FIELD OF THE INVENTION

The present invention relates to the structural proteins of the causative agent of Pancreatic Disease in fish, nucleotide sequences encoding said proteins, vaccines comprising said proteins or nucleotide sequences and diagnostic kits comprisingsaid proteins or nucleotide sequences.

BACKGROUND OF THE INVENTION

Pancreatic Disease (PD) is a serious disease that affects fish, in particular salmonid fish such as wild Atlantic salmon, rainbow trout and the like. The disease causes lesions in the pancreas, including loss of pancreatic exocrine tissue, andfibrosis, cardiac and skeletal muscle myopathies. Outbreaks of PD were first described in 1984 by Munro et al, in Helgoland Meeresuntersuchungen 37:571-586 (1984). PD typically affects the fish post-molts during the first year after they aretransferred to sea sites and is reported to spread rapidly among farm fish held in sea cages. Clinical signs include lethargy with a tendency to congregate in cage corners and to fail to maintain a horizontal position, cessation of feeding (anorexia)and significant mortalities (Ferguson et al, J. Fish Disease 9:95-98, 1986). Murphy et al (in J. Fish Disease 15:401-408, 1992) confirmed these observations in a later study, in which it was found that cardiac and skeletal myopathy is exacerbated infish suffering from PD.

An outbreak of PD in a fish farm can cause growth to be reduced and up to 10 percent of surviving fish may prove to be runt. On Irish fish farms PD causes significant mortality rates of 10 to 60 percent among the young fish during the first yearafter they are transferred to sea sites (McLoughlin, M., Fish Farmer page 19, March/April 1995). The estimated cost to the Irish industry in terms of loss of production is currently thought to be around .English Pound.25 million per year. Consequently,there is a great need for a vaccine for the prevention and/or treatment of PD in fish.

EP-A-712926 describes the isolation of the causative agent of PD from tissues of PD affected fish arid the identification of the virus as a toga-like virus. To prevent PD infections in fish, the use of attenuated or inactivated PD forvaccination of the fish is accordingly suggested. A drawback in the production of inactivated vaccines from the PD virus described in EP-A-712926 is the slow growth of the virus, in particular on cell cultures, which makes the manufacturing of saidvaccines a relatively inefficient process. A further drawback with the inactivated vaccines is the instability of the inactivated virus in the presence of other inactivated pathogens resulting in potency loss. Fish vaccines are generally produced asmultivalent vaccines, and significant higher amounts of inactivated virus are required in the multivalent vaccine than would be necessary in a monovalent vaccine to compensate for the loss of potency.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides the means to produce alternative vaccines to prevent infection of fish with PD, in which the above mentioned difficulties are overcome. The present invention provides for the nucleotide sequence of the 3' part ofthe genomic RNA of a salmon PD virus (SPDV). This sequence of 5179 nucleotides is depicted in SEQ ID NO 1 and contains several open reading frames (ORF's): On the coding strand nucleotide 2 to 1186 codes for a non-structural protein, and anotheroverlapping ORF starting from nucleotide 997 to 5076 codes for the structural proteins. This ORF was designated as p130. Other non-determined ORF's were found on the coding strand (3447 to 3767 and 4289 to 4612) and the non coding strand (1207 to 890,and 1232-837).

The ORF from nucleotide 2 to 1186 codes for the C-terminal part of a non-structural protein designated as NSP4; its deduced amino acid is depicted in SEQ ID NO 2.

ORF p130 comprises the nucleotide sequences that encode the structural proteins of the PD virus. The structural proteins of the PD virus consist of a basic capsid protein, three envelope proteins designated as E1, E2 and E3, and a proteindesignated as the 6K protein. The amino acid sequence of the whole protein encoded by the p130 ORF is depicted in SEQ ID NO 3. After processing, the p130 protein is spliced into the capsid protein (aa 76-375 of p130), E3 (aa 358-428 of p130), E2(aa429-866 of p130), 6K (aa 867-898 of p130), and E1 (aa 899-1359 of p130).

The nucleotide sequence encoding the capsid protein of the PD virus is located at nucleotide 1222 to 2067 of SEQ ID NO 1. The corresponding amino acid sequence (total 282 amino acids) is depicted in SEQ ID NO 4.

The nucleotide sequence encoding the envelope proteins E3, E2 and E1 are located at nucleotide 2068-2280, 2281-3594 and 3691-5076 respectively, of the nucleotide sequence depicted in SEQ ID NO 1. The corresponding amino acid sequences of the E3,E2 and E1 proteins are depicted in SEQ ID No's 5, 6 and 8 respectively.

The nucleotide sequence encoding the 6K protein is located at nucleotide 3595 to 3690 of the nucleotide sequence depicted in SEQ ID NO 1, and the corresponding amino acid sequence of the 6K protein is depicted in SEQ ID NO 7. Further sequenceanalysis of the viral RNA extracted from PD infected pancreas tissue revealed the existence of a longer variant of the 6K protein having 68 amino acids in length compared to the 6K protein of 32 amino acids depicted in SEQ ID NO 7. The nucleotidesequence (SEQ ID NO 14) encoding the longer variant of 6K protein is 204 nucleotides in length compared to the 96 nucleotides of the nucleotide sequence encoding the truncated 6K protein. The nucleotide sequence encoding the long variant of 6K proteinand the deduced amino acid sequence thereof are shown in FIG. 2 and SEQ ID NO 14 and SEQ ID NO 15 respectively.

