REFERENCE TO SEQUENCE LISTING
The present application contains information in the form of a sequence listing, which is appended to the application and also submitted on a data carrier accompanying this application. The content of the data carrier is fully incorporated hereinby reference.
FIELD OF THE INVENTION
The present invention relates to methods for producing a polypeptide comprising using a signal peptide foreign to the polypeptide, nucleic acid constructs comprising a first and a second nucleotide sequence encoding the signal peptide and thepolypeptide and expression vectors and host cells comprising said nucleic acid construct.
BACKGROUND OF THE INVENTION
The recombinant production of a heterologous protein in a fungal host cell, particularly a filamentous fungal cell such as Aspergillus or a yeast cell such Saccharomyces, may provide for a more desirable vehicle for producing the protein incommercially relevant quantities.
Recombinant production of a heterologous protein is generally accomplished by constructing an expression cassette in which the DNA coding for the protein is placed under the expression control of a promoter, excised from a regulated gene,suitable for the host cell. The expression cassette is introduced into the host cell. Production of the heterologous protein is then achieved by culturing the transformed host cell under inducing conditions necessary for the proper functioning of thepromoter contained on the expression cassette.
Improvement of the recombinant production of proteins generally requires the availability of new regulatory sequences which are suitable for controlling the expression of the proteins in a host cell.
It is an object of the present invention to provide improved methods for producing a polypeptide in a fungal host cell using signal peptide sequences.
SUMMARY OF THE INVENTION
The invention provides a method for producing a secreted polypeptide, comprising:
(a) cultivating an fungal host cell in a medium conducive for the production of the polypeptide, wherein the host cell comprises a nucleic acid construct comprising a first nucleotide sequence encoding a signal peptide operably linked to a secondnucleotide sequence encoding the polypeptide, wherein the first nucleotide sequence is foreign to the second nucleotide sequence, the 3' end of the first nucleotide sequence is immediately upstream of the second nucleotide sequence, and the firstnucleotide sequence is selected from the group consisting of: (i) a nucleotide sequence encoding a signal peptide having an amino acid sequence which has at least 70% identity with SEQ ID NO:1; (ii) a nucleotide sequence having at least 70% homology withSEQ ID NO: 2; and (iii) a nucleotide sequence which hybridizes under stringency conditions with the nucleotides of SEQ ID NO: 2, or its complementary strand, wherein the stringency conditions are defined as prehybridization, hybridization, and washingpost-hybridization at 5.degree. C. to 10.degree. C. below the calculated Tm in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40, 1.times. Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mgof yeast RNA per ml, and washing once in 6.times.SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6.times.SSC at 5.degree. C. to 10.degree. C. below the calculated Tm; and
(b) isolating the secreted polypeptide from the cultivation medium.
Furthermore, the present invention provides for A nucleic acid construct comprising a first nucleotide sequence encoding a signal peptide operably linked to a second nucleotide sequence encoding a polypeptide, wherein the first nucleotidesequence is foreign to the second nucleotide sequence, and the 3' end of the first nucleotide sequence is immediately upstream of the second nucleotide sequence, and the first nucleotide sequence is selected from the group consisting of:
(a) a nucleotide sequence encoding a signal peptide having an amino acid sequence which has at least 70% identity with SEQ ID NO:1;
(b) a nucleotide sequence having at least 70% homology with SEQ ID NO: 2; and
(c) a nucleotide sequence which hybridizes under stringency conditions with the nucleotides of SEQ ID NO: 2, or its complementary strand, wherein the stringency conditions are defined as prehybridization, hybridization, and washingpost-hybridization at 5.degree. C. to 10.degree. C. below the calculated Tm in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP40, 1.times. Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mgof yeast RNA per ml, and washing once in 6.times.SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6.times.SSC at 5.degree. C. to 10.degree. C. below the calculated Tm.
The present invention also provides expression vectors and host cells comprising said nucleic acid construct.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
The term "variant" when used in reference to another polypeptide or nucleotide sequence is in the context of the present invention to be understood as a polypeptide or nucleotide sequence which comprises a substitution, deletion, and/or insertionof one or more amino acids or nucleotides as compared to another polypeptide (i.e. it is a variant of polypeptide/nucleotide sequence it is compared with). In particular the changes may be of minor nature, such as conservative amino acid substitutionsor for nucleotide sequence resulting in conservative amino acid substitutions, that do not significantly affect the activity of the polypeptide; or small deletions, typically of one to about 20 amino acids depending on the size of the polypeptide inwhich the changes are made.
Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids(leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter the specific activity areknown in the art and are described, for example, by H. Neurath and R. L. Hill, 1979, In, The Proteins, Academic Press, New York. The most commonly occurring exchanges are Ala/Ser, Val/lle, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly,Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lle, Leu/Val, Ala/Glu, and Asp/Gly as well as these in reverse.
Method of the Present Invention
The present invention relates to methods for producing a secreted polypeptide, comprising: (a) cultivating a fungal host cell in a medium conducive for the production of the polypeptide, wherein the host cell comprises a nucleic acid constructcomprising a first nucleotide sequence encoding a signal peptide operably linked to a second nucleotide sequence encoding the polypeptide, wherein the first nucleotide sequence is foreign to the second nucleotide sequence, the 3' end of the firstnucleotide sequence is immediately upstream of the second nucleotide sequence, and the first nucleotide sequence is selected from the group consisting of: (i) a nucleotide sequence encoding a signal peptide having an amino acid sequence which has atleast 70% identity with SEQ ID NO:1; (ii) a nucleotide sequence having at least 70% homology with SEQ ID NO: 2; and (iii) a nucleotide sequence which hybridizes under stringency conditions with the nucleotides of SEQ ID NO: 2, or its complementarystrand, wherein the stringency conditions are defined as prehybridization, hybridization, and washing post-hybridization at 5.degree. C. to 10.degree. C. below the calculated Tm in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40, 1.times. Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml, and washing once in 6.times.SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6.times.SSC at 5.degree. C. to10.degree. C. below the calculated Tm; and (b) isolating the secreted polypeptide from the cultivation medium.
In the methods of the present invention, the fungal host cells are cultivated in a medium conducive for the production of the polypeptide, i.e. in a nutrient medium suitable for production of the polypeptide using methods known in the art. Forexample, the cell may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium andunder conditions allowing the polypeptide to be expressed and/or isolated. The cultivation may take place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media areavailable from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection).
The polypeptide may be detected using methods known in the art that are specific for the polypeptide. Such detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate.
In the methods of the present invention, the fungal host cell may in particular produce at least about 25% more, more particularly at least about 50% more, more particularly at least about 75% more, more particulary at least about 100% more, evenmore particularly at least about 200% more, most particularly at least about 300% more, and even most particularly at least about 400% more polypeptide relative to a fungal cell containing a native signal peptide sequence operably linked to a nucleotidesequence encoding the polypeptide when cultured under identical production conditions.
The resulting secreted polypeptide can be recovered directly from the medium by methods known in the art. For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to,centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
The polypeptide may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g.,preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
Signal Peptide
The first nucleotide sequence of the present encodes a signal peptide of the present invention. The term "signal peptide" or "signal peptide sequence" is defined herein as a peptide sequence usually present at the N-terminal end of newlysynthesized secretory or membrane polypeptides which directs the polypeptide across or into a cell membrane of the cell (the plasma membrane in prokaryotes and the endoplasmic reticulum membrane in eukaryotes). It is usually subsequently removed. Inparticular said signal peptide may be capable of directing the polypeptide into a cell's secretory pathway.
The term "operably linked" is defined herein as a configuration in which a control sequence, e.g., a signal peptide sequence, is appropriately placed at a position relative to a coding sequence such that the control sequence directs theproduction of a polypeptide encoded by the coding sequence.
The term "coding sequence" is defined herein as a nucleotide sequence which is translated into a polypeptide when placed under the control of the appropriate control sequences. The boundaries of the coding sequence are generally determined bythe start codon located at the beginning (5' end) of the open reading frame and a stop codon located at the 3' end of the open reading frame. A coding sequence can include, but is not limited to, genomic DNA, cDNA, RNA, semisynthetic, synthetic, andrecombinant nucleotide sequences.
The 5' end of the coding sequence of the polypeptide of the present invention may contain a native nucleotide sequence encoding a signal peptide which is naturally linked with nucleotide sequence segment which encodes the mature (or pro-form) ofthe polypeptide. In this case the signal peptide of the present invention may replace the native signal peptide. Alternatively, the polypeptide of the present invention may lack a native signal peptide. In this context the term "native" is intended tobe understood as being present naturally.
In the methods of the present invention, the signal peptide sequence is foreign to the nucleotide sequence encoding a polypeptide of interest, but the signal peptide sequence or nucleotide sequence may be native to the fungal host cell. In thiscontext the term "foreign" is intended to be understood as the signal peptide is not native to the polypeptide, i.e. it originates from another gene than the polypeptide.
In one embodiment the first nucleotide sequence may encode a signal peptide having an amino acid sequence which has at least 70%, particularly at least about 75%, more particularly at least about 80%, more particularly at least about 85%, evenmore particularly at least about 90%, most particularly at least about 95%, and even most particularly at least about 97% identity to SEQ ID NO: 1, which have the ability to direct a polypeptide into or across a cell membrane (hereinafter "homologoussignal peptide"), e.g. into a cell's secretory pathway. In a particular aspect, the homologous signal peptide may have an amino acid sequence which differs by five amino acids, particularly by four amino acids, more particularly by three amino acids,even more particularly by two amino acids, and most particularly by one amino acid from SEQ ID NO: 1. For purposes of the present invention, the identity or degree of identity between two amino acid sequences is determined by the Clustal method(Higgins, 1989, CABIOS 5: 151-153) using the LASERGENE.TM. MEGALIGN.TM. software (DNASTAR, Inc., Madison, Wis.) with an identity table and the following multiple alignment parameters: Gap penalty of 10 and gap length penalty of 10. Pair wise alignmentparameters are Ktuple=1, gap penalty=3, windows=5, and diagonals=5.
