag 396aaatc aagaacaatc tggacgcgtt ggatgcatag cttgagtattctatagtgtc 4taaatag cttggcgtaa tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc 4caattcc acacaacata cgagccggaa gcataaagtg taaagcctgg ggtgcctaat 4tgagcta actcacatta attgcgttgc gctcactgcc cgctttccag tcgggaaacc 42gtgcca gctgcattaatgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg 426tcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag 432tcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag 438aacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaaggccgcgttgc 444ttttt cgataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc 45gtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc 456cgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt 462agcgt ggcgctttctcatagctcac gctgtaggta tctcagttcg gtgtaggtcg 468tccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat 474aacta tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag 48tggtaa caggattagc agagcgaggt atgtaggcgg tgctacagagttcttgaagt 486cctaa ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc 492acctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta 498ggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag 5ctttgat cttttctacggggtctgacg ctcagtggaa cgaaaactca cgttaaggga 5tggtcat gagattatca aaaaggatct tcacctagat ccttttaaat taaaaatgaa 5ttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac caatgcttaa 522gaggc acctatctca gcgatctgtc tatttcgttc atccatagttgcctgactcc 528gtgta gataactacg atacgggagg gcttaccatc tggccccagt gctgcaatga 534cgaga cccacgctca ccggctccag atttatcagc aataaaccag ccagccggaa 54cgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct attaattgtt 546gaagc tagagtaagtagttcgccag ttaatagttt gcgcaacgtt gttggcattg 552ggcat cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc tccggttccc 558tcaag gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt agctccttcg 564ccgat cgttgtcaga agtaagttgg ccgcagtgtt atcactcatggttatggcag 57gcataa ttctcttact gtcatgccat ccgtaagatg cttttctgtg actggtgagt 576accaa gtcattctga gaataccgcg cccggcgacc gagttgctct tgcccggcgt 582cggga taatagtgta tgacatagca gaactttaaa agtgctcatc attggaaaac 588tcggg gcgaaaactctcaaggatct taccgctgtt gagatccagt tcgatgtaac 594cgtgc acccaactga tcttcagcat cttttacttt caccagcgtt tctgggtgag 6aaacagg aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa 6tcatact cttccttttt caatattatt gaagcattta tcagggttattgtctcatga 6gatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg cgcacatttc 6gaaaagt gccacctgta tgcggtgtga aataccgcac agatgcgtaa ggagaaaata 624tcagg cgaaattgta aacgttaata ttttgttaaa attcgcgtta aatatttgtt 63cagctc attttttaaccaataggccg aaatcggcaa aatcccttat aaatcaaaag 636accga gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga 642gactc caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg 648tcacc caaatcaagt tttttgcggt cgaggtgccg taaagctctaaatcggaacc 654gggag cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg 66gaagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc 666accac cacacccgcc gcgcttaa 6688 27 88Artificial Sequence Description of ArtificialSequence vector 27 tgcgccgcta cagggcgcgt ccattcgcca ttcaggctgc gcaactgttg ggaagggcga 6gcggg cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga agttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgaa taatacg actcactatagggcgaattg ggcccgacgt cgcatgctgg atgaaaagcc 24ccgct tttcaggtct gtcagcagct ttttcctgct gtatatgaaa aggaattgtt 3acgatg tcagaaacgg caggtcacct tgatgtgttg gaggctgaag aagccatcac 36attgg gaaggaaata ccgtatactt taaaacaatg aagaggtgaa atgggtgaaa42agcgg gaaaaaggat ttggataacc ggcgcttcag gagggcttgg agaaagaatc 48cttat gcgcggctga aggagcccat gtcctgctgt cggctagacg cgaggatcgt 54agaaa tcaaaaggaa aataaccgag gaatggagcg gacagtgtga gatttttcct 6atgtcg gccgcctaga ggatatcgcccgggtccgcg atcagatcgg ctcgattgat 66gatta acaatgcagg cttcggtata tttgaaacgg ttttagactc tacattggat 72gaaag cgatgtttga tgtgaatgtc ttcggcctga tcgcctgtac aaaagcggtg 78gcaaa tgcttgagca aaaaaaggga catatcatca atatcgcctc tcaagcgggg 84cgcca caccgaagtc tagcctgtat tccgcgacca aacatgccgt gttaggttac 9acgctt tgcggatgga gctttcggga accggcattt atgtgacaac agtcaacccg 96gattc agacggactt tttttccatt gctgataaag gcggggacta cgccaaaaat