The cloning and characterisation of the nucleotide sequences of the present invention provides for the production of the structural proteins of the PD virus using standard recombinant DNA technology (Sambrooke et al., Molecular Cloning: aLaboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989). Cloning techniques and subsequent protein expression using in vitro expression systems are well known in the art. In this way, recombinant structural PDV proteins can beobtained, that are substantially free from other PDV proteins. These isolated structural proteins can be used to manufacture subunit vaccines to protect against infection of PD in fish. Said subunit vaccines may be used as marker vaccine in fish todistinguish vaccination from field infections with PD. Alternatively the nucleotide sequences encoding the structural proteins of the PD virus can be used to manufacture DNA vaccines or vector vaccines to protect against infection of fish with PD. Thenucleotide sequences and recombinant PD proteins can furthermore be used for diagnostic purposes, for instance to detect the presence of PD virus in the field or anti-PD antibodies in fish. Additionally, the recombinant PD proteins of the presentinvention can be used to produce PD specific antibodies. These antibodies can also be used for diagnostic purposes such as the detection of PD virus in fish or in the field.

Thus, in a first aspect the invention provides for a nucleic acid comprising the nucleotide sequence depicted in SEQ ID NO 1 encoding the structural proteins and part of NSP4 of the PD virus, fragments of said nucleotide sequence and a nucleicacid comprising the nucleotide sequence depicted in SEQ ID NO 14. Preferred fragments of the nucleotide sequences according to the invention are nucleotide fragments 1222-5076 (also referred to as p130 encoding the capsid, E3, E2, 6K and E1 proteins),2068-5076 (also referred to as p98 encoding the E3, E2, 6K and E1 proteins), 2068-3594 (also referred to as pE2 encoding E3 and E2 proteins), 1222-15 2067 (capsid), 2068-2280 (E3), 2281-3594 (E2), 3595-3690 (6K), and 3691-5076 (E1). For the purpose ofthis invention the nucleotide sequences according to the present invention also encompass the nucleotide sequence depicted in SEQ ID NO 1 and fragment sequences thereof (such as the p 130 and p98 fragments) which at least comprise a nucleotide sequenceencoding for a 6K protein, wherein the nucleotide sequence depicted by nucleotide 3595-3690 of SEQ ID NO 1 has been substituted with the nucleotide sequence depicted in SEQ ID NO 14. Also within the scope of this invention are nucleic acids comprisingtandem arrays of the nucleotide sequence comprising the sequence depicted in SEQ ID NO 1 or SEQ ID NO 14 or fragments thereof. Nucleotide sequences that are complementary to the sequence depicted in SEQ ID NO 1, SEQ ID NO 14, or parts thereof are alsowithin the scope of the invention, as well as nucleotide sequences that hybridise with the sequence depicted in SEQ ID NO 1 or SEQ ID NO 14. The hybridisation conditions for this purpose are stringent, preferably highly stringent. According to thepresent invention the term "stringent" means washing conditions of 1.times.SSC, 0.1% SDS at a temperature of 65.degree. C.; highly stringent conditions refer to a reduction in SSC towards 0.3.times.SSC. Nucleotide sequences that hybridise with thesequence shown in SEQ ID NO 1 or SEQ ID NO 14 are understood to be nucleotide sequences that have a sequence homology of at least 70%, preferably 80%, and more preferably 90% with the corresponding matching part of the sequence depicted in SEQ ID NO 1 orSEQ ID NO 14. According to the present invention the sequence homology is determined by comparing the nucleotide sequence with the corresponding part of the sequence depicted in SEQ ID NO 1 or SEQ ID NO 14. The sequence homology between a to nucleotideand the sequence in SEQ ID NO 1 or SEQ ID NO 14 can be determined via common sequence analysis program such as BLASTN and the like. The optimal match area is automatically determined by these programs. Homologous sequences can easily be isolated fromclosely related PD virus strains with the sequence depicted in SEQ ID NO 1 or SEQ ID NO 14, or fragments of these sequences, using routine cloning and hybridisation techniques. Sleeping Disease (SD) virus is closely related to PD virus and the nucleicacid sequences encoding the structural capsid, E3, E2, E 1 and 6K proteins of SD virus have the necessary sequence homology with the nucleic acid sequences depicted in SEQ ID NO 1 and 14. Thus, these SD nucleic acid sequences are also within the presentinvention. The nucleotide sequences of the invention can be used in the preparation of a DNA vaccine to vaccinate fish against PD infection. DNA vaccination refers to the induction of an immune response to one or more antigens that are expressed invivo from a gene inserted in a DNA plasmid which has been inoculated directly into the vaccinated fish. Thus, in a second aspect of the invention there is provided for a DNA vaccine comprising a pharmaceutically acceptable carrier and a DNA plasmid inwhich a nucleotide sequence encoding one or more PDV structural proteins is operably linked to a transcriptional regulatory sequence.

Preferably the nucleotide sequence to be used in said DNA plasmid is a nucleotide sequence comprising the nucleotide sequence depicted in SEQ ID NO 1 or a nucleotide sequence comprising the nucleotide sequence depicted in SEQ ID NO 14 orfragments of said nucleotide sequences. Preferred fragments of the nucleotide sequence depicted in SEQ ID NO 1 or 14 are nucleotide fragments 1222-5076, 2068-5076, 2068-3594, 1222-2067, 2068-2280, 2281-3594, 3595-3690 3691-5076 of the sequence depictedin SEQ ID NO 1, and combinations thereof such as for example fragment 1222-2067 with fragment 2281-3594. Also suitable for use in said DNA plasmid are nucleotide sequences that are complementary to the sequence of SEQ ID NO 1 or SEQ ID NO 14 ornucleotide sequences of which the sequence homology with the sequence depicted in SEQ ID NO 1 or SEQ ID NO 14 is at least 70%, preferably 80%, more preferably 90%. The sequence homology between the nucleotide sequences that are suitable for use in theDNA plasmid is determined as described earlier.

DNA plasmids that are suitable for use in a DNA vaccine according to the invention are conventional cloning or expression plasmids for bacterial, eukaryotic and yeast host cells, many of which are commercially available. Well known examples ofsuch plasmids are pBR322 and pcDNA3 (Invitrogen). The DNA plasmids according to the invention should be able to induce protein expression of the nucleotide sequences. The DNA plasmid can comprise one or more nucleotide sequences according to theinvention. In addition, the DNA plasmid can comprise other nucleotide sequences such as the immune-stimulating oligonucleotides having unmethylated CpG dinucleotides, or nucleotide sequences that code for other antigenic proteins or adjuvatingcytokines.