In particular, the first nucleotide sequence may encode a signal peptide which comprises the amino acid sequence of SEQ ID NO: 1, or an allelic variant thereof; or a fragment thereof that has the ability to direct the polypeptide into or across acell membrane, e.g. into a cell's secretory pathway. In a more particular aspect, the first nucleotide sequence of the present invention encodes a signal peptide that comprises the amino acid sequence of SEQ ID NO: 1. In another particular aspect, thefirst nucleotide sequence encodes a signal peptide that consists of the amino acid sequence of SEQ ID NO: 1, or a fragment thereof, wherein the signal peptide fragment has the ability to direct a polypeptide into or across a cell membrane, e.g. into acell's secretory pathway. In another more particular aspect, the nucleotide sequence of the present invention encodes a signal peptide that consists of the amino acid sequence of SEQ ID NO: 1.
The present invention also encompasses first nucleotide sequences which encode a signal peptide having the amino acid sequence of SEQ ID NO: 1, which differs from SEQ ID NO: 2 by virtue of the degeneracy of the genetic code. The presentinvention also relates to subsequences or fragments of SEQ ID NO: 2 which encode fragments of SEQ ID NO: 1 which has the ability to direct a polypeptide into or across a cell membrane, e.g. into a cell's secretory pathway.
A subsequence of SEQ ID NO: 2 is a nucleic acid sequence encompassed by SEQ ID NO: 2 except that one or more nucleotides from the 5' and/or 3' end have been deleted. Particularly, a subsequence contains at least 30 nucleotides, such as at least35 nucleotides or at least 40 nucleotides or at least 45 nucleotides or at least 50 nucleotides or at least 52 nucleotides or at least 53 nucleotides. A fragment of SEQ ID NO: 1 is a polypeptide having one or more amino acids deleted from the aminoand/or carboxy terminus of this amino acid sequence. In particular a fragment contains at least 10 amino acid residues. such as at least 12 amino acid residues or at least 13 amino acid residues or at least 14 amino acid residues or at least 15 aminoacid residues or at least 16 amino residues or at least 17 amino acid residues. In particular if the first and second nucleotide sequences are expressed in a yeast host cell the signal peptide may comprise amino acid residues 1-16 of SEQ ID NO: 1, asthe inventors of the present invention have observed that in yeast the signal peptide is cleaved between amino acid residues 16 and 17 (at the AA.dwnarw.LP), while if the host cell is a filamentous fungus the signal peptide may in particular comprise the18 amino acid residues of SEQ ID NO: 1, as the inventors of the present invention have seen that in Aspergillus oryzae the cleavage of the signal peptide occurs after amino acid residue 18 of SEQ ID NO:1. This indicates that there may be a differencebetween yeast and filamentous fungi in the sequence recognized as a cleavage site for cleavage of the signal sequence.
An allelic variant denotes any of two or more alternative forms of a gene occupying the same chomosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations may be silent(no change in the encoded signal peptide) or may encode signal peptides having altered amino acid sequences. The allelic variant of a signal peptide is a peptide encoded by an allelic variant of a gene.
In a particular aspect, the first nucleotide sequence is the signal peptide coding sequence of the cutinase gene contained in Humicola insolens DSM 1800 (SEQ ID NO: 1).
In a second aspect, the first nucleotide sequence of the present invention which encodes a signal peptide may have a degree of homology to SEQ ID NO: 2 of at least about 70%, particularly at least about 75%, more particularly at least about 80%,more particularly at least about 85%, even more particularly at least about 90% homology, most particularly at least about 95% homology, and even most particularly at least about 97% homology, which encode a signal peptide; or allelic variants andsubsequences of SEQ ID NO: 2 which encode signal peptide fragments which have the ability to direct a polypeptide into or across a cell membrane, e.g. into a cell's secretory pathway. For purposes of the present invention, the degree of homology betweentwo nucleic acid sequences is determined by the Wilbur-Lipman method (Wilbur and Lipman, 1983, Proceedings of the National Academy of Science USA 80: 726-730) using the LASERGENE.TM. MEGALIGN.TM. software (DNASTAR, Inc., Madison, Wis.) with an identitytable and the following multiple alignment parameters: Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters are Ktuple=3, gap penalty=3, and windows=20.
In a third aspect, the first nucleotide sequence of the present invention encodes a signal peptide, wherein said first nucleotide sequence hybridize under stringency conditions with the nucleotides of SEQ ID NO: 2, or its complementary strand (J.Sambrook, E. F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N.Y.).
The nucleotide sequence of SEQ ID NO: 2 or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO: 1 or a fragment thereof may be used to design a nucleic acid probe to identify and clone DNA encoding signal peptides from strainsof different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in orderto identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but may in particular be at least 15, such as at least 25, or more particularly at least 35 nucleotides in length. Both DNA andRNA probes can be used. The probes may typically be labelled for detecting the corresponding gene (for example, with 32P, 3H, 35S, biotin, or avidin). Such probes are encompassed by the present invention.
Thus, a genomic DNA or cDNA library prepared from such other organisms may be screened for DNA which hybridizes with the probes described above and which encodes a signal peptide. Genomic or other DNA from such other organisms may be separatedby agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone orDNA which is homologous with SEQ ID NO: 2 or a subsequence thereof, the carrier material is used in a Southern blot. For purposes of the present invention, hybridization indicates that the nucleic acid sequence hybridizes to a labelled nucleic acidprobe corresponding to the nucleic acid sequence shown in SEQ ID NO: 2, its complementary strand, or a subsequence thereof, under stringency conditions defined herein. Molecules to which the nucleic acid probe hybridizes under these conditions can bedetected using X-ray film.
In a particular aspect, the nucleic acid probe is a nucleotide sequence which encodes the signal peptide of SEQ ID NO: 1, or a subsequence thereof. In another particular aspect, the nucleic acid probe is SEQ ID NO: 2. In another particularaspect, the nucleic acid probe is the signal peptide sequence of the cutinase gene contained in Humicola insolens DSM 1800 (SEQ ID NO: 2 of WO 96/13580).
For short probes which are about 15 nucleotides to about 60 nucleotides in length, stringency conditions are defined as prehybridization, hybridization, and washing post-hybridization at 5.degree. C. to 10.degree. C. below the calculated Tmusing the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48: 1390) in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40, 1.times. Denhardt's solution, 1 mM sodium pyrophosphate, 1 mMsodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures.
For short probes which are about 15 nucleotides to about 60 nucleotides in length, the carrier material is washed once in 6.times.SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6.times.SSC at 5.degree. C. to 10.degree. C.below the calculated Tm.
In a fourth aspect, the first nucleotide sequence may encode variants of the signal peptide having an amino acid sequence of SEQ ID NO: 1 comprising a substitution, deletion, and/or insertion of one or more amino acids.
The amino acid sequences of the variant signal peptides may differ from the amino acid sequence of SEQ ID NO: 1 by an insertion or deletion of one or more amino acid residues and/or the substitution of one or more amino acid residues by differentamino acid residues. Particularly, amino acid changes may be of a minor nature, such as conservative amino acid substitutions that do not significantly affect the activity of the signal peptide; or small deletions, typically of one to about 5 aminoacids.
Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids(leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter the specific activity areknown in the art and are described, for example, by H. Neurath and R. L. Hill, 1979, In, The Proteins, Academic Press, New York. The most commonly occurring exchanges are Ala/Ser, Val/lle, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly,Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lle, Leu/Val, Ala/Glu, and Asp/Gly as well as these in reverse.
Polypeptide
The second nucleotide sequence of the preset invention encodes a polypeptide encoded of the present invention. Said polypeptide may be native or heterologous to the fungal host cell in which it is produced.
The term "polypeptide" is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins. The term "heterologous polypeptide" is defined herein as a polypeptide which isnot native to the fungal cell, a native polypeptide in which modifications have been made to alter the native sequence, or a native polypeptide whose expression is quantitatively altered as a result of a manipulation of the gene encoding the polypeptideby recombinant DNA techniques. The fungal cell may contain one or more copies of the nucleotide sequence encoding the polypeptide.
In particular, the polypeptide may be a hormone or hormone variant, an enzyme, a receptor or portion thereof, an antibody or portion thereof, an allergen or a reporter. In a particular aspect, the polypeptide may be an allergen originating fromDermatophagoides pteronyssinus, Dermatophagoides farinae, Dermatophagoides siboney, Dermatophagoides microceaus, Blomia tropicalis and Euroglyphus maynei, or an allergen from one of said organisms which subsequently have been modified. Moreparticularly, said allergen may be Der p 1, e.g. Der p 1 from Dermantophagoides pteronyssinus (SEQ ID NO: 3). In particular the polypeptide may be the sequence of amino acids 19-320 of SEQ ID NO: 3. In a more particular embodiment the polypeptide maybe a variant of the polypeptide sequence of amino acids 19-320 of SEQ ID NO: 3. More particularly said variant may be a S54X or N52X, wherein "X" denotes any amino acid, as said disrupt the N-glycosylation site of Der p 1, in particular said variantsmay be S54N or N52Q. However, other variants of Der p 1 are envisioned.
In another particular embodiment the polypeptide may be an enzyme, such as an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase. In a more particular aspect, the polypeptide may be an aminopeptidase, amylase, carbohydrase,carboxypeptidase, catalase, cellulase, cellobiohydrolase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase,invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, or beta-xylosidase. An example of a relevant cellulaseincludes but is not limited to a cellulase from Mucor cicinellides, e.g. M. cicinellides IFO4554 (SEQ ID NO: 4). Examples of relevant proteolytic enzymes include but are not limited to cystein proteases, e.g. cystein protease 5 from Trifolium repens L(SEQ ID NO: 5), especially amino acids 109-327 of SEQ ID NO: 5 which encode the mature peptide, or trypsin, e.g. trypsin from Fusarium oxysporium (SEQ ID NO: 7). An example of a relevant phytase includes but is not limited to a phytase from Peniophoralycii, e.g. P. lycii CBS 686.96 (SEQ ID NO: 9).
The second nucleotide sequence encoding a polypeptide of the present invention may be obtained from any prokaryotic, eukaryotic, or other source. For purposes of the present invention, the term "obtained from" as used herein in connection with agiven source shall mean that the polypeptide is produced by the source or by a cell in which a gene from the source has been inserted.
The techniques used to isolate or clone a nucleotide sequence encoding a polypeptide of interest are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the second nucleotidesequence from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR). See, for example, Innis et al., 1990, PCR Protocols: A Guide to Methods and Application, Academic Press, New York. The cloning procedures mayinvolve excision and isolation of a desired nucleotide fragment comprising the nucleotide sequence encoding the polypeptide, insertion of the fragment into a vector molecule, and incorporation of the recombinant vector into the mutant fungal cell wheremultiple copies or clones of the nucleotide sequence will be replicated. The second nucleotide sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.