cggccgct ggatgcttga tcctgatgac gtggcagctcaaattacagc tgcaattttt gaaaaagc gggagatcaa tcttccgcgt ttaatgaatg ccggcactaa gctgtatcag gtttccag ctcttgtaga aaagctggca ggacgcgcgc tcatgaaaaa ataatgatag ctgcctgt ggtggagtgg cttgtttctc acggggcagt ttttgatagt ggaagggaga ttgttgaatgtcagttca ttcagaagtc cttcatgctc tgcttaaaga tccgtttatt gaaactga ttgatgcaga gcctgtattc tgggcaaatt caggcaagaa agaggggcca accccgtg cagatgagtg ggcaaccgag atagcggaag cggaaaaaag aatgcagcgg tgcacctt acattgccga ggtgtttcct gagacgaaaggcgctaaagg aatcatcgag tccgcttt ttgaggtgca gcatatgaag ggaaagctgg aagcggcata tcagcagcca tcccggaa gatggctttt aaagtgcgac catgagcttc cgatttcagg atcgattaaa gaggggcg ggatttatga agtgttaaag tatgctgaaa atctcgcgct tcaagaagga gcttcaggaaaccgatga ttaccgcatc ttacaggaag agcggtttac cgggtttttc ccgctatt cgattgctgt cggttcgaca ggaaatctag gtttaagcat cggcatcatc cgcggcac tcgggtttcg cgtgacagtg catatgtccg ccgatgctaa gcagtggaaa ggatctcc tccgccaaaa gggagtcact gttatggagtacgaaacaga ttacagtgaa ggtgaacg aagggagacg gcaggcggaa caagatccat tctgttattt tattgatgat acattctc gtcagctgtt cttaggatat gctgttgctg caagccgatt aaaaacacag 2gactgta tgaatataaa gccaagtctt gagacgccct tgtttgtgta tctgccgtgc 2gtcggcggaggaccggg cggtgtagca tttgggctga agcttttata cggagatgat 2catgtgt ttttcgcaga accaactcat tcaccttgta tgctgttagg gctttattca 222tcacg agaagatctc cgtccaggat atcggcctgg ataatcagac ggctgctgac 228tgccg tagggaggcc gtcaggattt gtcggcaagctgattgaacc gcttctgagc 234ttata cggtagagga caatacgctt tatactttgc ttcatatgct ggctgtatct 24ataaat atttagagcc ctctgctctt gctggcatgt tcgggccggt tcagcttttt 246agaag agggaaggcg ctatgctcag aaatataaga tggaacatgc cgtacatgtc 252gggaacgggaggaag catggttcca aaagatgaaa tggctgcgta taaccgaatc 258tgatt tgctaaaaaa acgaaatgga aaataagcag acagtgaaaa ggttttccgt 264tcttt gtaagggttt taacctacag agagtcaggt gtaaacagtg aaaaataaag 27taacct acatacttta tatacacagc acaatcgggagtcttggtct ggttttgggg 276ttgtc gattgctgta tctgaagaag aggcaaaagc tgtggaagga ttgaatgatt 282tctgt tgaagaagtg gagacgatct atattccgct tgttcgcttg cttcatttac 288aagtc tgcggctgaa cgcaataagc atgtcaatgt ttttttgaag cacccacatt 294aaaattccgtttatt atcggcattg ccggcagtgt cgcagtcgga aaaagcacga 3cgcggat cttgcagaag ctgctttcgc gtttgcctga ccgtccaaaa gtgagcctta 3cgacaga tggtttttta tttcctactg ccgagctgaa aaagaaaaat atgatgtcaa 3aaggatt tcctgaaagc tatgatgtaa aggcgctgctcgaatttttg aatgacttaa 3caggaaa ggacagcgta aaggccccgg tgtattccca tctaacctat gaccgcgagg 324gtgtt cgaggttgta gaacaggcgg atattgtgat tattgaaggc attaatgttc 33gtcgcc caccttggag gatgaccggg aaaacccgcg tatttttgtt tccgatttct 336ttttcgatttatgtg gatgcggagg aaagccggat tttcacttgg tatttagagc 342cgcct gcttcgggaa acagcttttc aaaatcctga ttcatatttt cataaattta 348ttgtc cgatcaggag gctgacgaga tggcagcctc gatttgggag agtgtcaacc 354aattt atatgaaaat attttgccaa ctaaattcaggtcagatctc attttgcgta 36agacgg gcataaggtc gaggaagtgt tggtaaggag ggtatgaaat gtgctgcagc 366caata gttaccctta ttatcaagat aagaaagaaa aggatttttc gctacgctca 372tttaa aaaaacacaa aagaccacat tttttaatgt ggtctttatt cttcaactaa 378ccattagttcaacaa acgaaaattg gataaagtgg gatattttta aaatatatat 384ttaca gtaatattga cttttaaaaa aggattgatt ctaatgaaga aagcagacaa 39gcctcc taaattcact ttagataaaa atttaggagg catatcaaat gaactttaat 396tgatt tagacaattg gaagagaaaa gagatatttaatcattattt gaaccaacaa 4actttta gtataaccac agaaattgat attagtgttt tataccgaaa cataaaacaa 4ggatata aattttaccc tgcatttatt ttcttagtga caagggtgat aaactcaaat 4gctttta gaactggtta caatagcgac ggagagttag gttattggga taagttagag 42tttatacaatttttga tggtgtatct aaaacattct ctggtatttg gactcctgta 426tgact tcaaagagtt ttatgattta tacctttctg atgtagagaa atataatggt 432gaaat tgtttcccaa aacacctata cctgaaaatg ctttttctct ttctattatt 438gactt catttactgg gtttaactta aatatcaataataatagtaa ttaccttcta 444tatta cagcaggaaa attcattaat aaaggtaatt caatatattt accgctatct 45aggtac atcattctgt ttgtgatggt tatcatgcag gattgtttat gaactctatt 456attgt cagataggcc taatgactgg cttttataat atgagataat gccgactgta 462tacagtcggttttct aatgtcacta acctgccccg ttagttgaag aaggttttta 468cagct gtcgactcgt gatcttcgga caggctgttc agctttttct caatgcgatc 474gcgct tttcggtttt tcgcatactt gaagcctgta acagccgcaa agacgacagc 48aatata ataaatacaa acagctgaaa catcacatcacctatattca tgttcttcac 486gtttg cgggagagat tcattctctt