Transcriptional regulatory sequences that are suitable for use in a DNA plasmid according to the invention comprise promoters such as the (human) cytomegalovirus immediate early promoter (Seed, B. et al., Nature 329, 840-842, 1987; Fynan, E. F.et al., PNAS 90, 11478-11482,1993; Ulmer, J. B. et al., Science 259, 1745-1748, 1993), Rous sarcoma virus LTR (RSV, Gorman, C. M. et al., PNAS 79, 6777-6781, 1982; Fynan et al., supra; Ulmer et al., supra), the-MPSV LTR (Stacey et al., J. Virology 50,725-732, 1984), SV40 immediate early promoter (Sprague J. et al., J. Virology 45, 773, 1983), the metallothionein promoter (Brinster, R. L. et al., Nature 296, 39-42, 1982), the major late promoter of Ad2, the .beta.-actin promoter (Tang et al., Nature356, 152-154, 1992). The regulatory sequences may also include terminator and polyadenylation sequences. Amongst the sequences that can be used are the well known bovine growth hormone polyadenylation sequence, the SV40 polyadenylation sequence, thehuman cytomegalovirus (hCMV) terminator and polyadenylation sequences.

The DNA plasmid comprising a nucleotide sequence according to the present invention operably linked to a transcriptional regulatory sequence for use in the vaccine according to the invention can be naked or can be packaged in a delivery system. Suitable delivery systems are lipid vesicles, Iscoms, dendromers, niosomes, polysaccharide matrices, and the like. Also very suitable as delivery system are attenuated live bacteria such as Salmonella.

The nucleotide sequences according to the invention can additionally be used in the production of a vector vaccine to vaccinate fish against PD. A vector vaccine is understood to be a vaccine in which a live, attenuated bacteria or virus hasbeen modified so that it contains one or more heterologous nucleotide sequences inserted is into its genetic material. These so called vector bacteria or viruses are capable of coexpressing the heterologous proteins encoded by the inserted nucleotides. Thus in a third aspect the invention provides for a vector vaccine comprising a live attenuated bacteria or virus which have been modified to comprise in their genetic material one or more of the nucleotide sequences of the present invention. Verysuitable for use as a vaccine vector are for example vaccinia virus or Semliki forest virus

The nucleotide sequences according to the invention can also be used for the recombinant production of structural PD proteins, substantially free from other PD proteins. Thus in a fourth aspect the invention provides for the structural proteinsfrom PD virus. More specifically the invention provides for a PD capsid protein, the PD envelope proteins E1, E2, and E3, and the 6K protein. In particular there is provided for a capsid protein having the amino acid sequence depicted in SEQ ID NO 4 ora derivative thereof, an E3 protein having the amino acid sequence depicted in SEQ ID NO 5 or a derivative thereof, an E2 protein having the amino acid sequence depicted in SEQ ID NO 6 or a derivative thereof, an E1 protein having the amino acid sequencedepicted in SEQ ID NO 8 or a derivative thereof, and a 6K protein having the amino acid sequence depicted in SEQ ID NO 7, SEQ ID NO 15 or a derivative thereof.

Derivative proteins are understood to be proteins which have alterations in the amino acid sequence(s) of the present invention which do not affect the antigenic and/or immunogenic characteristics of these proteins, that is these derivativeproteins are still capable of inducing the production of antibodies that recognise and (cross)-react with the PD virus and/or inducing an immune response in fish that protects against PD infection. Antigenic characteristics are understood to be theability to induce production of antibodies that recognise and (cross)-react with the PD virus. Immunogenic characteristics are understood to be the ability to induce an immune response in fish that protects against infection with PD. The alterationsthat can occur in a sequence according to the present invention could for instance result from conservative amino acid substitutions, deletions, insertions, inversions or additions of (an) amino acid(s) in the overall sequence. Amino acid substitutionsthat are expected not to alter the immunological properties have been described. Amino acid replacements between related amino acids or replacements which have occurred frequently in evolution are, inter alia Ser/Ala, Ser/Gly, Asp/Gly, Asp/Asn, Ile/Val(see Dayhof, M. D., Atlas of protein sequence and structure, Nat. Biomed. Res. Found., Washington D.C., 1978, vol. 5, suppl. 3). Based on this information Lipman and Pearson developed a method for rapid and sensitive protein comparison (Science,1985, vol. 227, 1435-1441) and determining the functional similarity between proteins and peptides having sequence homology. The derivative proteins according to the invention are still capable to induce the production of antibodies that recognise and(cross)-react with the PD virus and/or to induce an immune response in the fish that protects against PD infection. The capsid, E1, E2, E3, and 6K proteins derived from Sleeping Disease (SD) virus are such derivative proteins according to the invention. These proteins have an amino acid sequence that is identical or almost identical to those of the PD virus as depicted in SEQ ID NO 4 to 8 or 15. These proteins are capable to raise antibodies that recognize and cross-react with PD virus as well as SDvirus. Other derivatives are protein fragments that are still capable to induce the production of antibodies that recognise and (cross)-react with the PD virus and/or to induce an immune response in the fish. The proteins according to the invention canbe prepared via standard recombinant protein expression techniques. For this purpose a nucleotide sequence encoding one or more of the proteins according to the invention or a multimere of said protein is inserted into an expression vector. Preferablythe nucleotide sequence is a nucleotide sequence comprising the nucleotide sequence depicted in SEQ ID NO 1 or SEQ ID NO 14 or one or more fragments of these sequences. Preferred fragments of the nucleotide sequences according to the invention arenucleotide fragments 1222-5076, 2068-5076, 2068-3594, 1222-2067, 2068-2280, 2281-3594, 3595-3690 3691-5076 of the sequence depicted in SEQ ID NO 1, and combinations thereof such as, for example, fragment 1222-2067 with fragment 2281-3594. Furtherpreferred fragments according to the invention are fragments of the nucleotide sequence depicted in SEQ ID NO 15 such as, for example, the nucleotide sequence depicted by nucleotides 3595-3690 of SEQ ID NO 1. Also suitable are nucleotide sequences thatare complementary to the sequence of SEQ ID NO 1 or SEQ ID NO 14 or nucleotide sequences of which the sequence homology with the sequence depicted in SEQ ID NO 1 or SEQ ID NO 14 is at least 70%, preferably 80%, and more preferably 90%. The sequencehomology between the nucleotide sequences that are suitable for use in the DNA plasmid is determined as described earlier.