In the methods of the present invention, the polypeptide may also be a fused or hybrid polypeptide in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof. A fused polypeptide is producedby fusing a nucleotide sequence (or a portion thereof) encoding one polypeptide to the second nucleotide sequence (or a portion thereof) encoding the polypeptide of the present invention. Techniques for producing fusion polypeptides are known in theart, and include, ligating the coding sequences encoding the polypeptides so that they are in frame and expression of the fused polypeptide is under control of the same promoter(s) and terminator. The hybrid polypeptide may comprise a combination ofpartial or complete polypeptide sequences obtained from at least two different polypeptides wherein one or more may be heterologous to the mutant fungal cell.
Nucleic Acid Construct
The present invention also relates to a nucleic acid construct comprising a first nucleotide sequence signal peptide of the present invention operably linked to a second nucleotide sequence encoding a polypeptide of the present invention.
"Nucleic acid construct" is defined herein as a nucleotide molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acids combined and juxtaposed in amanner that would not otherwise exist in nature. The term nucleic acid construct is synonymous with the term expression cassette when the nucleic acid construct contains a coding sequence and all the control sequences required for expression of thecoding sequence.
A second nucleotide sequence encoding a polypeptide may be further manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the nucleotide sequence prior to its insertion into a vector may be desirable ornecessary depending on the expression vector. The techniques for modifying nucleotide sequences utilizing recombinant DNA methods are well known in the art.
In the methods of the present invention, the nucleic acid construct may comprise one or more native control sequences or one or more of the native control sequences may be replaced with one or more control sequences foreign to the first and/orsecond nucleotide sequence of the nucleic acid construct for improving expression of the second nucleotide sequence encoding a polypeptide in a host cell.
The term "control sequences" is defined herein to include all components which are necessary or advantageous for the expression of the polypeptide encoded by the second nucleotide sequence. Each control sequence may be native or foreign to thesecond nucleotide sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, signal peptide sequence of the present invention, and transcription terminator. At aminimum, the control sequences include a signal peptide sequence of the present invention, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sitesfacilitating ligation of the control sequences with the second nucleotide sequence encoding the polypeptide.
The control sequence may be an appropriate promoter sequence, which is recognized by a host cell for expression of the nucleotide sequence. The promoter sequence contains transcriptional control sequences which mediate the expression of thepolypeptide. The promoter may be any sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides eitherhomologous or heterologous to the host cell.
Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor mieheiaspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzaetriose phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium venenatum amyloglucosidase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reeseiendoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reeseibeta-xylosidase, as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase); and mutant, truncated, and hybrid promoters thereof.
In a yeast host, useful promoters include but are not limited to those obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GALl), Saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1,ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionine (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other usefulpromoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.
The control sequence may be a suitable transcription terminator sequence, which is recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding thepolypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.
Examples of suitable terminators for filamentous fungal host cells include but are not limited to those obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase,Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease.
Examples of suitable terminators for yeast host cells include but are not limited to those obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiaeglyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence may generally be operably linked to the 5' end of the nucleotide sequenceencoding a polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.
Examples of suitable leaders for filamentous fungal host cells include but are not limited to those obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
Suitable leaders for yeast host cells include but are not limited to those obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, andSaccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
The control sequence may also be a polyadenylation sequence, which is operably linked to the 3' end of the nucleotide sequence encoding a polypeptide and which, when transcribed, is recognized by the host cell as a signal to add polyadenosineresidues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
Examples of suitable polyadenylation sequences for filamentous fungal host cells include but are not limited to those obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilatesynthase, Fusarium oxysporum trypsin-like protease, and Aspergillus niger alpha-glucosidase.
Useful polyadenylation sequences for yeast host cells include but are not limited to those described by Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.
The control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in somecases). A propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. Examples of propeptide coding region include but are not limited tothose obtained from the genes for Dermantophagoides pteronyssinus Der p 1, or other genes obtained from Dermantophagoides, Fusarium oxysporum trypsin, Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthorathermophila laccase (WO 95/33836).
Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the aminoterminus of the propeptide region. If a propeptide is present a cleavable site may in one embodiment be present between the propeptide and the mature polypeptide. The term "cleavable site" is to be understood as an amino acid sequence which isrecognized by a proteolytic enzyme capable of cleaving the polypeptide at this site. Examples of such site include a kex-site, in particular a kex-II site.
It may also be desirable to add regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those which cause the expression of the gene to beturned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the TAKA alpha-amylase promoter, Aspergillus nigerglucoamylase promoter, and Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences. Other examples of regulatory sequences are those which allow for gene amplification. In eukaryotic systems, these include the dihydrofolatereductase gene which is amplified in the presence of methotrexate, and the metallothionein genes which are amplified with heavy metals. In these cases, the nucleotide sequence encoding the polypeptide would be operably linked with the regulatorysequence.
Expression Vector
The present invention also relates to a recombinant expression vector comprising a nucleic acid construct of the present invention. Besides comprising a first and a second nucleotide sequence encoding a signal peptide and a polypeptide,respectively of the present invention said expression vector may in particular comprise a transcriptional and translational stop signal. The various nucleotide and control sequences described above may be joined together to produce a recombinantexpression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the promoter and/or nucleotide sequence encoding the polypeptide at such sites. Alternatively, the nucleic acid construct may beinserted into an appropriate vector for expression for expression of the polypeptide encoded by the second nucleotide sequence. In creating the expression vector, the second nucleotide sequence encoding the polypeptide of the present invention islocated in the vector so that said sequence is operably linked with a signal peptide sequence of the present invention and one or more appropriate control sequences for expression.
The recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleotide sequence. The choice of the vector willtypically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids.
The vectors of the present invention may in particular contain one or more selectable markers which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide or viral resistance,resistance to heavy metals, prototrophy to auxotrophs, and the like. Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in a filamentous fungal host cellinclude, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfateadenyltransferase), trpC (anthranilate synthase), as well as equivalents thereof. In particular for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus.
The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome,or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s)into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
The vectors of the present invention may in particular contain an element(s) that permits stable integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
For integration into the host cell genome, the vector may rely on the second nucleotide sequence encoding the polypeptide or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologousrecombination. Alternatively, the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell. The additional nucleotide sequences may enable the vector to be integrated intothe host cell genome at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should in particular contain a sufficient number of nucleotides, such as 100 to 1,500 basepairs, preferably 400 to 1,500 base pairs, and most preferably 800 to 1,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be anysequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may be integrated into the genome of thehost cell by non-homologous recombination.
For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomousreplication which functions in a cell. The term "origin of replication" or "plasmid replicator" is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo.
Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6. The origin of replication may be one having a mutationwhich makes its ability to function temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75: 1433).
Examples of origins of replication useful in a filamentous fungal host cell are AMA1 and ANS1 (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic Acids Research 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and constructionof plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
More than one copy of a nucleotide sequence encoding a polypeptide may be inserted into the host cell to increase production of the gene product. An increase in the copy number of the nucleotide sequence can be obtained by integrating at leastone additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the nucleotide sequence where cells containing amplified copies of the selectable marker gene, and thereby additional copies of thenucleotide sequence, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).
Host Cells
The present invention relates to methods in which polypeptides are produced in a fungal host cell and to a recombinant host cells comprising a nucleic acid construct of the present invention.
A vector comprising a first nucleotide sequence encoding a signal peptide of the present invention operably linked to a second nucleotide sequence encoding a polypeptide is introduced into a fungal host cell so that the vector is maintained as achromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. Thechoice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
The host cell may be any fungal cell useful in the methods of the present invention. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby'sDictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al., 1995, supra).
In a particular aspect, the fungal host cell is a yeast cell. "Yeast" as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classificationof yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F. A., Passmore, S. M., and Davenport, R. R., eds, Soc. App. Bacteriol. Symposium Series No. 9,1980).
In a more particular aspect, the yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell.
In a most particular aspect, the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, e.g., S. cerevisiae YNG318, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis,Saccharomyces oviformis, Kluyveromyces lactis or Yarrowia lipolytica cell.
In another particular aspect, the fungal host cell is a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungiare characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth byyeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
In a more particular aspect, the filamentous fungal host cell is a cell of a species of, but not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, or Trichoderma.
In an even more particular aspect, the filamentous fungal host cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae cell. In another even more particularaspect, the filamentous fungal host cell is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusariumreticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell. In another even more particular aspect, the filamentousfungal host cell is a Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum,Trichoderma reesei, or Trichoderma viride cell.
In a most particular aspect, the Fusarium venenatum cell is Fusarium venenatum A3/5, which was originally deposited as Fusarium graminearum ATCC 20334 and recently reclassified as Fusarium venenatum by Yoder and Christianson, 1998, FungalGenetics and Biology 23: 62-80 and O'Donnell et al., 1998, Fungal Genetics and Biology 23: 57-67; as well as taxonomic equivalents of Fusarium venenatum regardless of the species name by which they are currently known. In another particular aspect, theFusarium venenatum cell is a morphological mutant of Fusarium venenatum A3/5 or Fusarium venenatum ATCC 20334, as disclosed in WO 97/26330.
In another most particular aspect, the Trichoderma cell is Trichoderma reesei ATCC 56765, Trichoderma reesei ATCC 13631, Trichoderma reesei CBS 526.94, Trichoderma reesei CBS 529.94, Trichoderma longibrachiatum CBS 528.94, Trichodermalongibrachiatum ATCC 2106, Trichoderma longibrachiatum CBS 592.94, Trichoderma viride NRRL 3652, Trichoderma viride CBS 517.94, or Trichoderma viride NIBH FERM/BP 447.
Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells aredescribed in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Suitable procedures for transformation of Trichoderma reesei host cells are described in Penttila et al., 1987, Gene 61: 155-164, andGruber et al., 1990, Curr Genet. 18(1):71-6. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156 and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente,In Abelson, J. N. and Simon, M. I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology 194: 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedings ofthe National Academy of Sciences USA 75:1920.