ccgtttttta tttaaagcgg cttttccaga 492acggt gttttgtggt ctccattttc atttgccgat aggcgaacgc taaaaatggc 498gagca gggtaatgcc gctcaggaca gaaaaaatat aaatcggccg gccagcgcca 5aggtctatacatatccc cccgacccaa gggccgatga cgtttccgag ctgtggaaaa 5attgccc cgaaataagt gccttttaat cctggttttg caatctggtc tacatacaaa 5atcatag agaataaaag cacttcgccg attgtaaatg tgatgacaat catcacaatt 522aacac cgtgtgatac ggtgaaaatg gccatgctgatgctaaccat cacattaccg 528cagag aacaaagcgg cgaaaaccgt tttgcaaaat ggacaatggg aaattgcgtc 534cacaa cgattgcgtt taatgtcagc atcagcccat acagcttcgt tccattgccg 54aggggt tctgcgccat atactgaggg aatgtggaac tgaattgtga gtagccgaag 546tagcgtaatgccgac caaagcaatg gtaaaaagat aatccttttg cgtgaccata 552ttccc gcacgctcat atttcgggac tgggctggtg ctgataagga tggatgtttt 558ttgga gggcaagcac aattccgtat agtccgtaaa tgactgcagg caccaaaaag 564agtcg attgcgatga gccgaaatat aggccaagcacaggtccgaa gacaacgccg 57taatag ccgcatagcg taaattaaaa actagcagtc tcgttttttc ttctgtcata 576caaca aggcctttga agcgggctca aacagtgatt tgcaaagacc gtttaatgcg 582tacaa aaaacaccca gagattagat gctgccgcaa agcctgcaaa taccagcatc 588gaaaatcgatacaag catcatgttt tttctgccga atttatctga gatatatccg 594aaagc ttgcgaggat gccgactgat gagctcgcgg cgatgaccag ccctgcatag 6gctgatg cgccttggac ggctgtcaaa taaatcgcta aaaaaggaat gctcatcgat 6gccattc tgccgaaaat ggttccgatt ataattgtacgcgttggatg catagcttga 6ttctata gtgtcaccta aatagcttgg cgtaatcatg gtcatagctg tttcctgtgt 6attgtta tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag 624ggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt 63gtcgggaaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 636ttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg 642ctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat 648gataa cgcaggaaag aacatgtgag caaaaggccagcaaaaggcc aggaaccgta 654gccgc gttgctggcg tttttcgata ggctccgccc ccctgacgag catcacaaaa 66acgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc 666ggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt 672tttctcccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca 678gtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg 684tgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat 69actggc agcagccact ggtaacagga ttagcagagcgaggtatgta ggcggtgcta 696ttctt gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct 7ctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac 7ccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 7gatctcaagaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa 72acgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt 726taaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca 732caatg cttaatcagt gaggcaccta tctcagcgatctgtctattt cgttcatcca 738gcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc 744gctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa 75gccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc 756attaattgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca 762gttgg cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat 768tccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag 774agctc cttcggtcct ccgatcgttg tcagaagtaagttggccgca gtgttatcac 78ggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt 786actgg tgagtactca accaagtcat tctgagaata ccgcgcccgg cgaccgagtt 792tgccc ggcgtcaata cgggataata gtgtatgaca tagcagaact ttaaaagtgc 798attggaaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat 8gttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca 8tttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga 8ggaaatg ttgaatactc atactcttcc tttttcaatattattgaagc atttatcagg 822tgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 828cgcac atttccccga aaagtgccac ctgtatgcgg tgtgaaatac cgcacagatg 834ggaga aaataccgca tcaggcgaaa ttgtaaacgt taatattttg ttaaaattcg 84aaatatttgttaaatc agctcatttt ttaaccaata ggccgaaatc ggcaaaatcc 846aaatc aaaagaatag accgagatag ggttgagtgt tgttccagtt tggaacaaga 852ctatt aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg 858ccact acgtgaacca tcacccaaat caagttttttgcggtcgagg tgccgtaaag 864aatcg gaaccctaaa gggagccccc gatttagagc ttgacgggga aagccggcga 87ggcgag aaaggaaggg aagaaagcga aaggagcggg cgctagggcg ctggcaagtg 876gtcac gctgcgcgta accaccacac ccgccgcgct taa 88

* * * * *