Suitable expression vectors are, amongst others, plasmids, cosmids, viruses and YAC's (Yeast Artificial Chromosomes) which comprise the necessary control regions for replication and expression. The expression vector can be brought to expressionin a host cell. Suitable host cells are, for instance, bacteria, yeast cells and mammalian cells. Such expression techniques are well known in the art (Sambrooke et al., Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, ColdSpring Harbor, 1989).The expressed proteins can be isolated and purified from the medium. Expression of the whole p130 ORF (nucleotide fragment 997 to 5076 of SEQ ID NO 1) might lead to the forming of virus-like particles due to the spontaneousassemblance of the structural proteins. The invention furthermore provides for a vaccine comprising one or more of the structural PD proteins and a pharmaceutically acceptable carrier. More specifically, a vaccine according to the invention comprises acapsid protein having an amino acid sequence depicted in SEQ ID NO 4 or a derivative thereof, an E3 protein having an amino acid sequence depicted in SEQ ID NO 5 or a derivative thereof, an E2 protein having an amino acid sequence depicted in SEQ ID NO 6or a derivative thereof, an E1 protein having an amino acid sequence depicted in SEQ ID NO 8 or a derivative thereof, a 6K protein having an amino acid sequence depicted in SEQ ID NO 7 or SEQ ID NO 15 or a derivative thereof, or a mixture comprising twoor more of the to proteins according to the invention. Preferably the vaccine according to the invention comprises the E2 protein, and optionally the capsid protein. Also preferred is a vaccine comprising all structural proteins of PD; these proteinscan spontaneously form virus-like particles, thus providing a vaccine that closely resembles that of the whole pathogen. Vaccines according to the invention are suitable for use as a marker vaccine to distinguish between vaccination and infection by PDin the field. A preferred vaccine according to the invention is a marker vaccine comprising a 6K protein having the amino acid sequence depicted in SEQ ID NO 7.

A vaccine according to the invention can be prepared according to techniques well known to the skilled practitioner. General techniques for the preparation of DNA vaccines have been widely described, for example in EP patent 0 773 295 and U.S. Pat. No. 5,580,859.

Vaccines according to the invention comprise an effective amount of the afore-mentioned DNA plasmids, vector bacteria or virus, or proteins and a pharmaceutically acceptable carrier. The term "effective" as used herein is defined as the amountsufficient to induce an immune response in the target fish. The amount of plasmid, vector or protein will depend on the type of plasmid or vector, the route of administration, the time of administration, the species of the fish as well as age, generalhealth and diet.

In general, a dosage of 0.01 to 1000 .mu.g protein per kg body weight, preferably 0.5 to 500, more preferably 0.1 to 100 .mu.g protein can be used. With respect to the DNA vaccines, generally a minimum dosage of 10 pg. up to dosages of 1000.mu.g of plasmid have been described to be sufficient for a suitable expression of the antigens in vivo.

Pharmaceutically acceptable carriers that are suitable for use in a vaccine according to the invention are sterile water, saline, aqueous buffers such as PBS and the like. In addition, a vaccine according to the invention may comprise otheradditives such as adjuvants, stabilisers, anti-oxidants and others.

Suitable adjuvants include, amongst others, aluminium hydroxide, aluminium phosphate, amphigen, tocophenols, monophosphenyl lipid A, muramyl dipeptide, oil emulsions, glucans, carbomers, block-copolymers, cytokines and saponins such as Quil A.The amount of adjuvant added depends on the nature of the adjuvant itself.

Suitable stabilisers for use in a vaccine according to the invention are for example carbohydrates including sorbitol, mannitol, starch, sucrose, dextrin, and glucose, proteins such as albumin or casein, and buffers like alkaline phosphates.

The vaccines according to the invention are administered to the fish via injection, spray, immersion or peroral. The administration protocol can be optimised in accordance with standard vaccination practice.

The nucleotide sequences and the proteins according to the invention are also suitable for use in diagnostics. The nucleotide sequences or fragments thereof can be used to detect the presence of PD virus in the fish. A primer spanning theC-terminal part of E2/6K/N-terminal part of E1 (see FIG. 2) was used in RT-PCR to succesfully detect the presence of PD virus in a clinical specimen of a PD outbreak. The proteins can be used to detect the presence of antibodies in the fish.

The proteins according to the invention can additionally be used for the production of antibodies, using the general techniques available to the practitioner in the field. Preferably the proteins are used to produce specific monoclonalantibodies. The obtained antibodies may be utilised in diagnostics, to detect PD virus in the field, or in the fish.

Thus, in another aspect, the present invention provides for a diagnostic kit comprising one or more nucleotide sequences according to the invention, or one or more structural proteins according to the invention, or antibodies obtained with saidproteins. Antibodies according to the invention can be prepared according to standard techniques. Procedures for immunising animals, e.g. mice with proteins and selection of hybridomas producing immunogen specific monoclonal antibodies are well knownin the art (see for example Coligan et al. (eds), Current protocols in Immunology, 1992; Kohler and Milstein, Nature 256:495-497, 1975; Steenbakkers et al., Mol. Biol. Rep. 19:125-134, 1994).

The following examples are to illustrate the invention and should not be interpreted to limit the invention in any way.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1: structural organisation of the various cloned nucleotide sequences coding for the PD structural proteins.