MATERIALS AND METHODS
Strains and Plasmids
Strains
E. coli DH12S (available from Gibco BRL) is used for yeast plasmid rescue.
Saccharomyces cerevisiae YNG318: MATa Dpep4[cir+] ura3-52, leu2-D2, his 4-539 is described in J. Biol. Chem. 272 (15): 9720-9727, 1997).
Plasmids
All yeast expression vectors are S. cerevisiae and E. coli shuttle vectors under the control of TPI promoter, constructed from pJC039 described in WO 00/10038.
Genes
Der p 1 from Dermatophagoides pteronyssinus: NCBI accession number: P08176, the amino acid sequence is shown in SEQ ID NO: 3.
The Cystein protease gene from Trifolium repens L (white clover) is the sequence which is deposited as EMBL: AY192363.
The alpha-factor (pheromone required for yeast mating) gene is the sequence in the commercial available pPICZ.alpha. A vector from Invitrogen.
The trypsin gene from Fusarium oxysporum is the sequence which is deposited as EMBL: S63827 and for which the cDNA sequence is shown in SEQ ID NO: 6.
The phytase gene from Peniophora lycii strain CBS 686.96 is the sequence which is deposited as EMBL: PLY310696 and for which the cDNA sequence is shown in SEQ ID NO: 8.
TABLE-US-00001 Primers For expression of a cellulase from Mucor circinellides For cDNA cloning: MCE-BC1 F (44mer): 5'-CAACTGGTGATCACCACCATGAAGTTCACCG (SEQ ID NO: 10) TTGCTATTACTTC-3' MCE-Nru R (39mer): 5'-TCTCGAGCTCGCGATTACTTTCTTTCGCAAC (SEQ IDNO: 11) CTGAGCGAG-3' For yeast vector construction: M61 F (50mer): 5'-CCAGCTTCCGCAAACAAAGTCGCCAACATGA (SEQ ID NO: 12) AGTTCACCGTTGCTATTAC-3' M61Cutisig F (50mer): 5'-CGCCAGCCTTGTTGCTGCTCTCCCCGCCGCT (SEQ ID NO: 13) TCTTGCAGCTCTGTCTATG-3' C-term R61 R(49mer): 5'-TAATTACATGATGCGGCCCTCTAGATTACTT (SEQ ID NO: 14) TCTTTCGCAACCTGAGCG-3' For expression of cystein protease from Trifolium repens L alpha-signal-Munl (49mer): 5'-ATAAACGACGGGACCCGGGGATCCAATTGAT (SEQ ID NO: 15) GAGATTCCCATCAATTTT-3'alpha-signal-CysPro R (42mer): 5'-GCCCACGATGGAGAAATCGCGAGCTTCAGCT (SEQ ID NO: 16) TCTCTTTTCTC-3' alpha-signal-CysPro F (42mer): 5'-GAAAAAAGAGAAGCTGAAGCTCGCGATTTCT (SEQ ID NO: 17) CCATCGTGGGC-3' Spe-CysPro R (50mer): 5'-ACTAATTACATGATGCGGCCCACTAGTTCAT(SEQ ID NO: 18) TTCTTCTTAGTAGGATAAG-3' Cuti-Sig-CysPro (50mer): 5'-GCACCGCCAGCCTTGTTGCTGCTCTCCCCCG (SEQ ID NO: 19) CGATTTCTCCATCGTGGGC-3' CysPro C-term (50mer): 5'-TAATTACATGATGCGGCCCGCGGCCGCTCAT (SEQ ID NO: 20) TTCTTCTTAGTAGGATAAG-3' For expression oftrypsin from Fusarium yeast-F (43mer): 5'-ACGACGGTACCCGGGGATCAAGCTTATGGTC (SEQ ID NO: 21) AAGTTCGCTTCC-3' yeast-R (43mer): 5'-AACTAATTACATGATGCGGCCCTCTAGATTA (SEQ ID NO: 22) AGCATAGGTGTC-3' cuti-pre (45mer): 5'-CGTTCCTGAACTTGTTGCCCGGGTTGGTGGC (SEQ ID NO:23) ACTTCTGCCAGCGC-3' TP2-Kex F (32mer): 5'-GTTCCTGAACTTGTTCGGCGGGTTGGTGGCA (SEQ ID NO: 24) C-3' TP2-Kex R (32mer): 5'-GTGCCACCAACCCGCCGAACAAGTTCAGGAA (SEQ ID NO: 25) C-3' Cuti-pre F (29mer): 5'-GTTGCTGCTCTCCCCGTTGGTGGCACTT (SEQ ID NO: 26) C-3' Cuti-preR (29mer): 5'-GAAGTGCCACCAACGGGGAGAGCAGCAA (SEQ ID NO: 27) C-3' CUTIpre-TPpro F (42mer): 5'-TCCTCAGGAGATCCCCAACATTGTTGGTGGC (SEQ ID NO: 28) ACTTCTGCCAG-3' CUTIpre-TPpro R (40mer): 5'-GTTGGGGATCTCCTGAGGAGCGGGGAGAGCA (SEQ ID NO: 29) GCAACAAGG-3' Forexpression of a phytase from Peniophora PP 1F (50mer): 5'-AAACGACGGTACCCGGGGATCAAGCTTATGG (SEQ ID NO: 30) TTTCTTCGGCATTCGCACC-3' PP R (50mer): 5'-ACTAATTACATGATGCGGCCCTCTAGACTAT (SEQ ID NO: 31) TCCGACGGAACAAAGCCGC-3' PP 2F (50mer):5'-CCGCCAGCCTTGTTGCTGCTCTCCCCCAGCT (SEQ ID NO: 32) ACCTATCCCCGCACAAAAC-3'
Medium and Substrates
RS-25: 40 g/L soy bean powder, 40 g/L glucose, 10 g/L KH.sub.2PO.sub.4, 0.25 g/L MgSO.sub.4, 0.01 g/L FeSO.sub.4, 2.5 g/L NH.sub.4NO.sub.3; pH 6
YPD: 20 g/L Glucose, 20 g/L Pepton and 10 g/L Yeast extract
10.times. Basal solution: 66.8 g/l Yeast nitrogen base w/o amino acids (DIFCO), 100 g/l succinate and 60 g/l NaOH.
SC-glucose (or SC-medium): 100 ml/l 20% glucose (i.e., a final concentration of 2%=2 g/100 ml), 4 ml/l 5% threonine, 10 ml/l 1% tryptophan, 25 ml/l 20% casamino acids and 100 ml/l 10.times. basal solution. This solution was sterilized using afilter of a pore size of 0.20 micron. Agar and H.sub.2O (approx. 761 ml) is autoclaved together, and the separately sterilized SC-glucose solution is added to the agar solution.
PEG/LiAc solution: 50 ml 40% PEG4000 (sterilized by autoclaving) and 1 ml 5 M lithium acetate (sterilized by autoclaving).
Methods
Yeast Transformation
This method was used in examples 2-5.
To transform yeast the in vivo recombinant mechanism was utilized by which it is possible for yeast to recombine a vector sequence and PCR fragments in vivo to create an expression vector, if both the vector sequence and the PCR fragments havethe same flanking regions.
A DNA mixture was prepared by mixing 0.5 Microl of vector (EcoRI-NotI digested) and 1 Microl of PCR fragments. S. cerevisiae YNG318 competent cells were thawed on ice. One hundred Microl of the cells were mixed with the DNA mixture and 10Microl of carrier DNA (Clontech) in 12 ml polypropylene tubes (Falcon 2059). To this 0.6 ml PEG/LiAc solution was added and mixed gently and then incubated for 30 min at 30.degree. C., and 200 rpm. Thereafter it was incubated for 30 min at 42.degree. C. (heat shock) before transferring it to an eppendorf tube and centrifugation for 5 sec. The supernatant was removed and resolved in 3 ml of YPD. The cell suspension was then incubated for 45 min at 200 rpm at 30.degree. C. before it was poured on toSC-glucose plates.
PCR Reaction
Unless otherwise indicated the PCR reactions were carried out under the following conditions:
The PCR reaction contained 38.9 MicroL H2O, 5 MicroL 10.times. reaction buffer, 1 MicroL Klen Taq LA (Clontech), 4 MicroL 10 mM dNTPs, 0.3 MicroL.times.2 100 pmol/MicroL primer and 0.5 MicroL template DNA and was carried out under the followingconditions: 30 cycles of 10 sec at 98.degree. C. and 90 sec at 68.degree. C., and a final 10 min at 68.degree. C.
Sandwich ELISA
Immunoplates (Nunc Maxisorb; Nunc-Nalgene) were coated overnight at 4.degree. C. with at suitable dose of polyclonal rabbit anti Der p 1 antibody. The plates were then washed thoroughly with 0.15 M Phosphate Buffered Saline (PBS) containing0.05% Tween 20 (PBST), and remaining binding sites are blocked with PBS with 2% skim milk powder, 1 h at room temperature. Samples, it can be purified, semi-purified recombinant group 1 mite polypeptide variant allergen or crude culture broth containingprotein of interest, were added in a suitable dose or dose-range. The plates were then washed thoroughly with 0.15 M PBST before the allergens were detected by incubation with biotinylated monoclonal anti Der p 1 antibody (INDOOR) 1 h at roomtemperature. The plates were then washed again in 0.15 M PBST before conjugated with complexes of Streptavidin:Horse Radish Peroxidase (Kierkegaard & Perry) for 1 h at room temperature. The washing step was repeated and then the plates were developedby adding 3,3',5,5'-tetramethylbenzidine hydrogen peroxide (TMB Plus, Kem-En-Tec) before the reaction was stopped by addition of 0.2 M H2SO4. The optical density (OD) at 450 nm reflected allergen binding to the immunoglobin, and it was then possible todetect and also determine the amount of allergen bound by comparing with the data obtained for natural Der p 1 (available from Indoor biotechnologies, NA-DP1) which was included in the ELISA in a known concentration dose range.
Other Methods
E. coli transformation to rescue yeast plasmid was carried out by electroporation (BIO-RAD Gene Pulser).
DNA Plasmids were prepared with the Qiagen.RTM. Plasmid Kit. DNA fragments and recovered from agarose gel by the Qiagen gel extraction Kit.
PCR was carried out by the PTC-200 DNA Engine.
The ABI PRISMTM 310 Genetic Analyzer was used for determination of all DNA sequences. Yeast total DNA was extracted by the Robzyk and Kassir's method described in Nucleic Acids Research 20(14): 3790 (1992).