FIG. 2: Nucleotide sequenec of C-terminus of E2 gene (nucleotides 3490-3594 of SEQ ID NO.:1; encoding amino acids 404-438 of SEQ ID NO.:6)/"long"6K gene (nucleotides 1-204 of SEQ ID NO.:14; encoding amino acids 1-68 of SEQ ID NO.: 15)/N-terminusof E1gene (nucleotides 3691 -3829 of SEQ ID NO.:1: encoding amino acids 1-46 of SEQ ID NO.:8). The putative cleavage sites between the E2/6K protein and 6K/E1 protein are represented by the vertical line (|) The nucleotide sequence encoding the "long"6Kprotein is 204 nucleotides long and encodes a protein of 68 amino acids. The numbering between brackets on the right of the sequence refers to the nucleotide and amino acid residues of the 6K gene or protein respectively. At nucleotide position 44 ofthe nucicotide sequence encoding the 6K gene the G-residue can be replaced with an A residue, resulting in a 6K protein with an N residue at amino acid position 15 of the amino acid sequence depicted in the figure.

EXAMPLES

Cells and Virus

Isolation and cultivation of a salmon PD virus (SPDV) strain was carried out in general as described in EP-A-712926. The F93125 isolate of SPDV was grown in Chinook salmon embryo (CHSE-214) cells as previously described (R. T. Nelson et al.(1995) Isolation of toga-like virus from farmed Atlantic salmon Salmo salar with pancreas disease. Diseases of Aquatic Organisms 22, pp. 25-32). For virus purification purposes, monolayer cultures of CHSE-214 grown to .about.80% confluence in 75cm.sup.2 flasks were infected with 1 ml virus to give a multiplicity of infection of .about.1. After 1 hr.adsorption an additional 14 ml supplemented Eagle's minimal essential medium (MEM) was introduced to each flask. The virus infected flasks wereincubated at 15.degree. C. for 7 or 8 days, when virus-induced cytopathic effect was evident, and the supernatant was collected.

Virus Purification

The supernatant (typically 500 ml from virus-infected cells was clarified at 3000 g for 20 min. Polyethyleneglycol (PEG) and NaCl were added to give final concentrations of 6% and 2.2% respectively. Following overnight incubation at 4.degree. C. the PEG precipitate was collected by centrifugation for 2 h at 3000 g. The resultant pellet was resuspended in PBS (1-2 ml) and, after clarification at 1000 g for 5 minutes, the crude virus suspension was fractionated by equilibrium densitycentrifugation using 11 ml gradients (20-60% w/w in PBS) of sucrose. After centrifugation for 18 hr at 75000 g at 4.degree. C., 1 ml fractions were collected from the bottom of the gradient. Fractions containing virus were identified by immunoblottingusing an PD-specific mouse monoclonal antibody (Welsh et al., submitted 1999).

Production of PD Virus cDNA Clones

Viral RNA was extracted from gradient-purified PD virus and virus-infected cells using RNA isolator (Genosys) and stored as ethanol precipitates. A cDNA library was made by random priming with RNA extracted from gradient-purified virus. Thislibrary consisted of clones containing inserts (250-500 bp) in the vector pUC18 (Sureclone ligation Kit, Pharmacia). Clones were selected randomly from the library and following sequencing and analysis using the BLAST program (University of Wisconsin,Genetics Computer Group) were mapped to the alphavirus genome. The sequences of three clones, N11, N38 and N50, were used to design oligonucleotide primers that were used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify 3overlapping fragments encompassing the 5.2 kb region at the 3'terminus of the PD genome. The incorporation of Not I sites into the primers facilitated the restriction ligation of two of these fragments into the Not I site of vector pBluescript(Stratagene). PCR was carried out using Expand Long Template PCR System (Boehringer Mannheim) at 94.degree. C. for 30 s 60.degree. C. for 30 s, 68.degree. C. for 2 min. Another clone was produced using 3'RACE (M. A. Frohmann et al., 1998; Rapidproduction of full-length cDNA's from rare transcripts using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci.USA. 85, pp. 8998-9002). The reaction was performed using a 5'/3' RACE kit (Boehringer Mannheim) with somemodifications. Thus, RNA from gradient-purified virus was independently subjected to first-strand synthesis and the resultant cDNA's were amplified by PCR at 94.degree. C. for 30 s, 60.degree. C. for 30 s, 68.degree. C. for I min.

Sequencing of PD Virus cDNA Clones

Cycle sequencing was performed using the ABI PRISM dye terminator ready reaction kit on purified plasmid DNA following the manufacturers protocol (Perkin Elmer Cetus). Electropherograms were interpreted using the Sequence Navigator software(Perkin Elmer Cetus). The complete nucleotide sequence of the 3'terminal 5.2 kb region of the PD virus RNA is presented in SEQ ID NO1.

An RT-PCR and sequence analysis using primers flanking the C-terminus of E2 and the N-terminus of E1 for viral RNA extracted directly from PD infected pancreas tissue revealed a longer 6K-encoding nucleotide sequence than the one depicted bynucleotides 3595-3690 of SEQ ID NO 1. The nucleic acid encoding the full-length 6K protein as well as the deduced amino acid sequence are shown in FIG. 2.

SPDV pFastBac1 and pcDNA3.1 (+) Constructs

Using standard cloning techniques (Sambrooke et al., Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989) four clones representing the SPDV structural region have been created in the vectorpFastBac1 (Gibco BRL) for expression in the baculovirus system. These clones have also been created in the expression vector pcDNA3.1 (Invitrogen) for monoclonal antibody characterisation and use as a DNA vaccine. Details of how these clones have beenproduced are as follows:

Clone 1.

p130 encodes the complete structural gene region from the 1st ATG of the capsid protein to the poly(A) tract (3944nt). cDNA was produced from viral RNA by RT-PCR using the following primers:

TABLE-US-00001 5' forward primer (5'130Not1): 5'-TGC ATG CGG CCG CAT GTT (SEQ ID NO 9) TCC CAT GCA ATT CAC CAA C-3' 3' inverse primer (3'130Not1) (sequence 5' to 3'): 5'-TGC ATG CGG CCG CTT GTA (SEQ ID NO 10) TTG AAA ATT TTA AAA CCA A-3'

These primers contain a 5 nucleotide stretch (ensures restriction enzyme recognition) followed by a Not1 site then the appropriate SPDV sequence (highlighted in the attached sequence, from 1222 to 1245 for 5'130Not1 and from 5143 to 5166 for3'130Not1). The 3944nt cDNA product was cloned into the Not1 site in both pFastBac1 and pcDNA3.1.