Enzyme Assays
Cystein Protease Assay
96 well microtiter plate assay:
The following was added to each well: 10 MicroL 0.5 M Sodium acetate buffer (pH 5), 10 MicroL 2 M NaCl (comprising 700 MicroL mercaptethano/100 ml), 45 MicroL D. W. (distilled water) and 10 MicroL enzyme sample. The plate was then incubated atroom temperature for 5-10 min (for maturation of the peptidase) before 25 MicroL 40 MicroM Z-Phe-Arg-MCA (0.1% DMSO) was added. Finally, the emission of MCA (4-methyl-coumaryl-7-amide) at 460 nm was measured in a fluorometer.
TryDsin Assay (PNA Assay for Fusarium Trypsin)
Substrate:
Fifty mg of N alpha-Benzoyl-DL-Arginine-p-Nitroanilide (BAPNA, Sigma B-4875) was dissolved in 1 ml DMSO and kept at -20.degree. C. This solution was diluted 100.times. in the assay buffer just before use.
Assay Buffer:
50 mM Borate-NaOH (pH 10.5)+2 mM CaCl.sub.2
Method:
20 Microl sample and 200 Microl assay buffer were mixed in a 96-well microtiter tray and Delta OD/min was measured at 405 nm for 5 min.
Phytase Assay
Ten MicroL diluted enzyme samples (diluted in 0.1 M sodium acetate, 0.01% Tween20, pH 5.5) were added into 250 MicroL of 5 mM sodium phytate (Sigma) in 0.1 M sodium acetate, 0.01% Tween20, pH 5.5 (pH adjusted after dissolving the sodium phytate;the substrate was preheated) and incubated for 30 minutes at 37.degree. C. The reaction was stopped by adding 250 MicroL 10% TCA and free phosphate was measured by adding 500 MicroL 7.3 g FeSO.sub.4 in 100 ml molybdate reagent (2.5 g(NH.sub.4).sub.6Mo70.sub.24.4H.sub.2O in 8 ml H.sub.2SO.sub.4 diluted to 250 ml . The absorbance at 750 nm was measured on 200 MicroL samples in 96 well microtiter plates. Substrate and enzyme blanks were included. A phosphate standard curve was alsoincluded (0-2 mM phosphate). 1 U equals the amount of enzyme that releases 1 Micromol phosphate/min at the given conditions.
EXAMPLES
Example 1
Expression of Der p 1 in S. cerevisiae
The Der p 1 cystein protease from Dermantophagoides pteronyssinus (the amino acid sequence of which is depicted in SEQ ID NO: 3) encoding gene was located in vector pSteD212, which is derived from yeast expression vector pYES 2.0 (Invitrogen,Kofod et al., 1994, J. Biol. Chem. 269: 29182-29189 and Christgau et al., 1994, Biochem. Mol. Biol. Int. 33: 917-925).
This plasmid replicated both in E. coli and in S. cerevisiae. In S. cerevisiae Der p 1 was expressed from this plasmid.
Recombinant Der p 1 was expressed with the Der p 1 propeptide and had the mutation S54N or N52Q which disrupts the only N-glycosylation motif within the mature sequence.
For secretion in yeast two different signal peptides were tested for their expression efficiency by introducing them upstream of the encoding pro-Der p 1 gene. Expression constructs with signal peptides were made by cloning of DNA fragments(Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor, 1989). One signal peptide was the natural occurring Dermantophagoides pteronyssinus Der p 1 signal peptide with the amino acid sequence MKIVLAIASLLALSAVYA (SEQ ID NO:3) and the other signal peptide was derived from a cutinase from Humicula insolens with the amino acid sequence MKFFTTILSTASLVAALP (SEQ ID NO: 1). The yeast strain and the construct with the dust mite Der p 1 signal peptide was named pre-pro-Der p 1 andthe yeast strain and construct with the cutinase signal peptide was named cuti-pro-Der p 1.
The constructs were transformed into S. cerevisiae. For screening of yeast transformants expressing Der p 1, the transformation solution was plated on SC-agar plates for colony formation at 30.degree. C. for 3 days. Colonies were inoculated in50 ml sterile plastic tubes, each tube containing 10 mL SC medium. The tubes were fermented in 500 ml baffled Erlenmeyer flasks containing 100 ml SC medium at 30.degree. C., 250 rpm for 4 days. Culture broth from these fermentations were used forsandwich ELISA experiments to determine the concentration of expressed protein.
The expression level of Der p 1 by the pre-pro Der p1 S54N and the pre-pro Der p1 N52Q transformants were determined by sandwich ELISA as described above in the Method section to be at the same level plus/minus 8%. It was concluded that theexpression level of the two strains with the pre-pro-Der p 1 was independent of which of the two mutations S54N and N52Q were used.
In another experiment, 4.5 L culture broth of pre-pro-Der p 1 (N52Q) and cuti-pro-Der p 1 (S54N) were fermented for 4 days and samples were taken each day during fermentation and the amount of Der p 1 was measured by the Sandwich ELISA asdescribed above to follow the expression level. The ratio between expression yields of cuti-pro-Der p 1 and pre-pro-Der p 1 is shown below.
TABLE-US-00002 Expression yield (cuti-pro Fermentation day Der p 1/pre-pro-Der p 1) Day 1 8 Day 2 10 Day 3 8 Day 4 6
For each day of fermentation the cuti-pro-Der p 1 expressed between 6-10 times more Der p 1 than pre-pro-Der p 1 which showed that the cutinase signal peptide in front of pro-Der p 1 increased the expression level of pro-Der p 1 protein comparedto the use of natural dust mite Der p 1 signal peptide.
Example 2
Expression of a Cellulase From Mucor circinellides in S. cerevisiae
Mucor circinellides IFO4554 was cultivated in shake flask containing RS-25+0.5% lactose medium for one day at 30.degree. C. The mycelium was collected and used for mRNA preparation, which was subsequently reverse transcribed into cDNA. Anapproximately 1 kb fragment was amplified by PCR from the cDNA by using the MCE-BC1 F and MCE-Nru R primer pair and the following PCR conditions: 2 min at 94.degree. C.; 35 cycles of 1 min at 94.degree. C., 1 mi at 45.degree. C. and 2.5 min at72.degree. C.; and finally 8 min at 72.degree. C. The amplified fragment was cloned int T-vector (Novagene).
The fragment (the Mucor cellulase gene) in T-vector was re-amplified with the primer pairs, M61 F and C-term R61 R, and M61Cutisig F and C-term R61 R, where the former pair was used for the construct with the original signal sequence (the signalsequence of the Mucor cellulase gene) and the latter pair was used to construct a nucleic acid sequence comprising the signal sequence from the H. insolens cutinase (SEQ ID NO: 2) and the Mucor cellulase gene.
Yeast was transformed by introducing the resulting PCR fragments into S. cerevisiae YNG318 together with the pJC039 vector digested with HindIII and XbaI, and PvuII and XbaI, respectively.
The obtained transformants were cultivated in 24 well plates containing YPD medium at 30.degree. C. and 180 rpm for 3 days. The culture supernatants were applied to holes in an agar plated containing 0.2% CMC (carboxy methyl cellulose), pH 8.5. In below table the size of the halos surrounding holes containing culture supernatant from yeast cells expressing the cellulase from Mucor with either the H. insolens cutinase signal peptide or with the signal peptide from the Mucor cellulase gene. Asthe cellulase is capable of degrading the CMC thereby creating the halo the size of the halo correlates to the amount of cellulase present in the culture supernatant which was placed in the particular hole. Thus a large halo indicates high amounts ofcellulase while a small halo indicates a low amount of cellulase.
TABLE-US-00003 Halo size in CMC plate Mucor cellulase with +++++ H. insolens cutinase signal peptide Mucor cellulase with its (+) own signal peptide
The results indicate that the expression level in yeast of Mucor cellulase is much higher when it is expressed with the signal peptide sequence from the H. insolens cutinase gene than when expressed with its own signal peptide sequence (Mucorcellulase gene).
Example 3
Expression of Cystein Protease from Trifolium repens L in S. cerevisiae
To construct an expression vector comprising the signal peptide from alpha-factor and the cystein protease from Trifolium repens L, the DNA fragment encoding the alpha-factor signal peptide was re-amplified with a primer pair, alpha-signal-Munland alpha-signal-CysProR. The gene encoding pro-mature region of the cystein protease from Trifolium repens L was re-amplified with a primer pair, alpha-signal-CysPro F and Spe-Cys ProR using the EMBL:AY192363 sequence as template. Yeast wastransformed by mixing these two PCR fragments together with pJC039 vector digested with Hind III and Xba I and introduced into S. cerevisiae YNG318.
To construct an expression vector comprising the signal peptide from the H. insolens cutinase and the cystein protease from Trifolium repens L, the gene encoding the pro-mature region of the cystein protease from Trifolium repens L wasre-amplified with a primer pair, Cuti-Sig-CysPro and CysPro C-term. Yeast was transformed by mixing the obtained PCR fragment with pJC039 vector digested with Hind III and Xba I and introduced into S. cerevisiae YNG318.
The obtained transformants were cultivated in 24 well plate containing 1 ml of YPD at 27.degree. C. for 3 days and then the supernatants were tested for cystein protease activity as described in the Methods section. The measurements of thecystein protease activity are shown in below table.
TABLE-US-00004 Cystein protease activity (fluorescence emission/min) Cystein protease with H. insolens 4.446 .times. 10.sup.6 cutinase signal peptide Cystein protease with alpha-factor 4.073 .times. 10.sup.5 signal peptide
The results indicate that the expression level in yeast of the cystein protease from white clover is 10 times higher when the protease is expressed with the H. insolens cutinase signal peptide than with the alpha-factor signal peptide.
Example 4
Expression of Trypsin from Fusarium in S. cerevisiae
The trypsin gene from Fusarium was re-amplified with the primer pairs, yeast-F and yeast-R, and cuti-pre and yeast-R using the EMBL: S63827 sequence as template, i.e. the cDNA sequence shown in SEQ ID NO: 6. The yeast-F/yeast-R primer pair wasused to construct a sequence comprising a nucleic acid sequence encoding the signal peptide, the pro-region and the mature part of the trypsin gene, while the cuti-pre/yeast-R primer pair was used to construct a nucleic acid sequence comprising thesignal peptide and pro-region from the H. insolens cutinase and the mature trypsin gene from Fusarium. Yeast was transformed introducing the resulting PCR fragments into S. cerevisiae YNG318 together with the pJC039 vector digested with HindIII andXbaI, and PvuII and XbaI.
The obtained transformants (pTM-TP1 and pTM-TP2) were cultivated in 24 well plates containing YPD medium at 30.degree. C., 180 rpm for 3 days. pTM-TP1: Fusarium Trypsin signal+Fusarium Trypsin Pro+mature trypsin pTM-TP2: H. insolens cutinasesignal+H. insolens cutinase Pro+mature trypsin
The trypsin activity was measured as described above in the Method section. No activity was observed in both culture supernatant even with NeutraseTM (as a maturase) addition. However, the pro-form of trypsin (cutinase pro+mature trypsin) wasdetected by Western blotting with pTM-TP2.
Therefore, the following constructs were made: pTM-TP2-Kex: H. insolens cutinase signal peptide+H. insolens cutinase pro-region+KexII site+mature Fusarium trypsin pTM-TP2w/o pro: H. insolens cutinase signal peptide+mature Fusarium trypsinpTM-TP2 TPpro: H. insolens cutinase signal peptide+Fusarium trypsin pro-region+Fusarium mature trypsin
Each of the primer pairs, TP2-Kex F and R, Cuti-pre F and R and CUTI-pre-TPpro F and R, were used to prepare pTM-TP2-Kex, pTM-TP2w/o pro and pTM-TP2 TPpro, respectively by mixing them with pTM-TP2 vector digested with EagI and introducing thismixture into S. cerevisiae YNG318.
The obtained transformants were cultivated in 24 well plates containing YPD medium at 30.degree. C., 180 rpm for 3 days.
TABLE-US-00005 Activity w/o Activity Western blot Western blot of Signal Neutrase (as with of cell extract supernatant Construct peptide Pro-region a maturase) Neutrase (intracellular) (extracellular) pTM-TPI Trypsin Trypsin - - Pro-form -pTM-TPIKex Trypsin Trypsin (+kex site) - - Pro-form - pTM-TP2 Cutinase Cutinase - - - Pro-form pTM-TP2Kex Cutinase Cutinase (+kex site) - - N.T. N.T. pTM-TP2 w/o pro Cutinase None - - - Larger than mature pTM-TP2TPpro Cutinase Trypsin - + - Pro-formwherein "-" means that no activity or no band in the Western blot could be detected, "+" means that trypsin activity was detectable, "pro-form" means that it was the pro-form of the trypsin which was detectable, "N.T." means "not tested" and for thepTM-TP2 w/o pro means that a protein larger than the mature was detectable, however this construct was designed not to include a pro-region, thus it is not a pro-form.
Trypsin activity was detected with pTM-TP2TPpro vector when Neutrase.TM. was added to the supernatant (final conc. 0.5 AU/ml). The results indicate that the Fusarium trypsin's own signal peptide does not work efficiently in yeast for expressionof trypsin, while the H. insolens cutinase signal peptide does. The pro-region (also called the pro-sequence) from the Fusarium trypsin (7 amino acids) seems to be necessary for proper folding and activation of the trypsin.
Example 5
Expression of a Phytase from Peniophora in S. cerevisiae
The Peniophora phytase gene was amplified with the primer pairs (PP1 F and PP R, PP2 F and PPR using the EMBL: PLY310696 sequence as template, i.e. the cDNA sequence shown in SEQ ID NO: 8. The PP1 F/PP R primer pair was used to construct anucleic acid sequence encoding the signal peptide from the Peniophora phytase gene and the mature protein of Peniophora phytase, while the PP2 F/PPR primer pari was used to construct a nucleic acid sequence encoding the signal peptide from the H.insolens cutinase gene and the mature Peniophora phytase protein. Yeast was transformed by introducing the resulting PCR fragments into S. cerevisiae YNG318 together with the pJC039 vector digested with HindIII and XbaI, and PvuII and XbaI.
The obtained transformants were cultivated in 24 well plates and 500 ml-shake flaks containing YPD medium at 30.degree. C., 180 rpm for 3 days.
The pTMPP1 construct comprised the original signal peptide sequence from the Peniophora phytase, while the pTMPP2 construct comprised the H. insolens cutinase signal peptide sequence. The phytase activity was measured, as described in the Methodsection, in the culture supernatant of transformants comprising the pTMPP1 or the pTMPP2 construct which were culture either in 24-well plates or in a shake flask. The results are shown below.
TABLE-US-00006 24-well Shake flask pTMPP1 (phytase signal) 1.8 U/ml 1 U/ml pTMPP2 (cutinase signal) 6.9 U/ml 13 U/ml
The results show that the transformants comprising the pTMPP2 construct express more phytase activity than those comprising the pTMPP1 construct indicating that the H. insolens signal peptide increases expression of the phytase in yeast comparedwith the phytase's own signal peptide.
Example 6
Expression of Phytase from Peniophora in Aspergillus oryzae
The constructs comprising the phytase gene with its own signal peptide sequence and the phytase gene with the H. insolens cutinase signal peptide sequence described in example 5 were used to construct an expression vector for Aspergillus andtransformed into Aspergillus as described in Lassen et al., 2001, Applied and Environmental Micorbiology, 67: 4701-4707. For each of the constructs 49 strains were isolated, purified and the production of phytase was measured as described in the Methodsection above by culturing said transformants in shake flasks. When comparing the strains from the two groups of construct which expressed the highest level of phytase, it was found that the strain comprising the construct with the cutinase signalpeptide expressed approximately 1.4 times more phytase than the one comprising the phytase signal peptide. Similarly, when the average amount of expressed phytase in the 5 strains from each group which expressed the highest amount of phytase wascompared the strains comprising the construct with the cutinase signal peptide expressed approximately 1.3 times more phytase than those comprising the construct with the phytase signal peptide.
>
32 T Humicolainsolens ys Phe Phe Thr Thr Ile Leu Ser Thr Ala Ser Leu Val Ala Ala Pro 2 54 DNA Humicola insolens 2 atgaagttct tcaccaccat cctcagcacc gccagccttg ttgctgctct cccc 54 3 32ermatophagoides pteronyssinus SIGNAL () PROPEP(8) mat_peptide (99)..