Clone 2.

p98 encodes for E3, E2, 6K and E1 to the poly(A) tract (3098nt). cDNA was produced from viral RNA by RT-PCR using the following primers:

TABLE-US-00002 5' forward primer (5'E3Not1): 5'-TGC ATG CGG CCG CAT GAC ACG (SEQ ID NO 11) CGC TCC GGC CCT CCT G-3' 3' inverse primer (3'130Not1): 5'-TGC ATG CGG CCG CTT GTA TTG (SEQ ID NO 10) AAA ATT TTA AAA CCA A-3'

The primer 5'E3Not1 contains a 5 nucleotide stretch (ensures restriction enzyme recognition) followed by a Not1 site, an ATG (artificial start codon) then the appropriate SPDV sequence (from 2067 to 2088) The primer 3'130Not1 is as describedabove in Clone1. The 3098nt cDNA product was cloned into the Not1 site in both pFastBac1 and pcDNA3.1.

Clone 3.

pE2 encoding the E3 and E2 glycoproteins (1527nt). cDNA was produced from viral RNA by RT-PCR using the following primers:

TABLE-US-00003 5' forward primer (5'E3Not1): 5'-TGC ATG CGG CCG CAT GAC ACG (SEQ ID NO 11) CGC TCC GGC CCT CCT G-3' 3' inverse primer (3'E2Not1): 5'-TGC ATG CGG CCG CTC ACG CGC (SEQ ID NO 12) GAG CCC CTG GTA TGC AAC A-3'

The primer 5'E3Not1 is as described above in Clone2. The primer 3'E2Not1 contains a 5 nucleotide stretch (ensures restriction enzyme recognition) followed by a Not1 site, a TGA (artificial stop codon) then the appropriate SPDV sequence(highlighted in the attached sequence, from 3571 to 3594). The 1527nt cDNA product was cloned into the Not1 site in both pFastBac1 and pcDNA3.1.

Clone 4.

E2 encoding the E2 glycoprotein (1314nt). cDNA was produced from viral RNA by RT-PCR using the following primers:

TABLE-US-00004 5' forward primer (5'E2Not1): 5'-TGC ATG CGG CCG CAT GGC TGT (SEQ ID NO 13) GTC TAC GTC GCC TGC C-3' 3' inverse primer (3'E2Not1): 5'-TGC ATG CGG CCG CTC ACG CGC (SEQ ID NO 12) GAG CCC CTG GTA TGC AAC A-3'.

The primer 5'E2Not1 contains a 5 nucleotide stretch (ensures restriction enzyme recognition) followed by a Not1 site, an ATG (artificial start codon) then the appropriate SPDV sequence (from 2281 to 2301). The primer 3'E2Not1 is as describedabove in Clone 3. The 1314nt cDNA product was cloned into the Not1 site in both pFastBac1 and pcDNA3.1.

Insect cells (SF-9)were infected with the four recombinant baculovirus constructs. Using monoclonals that were raised against whole-inactivated PD virus, an IFT staining was performed on these recombinant baculovirus infected SF-9 cells. Allproduced proteins reacted positively with the monoclonals, indicating that the recombinant proteins possess the wild-type epitopes.

Challenge Experiments

The proteins produced by all four constructs were collected using Triton extraction. The proteins were BPL inactivated to prevent possible spread of surviving recombinant baculoviruses in the environment. The proteins were formulated intowater-in-oil based vaccine formulations and injected in a 0.2 ml vaccine volume

ELISA analysis using anti-PD-E2 monoclonals (2D9 capture and 7A2) showed that the amount of reactive epitopes per dose recombinant vaccine was comparable or even higher than the amount of epitopes found in a dose of the conventional inactivatedPD virus vaccine. A standardized challenge experiment performed at 8 weeks post-vaccination in Atlantic salmon fish showed that protection against challenge with salmon PD virus could be obtained with these recombinant sub-unit vaccines. In theexperiment, 20 lesions in pancreas, skeletal muscle and heart muscle were scored in ordinary way. Significant levels were calculated from Kruskal-Wallis one-way analysis of variance (non-parametric test). The vaccine formulation comprising the E2 orE2-E3 proteins gave similar levels of protection as obtained by the inactivated PD virus vaccine, while vaccines containing the recombinant proteins resulting from the p130 and p98 constructs respectively were less protective then the inactivated PDvirus vaccine.

Production of Antibodies.

DNA vaccination with proteins obtained from expression of the p130 nucleotide construct was carried out in mice to test for the antigenic properties of the recombinant proteins. After two intramuscular inoculations with p130-pcDNA3.1 recombinantexpression plasmids (see clone 1), the sera of mice showed an antibody reaction with in vitro produced PD virus.

>

79 DNA Salmon pancreatic disease virus tggac tcagcggcaa tgaacgtgga ggcttttaaa agtttcgcctgtaaggacac 6tgtgg actgagttcg cggaaaaacc agtaaggttg tcgcccggcc aaatcgaaga tgtcttt catctacaag gggccaaggc caatgtgatg cacagcagag tcgaagccgt ccctgac ctctcggagg tggctatgga caggttcaca ctagacatga aacgcgacgt 24tgacg ccaggcacgaagcacgtaga ggagagacct aaagtccaag agattcaagc 3gacccc atggccaccg cgtacttgtg cgccatccat agagagctag tccgaaggct 36ccgtc ctgaaaccgt ctatacacgt gttgttcgat atgagctccg aggattttga 42tcgtg ggccatggga tgaagttggg tgacaaggtg ctggaaacgg acatctcctc48acaag agccaggacc aagccatggc ggttacagcg ctgatgctgc tgagggactt 54tagaa gaagacctcc tgaccctaat tgaggcgtct ttcggcgaca tcacttctgc 6ctgccc acaggcacca gatttcagtt tggatcgatg atgaagtctg gactttttct 66tgttc gtgaacacgc tgcttaacatcaccatagct gcccgagttt tacgggagca 72ctgat accaggtgtg ccgcgtttat cggtgacgac aacgtaatca ccggagtagt 78acgac atgatggtgg ccaggtgcgc atcctggctg aacatggagg tgaagatcat 84tggaa attggcaaca tgagtcctta tttttgtggc ggcttcctgt tactcgacac 9acaggc actgtaagcc gagtgtcgga ccctgtaaaa cgcctgatga agatgggaaa 96ccctg aacgatccag aaacggacgt ggacagatgc cgcgcactgc gcgaagaagt aaagctgg tacagagtgg ggattcagtg gccactgcag gtggctgccg ccacacgcta gcgtgaac cacctgccgc tggccacaatggcgatggcc acgctcgccc aggacttgag cgtacctg ggcgcgcgag gggagtacgt atccctctac gtctaacctt aatattttct atcatact tccaaacaat catgtttccc atgcaattca ccaactcagc ctatcgccag ggagccca tgtttgcacc gggttcccga ggacaagtac agccgtaccg gccgcgcact gcgccgcc aggagccgca agtcggcaac gccgccatta ctgccctcgc gaaccagatg tgcgctcc agttgcaggt agctggactt gccggccagg caagggtgga ccgccgtggg aagacgtg ttcagaagaa caagcagaag aagaagaact cttccaacgg agaaaaaccc agagaaga agaagaagca aaaacaacaggagaagaagg gaagcggtgg cgaaaaagtc gaagacta ggaaccgacc cgggaaggag gtaaggatct ccgtaaagtg tgcccgacag caccttcc ccgtgtacca cgaaggtgct atatccggct acgctgtgct gattggatct cgtattca agccggcaca cgtgaagggt aagatcgacc accctgaact ggcagacatc gttccagg tcgccgagga catggacctc gaagcagctg cgtacccgaa gagcatgcga ccaagcgg ctgaaccagc gaccatgatg gacagagtgt acaactggga gtatggcact cagagtgg aggataatgt cataatcgac gcaagcggta ggggcaagcc gggtgacagt cagggcca tcaccgacaa ctcgggaaaggttgttggta ttgtcctcgg aggaggaccc tggcaggc gcacacgcct ctccgtgata ggtttcgaca agaagatgaa ggctagggag 2gcctaca gtgatgccat accttggaca cgcgctccgg ccctcctgct gctgcctatg 2attgtct gcacctacaa ttccaacacc ttcgattgct ccaaaccgtc ctgccaggac 2tgcatta ctgctgaacc agagaaggcc atgaccatgc tgaaggacaa tctgaacgac 222ctact gggacctact cattgctgtc accacctgtg gctccgcccg gagaaagagg 228gtcta cgtcgcctgc cgccttttac gacacacaga tcctcgccgc ccacgcagct 234cccat acagggcgta ctgccccgattgtgacggaa cagcgtgtat ctcgccgata 24tcgacg aggtggtgag cagtggcagc gaccacgtcc tccgcatgcg ggttggttct 246gggag tgaccgctaa gggtggtgcg gcgggtgaga cctctctgcg atacctggga 252cggga aggttcacgc cgcagacaac acgcgactcg tggtgcgcac gactgcaaag 258cgtgc tgcaggccac tggccactac atcctggcca actgcccagt ggggcagagc 264cgttg cggccacact ggatggcacc cggcatcaat gcaccacggt tttcgaacac 27taacgg agaagttcac cagagaacgc agcaagggcc accatctgtc cgacatgacc 276atgca ccagattttc cactacaccaaaaaagtccg ccctctacct cgttgatgtg 282cgctc tgccgatttc tgtagagatt agcaccgtcg taacatgcag cgacagccag 288agtga gggtgccacc tggtaccaca gtgaaattcg acaagaaatg caagagcgct 294ggcaa ccgtcacttt caccagcgac tcccagacgt ttacgtgtga ggagccagtc 3acggctg ccagtatcac ccagggcaag ccacacctca gatcggcaat gttgcctagc 3ggcaagg aagtgaaagc aaggatcccg ttcccgttcc cgccggaaac cgcaacttgc 3gtgagtg tagccccact gccgtcgatc acctacgagg aaagcgatgt cctgctagcc 3accgcaa aataccctgt gctgctaaccacacggaacc ttggtttcca tagcaacgcc 324cgaat ggatccaggg caagtacctg cgccgcatcc cggtcacgcc tcaagggatc 33taacat ggggaaacaa cgcgccgatg cacttttggt catccgtcag gtacgcatcc 336cgctg atgcgtaccc ctgggaactt ctggtgtacc acaccaagca ccatccagag 342gtggg cgtttgtagg agttgcatgc ggcctgctgg ctatcgcagc gtgcatgttt 348cgcat gcagcagggt gcggtactct ctggtcgcca acacgttcaa ctcgaaccca 354attga ccgcactgac tgcagcactg