(32t Lys Ile Val Leu Ala Ile Ala Ser Leu Leu Ala Leu Ser Ala Val -95 -9yr Ala Arg Pro Ser Ser Ile Lys Thr Phe Glu Glu Tyr Lys Lys Ala -87sn Lys Ser Tyr Ala Thr Phe Glu Asp Glu Glu Ala Ala Arg Lys-65 -6sn Phe Leu Glu Ser Val Lys Tyr Val Gln Ser Asn Gly Gly Ala Ile -54sn His Leu Ser Asp Leu Ser Leu Asp Glu Phe Lys Asn Arg Phe Leu -32er Ala Glu Ala Phe Glu His Leu Lys Thr Gln Phe Asp Leu Asn --5 Ala Glu ThrAsn Ala Cys Ser Ile Asn Gly Asn Ala Pro Ala Glu Ile -eu Arg Gln Met Arg Thr Val Thr Pro Ile Arg Met Gln Gly Gly 5 3ly Ser Cys Trp Ala Phe Ser Gly Val Ala Ala Thr Glu Ser Ala 35 4r Leu Ala Tyr Arg Asn Gln Ser Leu Asp LeuAla Glu Gln Glu Leu 5 Val Asp Cys Ala Ser Gln His Gly Cys His Gly Asp Thr Ile Pro Arg 65 7y Ile Glu Tyr Ile Gln His Asn Gly Val Val Gln Glu Ser Tyr Tyr 8 Arg Tyr Val Ala Arg Glu Gln Ser Cys Arg Arg Pro Asn Ala Gln Arg 95 Gly Ile Ser Asn Tyr Cys Gln Ile Tyr Pro Pro Asn Val Asn Lys Arg Glu Ala Leu Ala Gln Thr His Ser Ala Ile Ala Val Ile Ile Ile Lys Asp Leu Asp Ala Phe Arg His Tyr Asp Gly Arg Thr Ile Gln Arg Asp Asn GlyTyr Gln Pro Asn Tyr His Ala Val Asn Ile Gly Tyr Ser Asn Ala Gln Gly Val Asp Tyr Trp Ile Val Arg Asn Ser Trp Asp Thr Asn Trp Gly Asp Asn Gly Tyr Gly Tyr Phe Ala Ala 2Ile Asp Leu Met Met Ile Glu Glu Tyr ProTyr Val Val Ile Leu 222 PRT Mucor circinellides mat_peptide (6) 4 Ala Ser Cys Ser Ser Val Tyr Gly Gln Cys Gly Gly Ile Gly Trp Ser Pro Thr Cys Cys Gln Ser Gly Ser Thr Cys Val Ala Gln Glu Gly 2 Asn Lys Tyr Tyr SerGln Cys Leu Pro Gly Ser His Ser Asn Asn Ala 35 4y Asn Ala Ser Ser Thr Lys Lys Thr Ser Thr Lys Ser Ser Thr Thr 5 Thr Ala Lys Ala Thr Ala Thr Val Thr Thr Lys Thr Val Thr Lys Thr 65 7 Thr Thr Lys Thr Thr Thr Lys Thr Ser Thr Thr Ala AlaAla Ser Thr 85 9r Thr Ser Ser Ser Ala Gly Tyr Lys Val Ile Ser Gly Gly Lys Ser Ser Gly Ser Thr Thr Arg Tyr Trp Asp Cys Cys Lys Ala Ser Cys Trp Pro Gly Lys Ala Ser Val Thr Gly Pro Val Asp Thr Cys Ala Asn Gly Ile Ser Leu Leu Asp Ala Asn Ala Gln Ser Gly Cys Asn Gly Gly Asn Gly Phe Met Cys Asn Asn Asn Gln Pro Trp Ala Val Asn Glu Leu Ala Tyr Gly Phe Ala Ala Ala Ser Ile Ala Gly Ser Asn Ala Gly Trp Cys CysGly Cys Tyr Glu Leu Thr Phe Thr Ser Gly 2Ala Ser Gly Lys Lys Met Val Val Gln Val Thr Asn Thr Gly Gly 222eu Gly Ser Asn His Phe Asp Leu Gln Met Pro Gly Gly Gly Val 225 234le Phe Asn Gly Cys Ala Ala Gln Trp GlyAla Pro Asn Asp Gly 245 25rp Gly Ala Arg Tyr Gly Gly Val Ser Ser Val Ser Asp Cys Ala Ser 267ro Ser Ala Leu Gln Ala Gly Cys Lys Trp Arg Phe Asn Trp Phe 275 28ys Asn Ser Asp Asn Pro Thr Met Thr Phe Lys Glu Val Thr Cys Pro 29Glu Leu Thr Thr Arg Ser Gly Cys Glu Arg Lys 337 PRT Trifolium repens L mat_peptide (327) 5 Arg Asp Phe Ser Ile Val Gly Tyr Ser Ser Glu Asp Leu Lys Ser Met -sp Lys Leu Ile Glu Leu Phe Glu Ser Trp Met Ser ArgHis Gly Lys -98yr Glu Thr Ile Glu Glu Lys Leu Leu Arg Phe Glu Val Phe Lys -75 -7sp Asn Leu Lys His Ile Asp Asp Arg Asn Lys Val Val Ser Asn Tyr -65rp Leu Gly Leu Asn Glu Phe Ala Asp Leu Ser His Gln Glu Phe Lys -43ys Tyr Leu Gly Leu Lys Val Asp Leu Ser Gln Arg Arg Glu Ser -25 -2er Asn Glu Glu Glu Phe Thr Tyr Arg Asp Val Asp Leu Pro Lys Ser - Asp Trp Arg Lys Lys Gly Ala Val Thr Pro Val Lys Asn Gln Gly 5 ys Gly Ser Cys TrpAla Phe Ser Thr Val Ala Ala Val Glu Gly 25 3e Asn Gln Ile Val Thr Gly Asn Leu Thr Ser Leu Ser Glu Gln Glu 4 Leu Ile Asp Cys Asp Thr Thr Tyr Asn Asn Gly Cys Asn Gly Gly Leu 55 6t Asp Tyr Ala Phe Ser Phe Ile Val Gln Asn Gly Gly Leu HisLys 7 Glu Asp Asp Tyr Pro Tyr Ile Met Glu Glu Ser Thr Cys Glu Met Lys 85 9lu Glu Thr Gln Val Val Thr Ile Asn Gly Tyr His Asp Val Pro Asn Asn Glu Gln Ser Leu Leu Lys Ala Leu Ala Asn Gln Pro Leu Val AlaIle Glu Ala Ser Ser Arg Asp Phe Gln Phe Tyr Ser Gly Val Phe Asp Gly His Cys Gly Ser Asp Leu Asp His Gly Val Ser Val Gly Tyr Gly Thr Ser Lys Asn Leu Asp Tyr Ile Ile Val Lys Asn Ser Trp Gly Ala Lys Trp GlyGlu Lys Gly Phe Ile Arg Met Lys Asn Ile Gly Lys Pro Glu Gly Ile Cys Gly Leu Tyr Lys Met Ala 22Tyr Pro Thr Lys Lys Lys 28 DNA fusarium oxysporum CDS (58)..(8tcatcaacc actcttcact cttcaactct cctctcttgg atatctatctcttcacc 57 atg gtc aag ttc gct tcc gtc gtt gca ctt gtt gct ccc ctg gct gct Val Lys Phe Ala Ser Val Val Ala Leu Val Ala Pro Leu Ala Ala gct cct cag gag atc ccc aac att gtt ggt ggc act tct gcc agc Ala Pro Gln Glu Ile Pro AsnIle Val Gly Gly Thr Ser Ala Ser 2 gct ggc gac ttt ccc ttc atc gtg agc att agc cgc aac ggt ggc ccc 2Gly Asp Phe Pro Phe Ile Val Ser Ile Ser Arg Asn Gly Gly Pro 35 4g tgt gga ggt tct ctc ctc aac gcc aac acc gtc ttg act gct gcc 249 TrpCys Gly Gly Ser Leu Leu Asn Ala Asn Thr Val Leu Thr Ala Ala 5 cac tgc gtt tcc gga tac gct cag agc ggt ttc cag att cgt gct ggc 297 His Cys Val Ser Gly Tyr Ala Gln Ser Gly Phe Gln Ile Arg Ala Gly 65 7 agt ctg tct cgc act tct ggt ggt att acctcc tcg ctt tcc tcc gtc 345 Ser Leu Ser Arg Thr Ser Gly Gly Ile Thr Ser Ser Leu Ser Ser Val 85 9a gtt cac cct agc tac agc gga aac aac aac gat ctt gct att ctg 393 Arg Val His Pro Ser Tyr Ser Gly Asn Asn Asn Asp Leu Ala Ile Leu ctctct act tcc atc ccc tcc ggc gga aac atc ggc tat gct cgc 44eu Ser Thr Ser Ile Pro Ser Gly Gly Asn Ile Gly Tyr Ala Arg gct gct tcc ggc tct gac cct gtc gct gga tct tct gcc act gtt 489 Leu Ala Ala Ser Gly Ser Asp Pro Val Ala Gly SerSer Ala Thr Val ggc tgg ggc gct acc tct gag ggc ggc agc tct act ccc gtc aac 537 Ala Gly Trp Gly Ala Thr Ser Glu Gly Gly Ser Ser Thr Pro Val Asn ctt ctg aag gtt act gtc cct atc gtc tct cgt gct acc tgc cga gct 585 Leu LeuLys Val Thr Val Pro Ile Val Ser Arg Ala Thr Cys Arg Ala tac ggc acc tcc gcc atc acc aac cag atg ttc tgt gct ggt gtt 633 Gln Tyr Gly Thr Ser Ala Ile Thr Asn Gln Met Phe Cys Ala Gly Val tcc ggt ggc aag gac tct tgc cag ggtgac agc ggc ggc ccc atc 68er Gly Gly Lys Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro Ile 2gac agc tcc aac act ctt atc ggt gct gtc tct tgg ggt aac gga 729 Val Asp Ser Ser Asn Thr Leu Ile Gly Ala Val Ser Trp Gly Asn Gly 222cc cga ccc aac tac tct ggt gtc tat gcc agc gtt ggt gct ctc 777 Cys Ala Arg Pro Asn Tyr Ser Gly Val Tyr Ala Ser Val Gly Ala Leu 225 234ct ttc att gac acc tat gct taa ataccttgtt ggaagcgtcg 824 Arg Ser Phe Ile Asp Thr Tyr Ala 245 agatgttccttgaatattct ctagcttgag tcttggatac gaaacctgtt tgagaaatag 884 gtttcaacga gttaagaaga tatgagttga tttcagttgg atcttagtcc tggttgctcg 944 taatagagca atctagatag cccaaattga atatgaaatt tgatgaaaat attc 998 7 248 PRT fusarium oxysporum 7 Met Val Lys Phe Ala Ser ValVal Ala Leu Val Ala Pro Leu Ala Ala Ala Pro Gln Glu Ile Pro Asn Ile Val Gly Gly Thr Ser Ala Ser 2 Ala Gly Asp Phe Pro Phe Ile Val Ser Ile Ser Arg Asn Gly Gly Pro 35 4p Cys Gly Gly Ser Leu Leu Asn Ala Asn Thr Val Leu Thr AlaAla 5 His Cys Val Ser Gly Tyr Ala Gln Ser Gly Phe Gln Ile Arg Ala Gly 65 7 Ser Leu Ser Arg Thr Ser Gly Gly Ile Thr Ser Ser Leu Ser Ser Val 85 9g Val His Pro Ser Tyr Ser Gly Asn Asn Asn Asp Leu Ala Ile Leu Leu Ser ThrSer Ile Pro Ser Gly Gly Asn Ile Gly Tyr Ala Arg Ala Ala Ser Gly Ser Asp Pro Val Ala Gly Ser Ser Ala Thr Val Gly Trp Gly Ala Thr Ser Glu Gly Gly Ser Ser Thr Pro Val Asn Leu Leu Lys Val Thr Val Pro Ile ValSer Arg Ala Thr Cys Arg Ala Tyr Gly Thr Ser Ala Ile Thr Asn Gln Met Phe Cys Ala Gly Val Ser Gly Gly Lys Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro Ile 2Asp Ser Ser Asn Thr Leu Ile Gly Ala Val Ser Trp Gly AsnGly 222la Arg Pro Asn Tyr Ser Gly Val Tyr Ala Ser Val Gly Ala Leu 225 234er Phe Ile Asp Thr Tyr Ala 245 8 A peniophora lycii CDS (ig_peptide (t_peptide ( catcttctgc tctgacctccatctcgctga gcggccgacg agaacctagg ggctctaagt 6tacta tcgccgcgcc tgtgaaggcc ccataccagc ccttatcgat atg gtt Val tct tcg gca ttc gca cct tcc atc cta ctt agc ttg atg tcg agt ctt Ser Ala Phe Ala Pro Ser Ile Leu Leu Ser Leu Met Ser Ser Leu-25 -2ct ttg agc acg cag ttc agc ttt gtt gcg gcg cag cta cct atc ccc 2Leu Ser Thr Gln Phe Ser Phe Val Ala Ala Gln Leu Pro Ile Pro -ca caa aac aca agt aat tgg ggg cct tac gat ccc ttc ttt ccc gtc 26ln Asn Thr Ser Asn TrpGly Pro Tyr Asp Pro Phe Phe Pro Val cg tat gca gct ccg ccg gaa ggg tgc aca gtg aca cag gtc aac 3Pro Tyr Ala Ala Pro Pro Glu Gly Cys Thr Val Thr Gln Val Asn 25 3g att cag agg cac ggc gcg cgt tgg ccc aca tcc ggc gcg cgg tcg 356Leu Ile Gln Arg His Gly Ala Arg Trp Pro Thr Ser Gly Ala Arg Ser 4 cgg cag gtc gcc gcc gta gcg aag ata caa atg gcg cga cca ttc acg 4Gln Val Ala Ala Val Ala Lys Ile Gln Met Ala Arg Pro Phe Thr 55 6t ccc aag tat gag ttc ctc aac gac ttcgtg tac aag ttc ggc gtc 452 Asp Pro Lys Tyr Glu Phe Leu Asn Asp Phe Val Tyr Lys Phe Gly Val 7 85 gcc gat ctg cta ccg ttc ggg gct aac caa tcg cac caa acc ggc acc 5Asp Leu Leu Pro Phe Gly Ala Asn Gln Ser His Gln Thr Gly Thr 9tgtat acg cgc tac agt aca cta ttt gag ggc ggg gat gta ccc 548 Asp Met Tyr Thr Arg Tyr Ser Thr Leu Phe Glu Gly Gly Asp Val Pro gtg cgc gcg gct ggt gac caa cgc gtc gtt gac tcc tcg acg aac 596 Phe Val Arg Ala Ala Gly Asp Gln Arg Val Val AspSer Ser Thr Asn acg gca ggc ttt ggc gat gct tct ggc gag act gtt ctc ccg acg 644 Trp Thr Ala Gly Phe Gly Asp Ala Ser Gly Glu Thr Val Leu Pro Thr cag gtt gtg ctt caa gaa gag ggg aac tgc acg ctc tgc aat aat 692 Leu Gln ValVal Leu Gln Glu Glu Gly Asn Cys Thr Leu Cys Asn Asn atg tgc ccg aat gaa gtg gat ggt gac gaa tcc aca acg tgg ctg ggg 74ys Pro Asn Glu Val Asp Gly Asp Glu Ser Thr Thr Trp Leu Gly ttt gcg ccg aac atc acc gcg cga ttgaac gct gct gcg ccg agt 788 Val Phe Ala Pro Asn Ile Thr Ala Arg Leu Asn Ala Ala Ala Pro Ser aac ctc tca gac agc gac gcg ctc act ctc atg gat atg tgc ccg 836 Ala Asn Leu Ser Asp Ser Asp Ala Leu Thr Leu Met Asp Met Cys Pro 22gac act ctc agc tcc ggg aac gcc agc ccc ttc tgt gac cta ttt 884 Phe Asp Thr Leu Ser Ser Gly Asn Ala Ser Pro Phe Cys Asp Leu Phe 2225 acc gcg gag gag tat gtg tcg tac gag tac tac tat gac ctc gac aag 932 Thr Ala Glu Glu Tyr Val Ser Tyr Glu Tyr TyrTyr Asp Leu Asp Lys 234ac tat ggc acg ggc ccc ggg aac gct ctc ggt cct gtc cag ggc gtc 98yr Gly Thr Gly Pro Gly Asn Ala Leu Gly Pro Val Gln Gly Val 256ac gtc aat gag ctg ctt gca cgc ttg acc ggc caa gcc gtt cga yTyr Val Asn Glu Leu Leu Ala Arg Leu Thr Gly Gln Ala Val Arg 265 27ac gag acg cag acg aac cgc acg ctc gac agc gac cct gca aca ttc p Glu Thr Gln Thr Asn Arg Thr Leu Asp Ser Asp Pro Ala Thr Phe 289tg aac cgt acg ttc tac gcc gacttc tcg cat gat aac acc atg o Leu Asn Arg Thr Phe Tyr Ala Asp Phe Ser His Asp Asn Thr Met 295 3gtg ccc atc ttt gcg gcg ctc ggg ctc ttc aac gcc acc gcc ctc gac l Pro Ile Phe Ala Ala Leu Gly Leu Phe Asn Ala Thr Ala Leu Asp 332cg ctg aag ccc gac gag aac agg ttg tgg gtg gac tct aag ctg gta o Leu Lys Pro Asp Glu Asn Arg Leu Trp Val Asp Ser Lys Leu Val 334tc tct gga cat atg acg gtc gag aag ctg gca tgt tct ggg aag o Phe Ser Gly His Met Thr Val GluLys Leu Ala Cys Ser Gly Lys 345 35ag gcg gtc agg gtg ctc gtg aac gac gcg gtg cag ccg ctg gag ttc u Ala Val Arg Val Leu Val Asn Asp Ala Val Gln Pro Leu Glu Phe 367ga ggt gtt gat ggg gtg tgc gag ctt tcg gct ttc gta gag agc s Gly Gly Val Asp Gly Val Cys Glu Leu Ser Ala Phe Val Glu Ser 375 38ag acg tat gcg cgg gag aat ggg caa ggc gac ttc gcc aag tgc ggc n Thr Tyr Ala Arg
Glu Asn Gly Gln Gly Asp Phe Ala Lys Cys Gly 39ttt gtt ccg tcg gaa tagcgggaga ccgtctatgc tacacagtaa ttgtgtactc e Val Pro Ser Glu 4gcactg tagctgtact tacaagtcgt agggtacgat cgtacttacg ctcgtttatt tccttcct ttaaaaaaaaaaaaaaaaaa aaaaaaaaaa a 439 PRT peniophora lycii 9 Met Val Ser Ser Ala Phe Ala Pro Ser Ile Leu Leu Ser Leu Met Ser -25 -2er Leu Ala Leu Ser Thr Gln Phe Ser Phe Val Ala Ala Gln Leu Pro - Pro Ala Gln Asn Thr Ser Asn Trp Gly ProTyr Asp Pro Phe Phe 5 ro Val Glu Pro Tyr Ala Ala Pro Pro Glu Gly Cys Thr Val Thr Gln 2 35 Val Asn Leu Ile Gln Arg His Gly Ala Arg Trp Pro Thr Ser Gly Ala 4 Arg Ser Arg Gln Val Ala Ala Val Ala Lys Ile Gln Met Ala Arg Pro 55 6eThr Asp Pro Lys Tyr Glu Phe Leu Asn Asp Phe Val Tyr Lys Phe 7 Gly Val Ala Asp Leu Leu Pro Phe Gly Ala Asn Gln Ser His Gln Thr 85 9y Thr Asp Met Tyr Thr Arg Tyr Ser Thr Leu Phe Glu Gly Gly Asp Val Pro Phe Val Arg Ala Ala GlyAsp Gln Arg Val Val Asp Ser Ser Asn Trp Thr Ala Gly Phe Gly Asp Ala Ser Gly Glu Thr Val Leu Thr Leu Gln Val Val Leu Gln Glu Glu Gly Asn Cys Thr Leu Cys Asn Met Cys Pro Asn Glu Val Asp Gly Asp Glu Ser ThrThr Trp Gly Val Phe Ala Pro Asn Ile Thr Ala Arg Leu Asn Ala Ala Ala Pro Ser Ala Asn Leu Ser Asp Ser Asp Ala Leu Thr Leu Met Asp Met 22Pro Phe Asp Thr Leu Ser Ser Gly Asn Ala Ser Pro Phe Cys Asp 2225Leu Phe Thr Ala Glu Glu Tyr Val Ser Tyr Glu Tyr Tyr Tyr Asp Leu 234ys Tyr Tyr Gly Thr Gly Pro Gly Asn Ala Leu Gly Pro Val Gln 245 25ly Val Gly Tyr Val Asn Glu Leu Leu Ala Arg Leu Thr Gly Gln Ala 267al Arg Asp Glu ThrGln Thr Asn Arg Thr Leu Asp Ser Asp Pro Ala 289he Pro Leu Asn Arg Thr Phe Tyr Ala Asp Phe Ser His Asp Asn 295 3Thr Met Val Pro Ile Phe Ala Ala Leu Gly Leu Phe Asn Ala Thr Ala 332sp Pro Leu Lys Pro Asp Glu Asn Arg LeuTrp Val Asp Ser Lys 325 33eu Val Pro Phe Ser Gly His Met Thr Val Glu Lys Leu Ala Cys Ser 345ly Lys Glu Ala Val Arg Val Leu Val Asn Asp Ala Val Gln Pro Leu 367he Cys Gly Gly Val Asp Gly Val Cys Glu Leu Ser Ala Phe Val375 38lu Ser Gln Thr Tyr Ala Arg Glu Asn Gly Gln Gly Asp Phe Ala Lys 39Gly Phe Val Pro Ser Glu 4NA Artificial Sequence Primer tggtga tcaccaccat gaagttcacc gttgctatta cttc 44 NA Artificial Sequence Primergagctc gcgattactt tctttcgcaa cctgagcgag 4 DNA Artificial Sequence Primer cttccg caaacaaagt cgccaacatg aagttcaccg ttgctattac 5 DNA Artificial Sequence Primer agcctt gttgctgctc tccccgccgc ttcttgcagc tctgtctatg 5DNA Artificial Sequence Primer tacatg atgcggccct ctagattact ttctttcgca acctgagcg 49 NA Artificial Sequence Primer acgacg ggacccgggg atccaattga tgagattccc atcaatttt 49 NA Artificial Sequence Primer acgatg gagaaatcgcgagcttcagc ttctcttttc tc 42 NA Artificial Sequence Primer aaagag aagctgaagc tcgcgatttc tccatcgtgg gc 42 NA Artificial Sequence Primer attaca tgatgcggcc cactagttca tttcttctta gtaggataag 5 DNA Artificial Sequence Primercgccag ccttgttgct gctctccccc gcgatttctc catcgtgggc 5 DNA Artificial Sequence Primer 2acatg atgcggcccg cggccgctca tttcttctta gtaggataag 5 DNA Artificial Sequence Primer 2ggtac ccggggatca agcttatggt caagttcgct tcc 43 2243 DNA Artificial Sequence Primer 22 aactaattac atgatgcggc cctctagatt aagcataggt gtc 43 23 45 DNA Artificial Sequence Primer 23 cgttcctgaa cttgttgccc gggttggtgg cacttctgcc agcgc 45 24 32 DNA Artificial Sequence Primer 24 gttcctgaac ttgttcggcg ggttggtggcac 32 25 32 DNA Artificial Sequence Primer 25 gtgccaccaa cccgccgaac aagttcagga ac 32 26 29 DNA Artificial Sequence Primer 26 gttgctgctc tccccgttgg tggcacttc 29 27 29 DNA Artificial Sequence Primer 27 gaagtgccac caacggggag agcagcaac 29 28 42 DNAArtificial Sequence Primer 28 tcctcaggag atccccaaca ttgttggtgg cacttctgcc ag 42 29 4rtificial Sequence Primer 29 gttggggatc tcctgaggag cggggagagc agcaacaagg 4 DNA Artificial Sequence Primer 3acggt acccggggat caagcttatg gtttcttcggcattcgcacc 5 DNA Artificial Sequence Primer 3ttaca tgatgcggcc ctctagacta ttccgacgga acaaagccgc 5 DNA Artificial Sequence Primer 32 ccgccagcct tgttgctgct ctcccccagc tacctatccc cgcacaaaac 5BR>* * * * *