tgttgcatac caggggctcg cgcggaccaa 36acttgg acatcattgc ctactttttaggggtaagag ggtggtcagc cctgctggtc 366tgcgt atgtacagag ctgcaagagc tacgaacaca ccgtggtggt cccaatggat 372agccc cgtcgtacga agcagtgata aaccggaatg ggtatgatcc attgaagctg 378ctcag tgaatttcac cgtcatctca ccaactacgg ctctggaata ttggacctgc 384agtcc ccatcgtcga gccgccccat gtgggctgct gcacgtcggt gtcctgcccc 39acctct ctacgctgca tgcgtttact ggcaaagctg tctccgacgt gcactgcgat 396cacaa acgtgtaccc cttgttgtgg ggcgcggctc actgcttctg ttccaccgag 4acacagg tcagcgctgt ggcagccaccgtttctgagt tctgtgccca ggactcagag 4gccgaag cgttcagcgt acacagcagc tcagtcaccg ctgaggtcct ggtgacgctt 4gaagtgg tgacggcagt ccacgtttac gtggacgggg taacatcagc caggggcact 42tcaaga tcgtggctgg accaataaca accgactact ccccattcga tcgcaaagta 426catcg gcgaagaggt ctataactat gactggcctc cttacggggc tggccgacca 432attcg gagacattca agctaggtca accaactatg tcaaacccaa cgatctgtat 438catcg gaattgaagt actgcagccg actaacgacc acgtacatgt ggcttacacg 444gacct ctgggttact gcgttggctgcaggacgctc cgaaaccact cagtgtcaca 45cgcacg gttgtaagat cagtgccaat ccgctcctgg ccctcgattg tggggttggt 456cccca tgtccatcaa cattccggac gcgaagttta cccgcaaatt aaaggatccg 462atcgg ccctgaaatg cgtggtggac agctgcgagt acggggtgga ctacgggggc 468cacga tcacctacga gggccacgag gccgggaagt gcgggattca ttccctgaca 474agtcc ccctgagaac atcggtggtt gaagtggttg ctggcgccaa taccgtcaaa 48ccttct cctcacccac gcccgaggtt gcactcgagg tagagatctg ttcggcaata 486gtgcg ctggtgagtg cactccaccgaaggaacatg tggtcgcaac caggcctcgc 492cagcg accctggagg ctacatctcc gggcccgcaa tgcgctgggc cggagggatt 498gaccc tagtggtcct gttccttatc cttgccgtca tctactgcgt ggtgaagaag 5cgctcca aaagaatccg gatagtcaag agctaaattc cggtatacaa attgctcact 5agcccat ccgatcccac agggagtagg atgagtcatc tattggtttt aaaattttca 5caaaaaa aaaaaaaaa 594 PRT Salmon pancreatic disease virus NSP4 (C-terminal region) 2 Thr Met Asp Ser Ala Ala Met Asn Val Glu Ala Phe Lys Ser Phe Ala Lys AspThr Asp Leu Trp Thr Glu Phe Ala Glu Lys Pro Val Arg 2 Leu Ser Pro Gly Gln Ile Glu Glu Tyr Val Phe His Leu Gln Gly Ala 35 4s Ala Asn Val Met His Ser Arg Val Glu Ala Val Cys Pro Asp Leu 5 Ser Glu Val Ala Met Asp Arg Phe Thr Leu Asp MetLys Arg Asp Val 65 7 Lys Val Thr Pro Gly Thr Lys His Val Glu Glu Arg Pro Lys Val Gln 85 9u Ile Gln Ala Ala Asp Pro Met Ala Thr Ala Tyr Leu Cys Ala Ile Arg Glu Leu Val Arg Arg Leu Lys Ala Val Leu Lys Pro Ser Ile Val Leu Phe Asp Met Ser Ser Glu Asp Phe Asp Ala Ile Val Gly Gly Met Lys Leu Gly Asp Lys Val Leu Glu Thr Asp Ile Ser Ser Phe Asp Lys Ser Gln Asp Gln Ala Met Ala Val Thr Ala Leu Met Leu Arg Asp Leu GlyVal Glu Glu Asp Leu Leu Thr Leu Ile Glu Ala Phe Gly Asp Ile Thr Ser Ala His Leu Pro Thr Gly Thr Arg Phe 2Phe Gly Ser Met Met Lys Ser Gly Leu Phe Leu Thr Leu Phe Val 222hr Leu Leu Asn Ile Thr Ile Ala Ala ArgVal Leu Arg Glu Gln 225 234la Asp Thr Arg Cys Ala Ala Phe Ile Gly Asp Asp Asn Val Ile 245 25hr Gly Val Val Ser Asp Asp Met Met Val Ala Arg Cys Ala Ser Trp 267sn Met Glu Val Lys Ile Met Asp Met Glu Ile Gly Asn Met Ser275 28ro Tyr Phe Cys Gly Gly Phe Leu Leu Leu Asp Thr Val Thr Gly Thr 29Ser Arg Val Ser Asp Pro Val Lys Arg Leu Met Lys Met Gly Lys 33Pro Ala Leu Asn Asp Pro Glu Thr Asp Val Asp Arg Cys Arg Ala Leu 325 33rg GluGlu Val Glu Ser Trp Tyr Arg Val Gly Ile Gln Trp Pro Leu 345al Ala Ala Ala Thr Arg Tyr Gly Val Asn His Leu Pro Leu Ala 355 36hr Met Ala Met Ala Thr Leu Ala Gln Asp Leu Arg Ser Tyr Leu Gly 378rg Gly Glu Tyr Val Ser LeuTyr Val 385 399 PRT Salmon pancreatic disease virus pet Pro Arg Thr Ala Arg Arg Ser Gly Lys Leu Val Gln Ser Gly Asp Val Ala Thr Ala Gly Gly Cys Arg His Thr Leu Trp Arg Glu Pro 2 Pro Ala Ala Gly His Asn Gly Asp Gly HisAla Arg Pro Gly Leu Glu 35 4e Val Pro Gly Arg Ala Arg Gly Val Arg Ile Pro Leu Arg Leu Thr 5 Leu Ile Phe Ser Ala Ser Tyr Phe Gln Thr Ile Met Phe Pro Met Gln 65 7 Phe Thr Asn Ser Ala Tyr Arg Gln Met Glu Pro Met Phe Ala Pro Gly 85 9r Arg Gly Gln Val Gln Pro Tyr Arg Pro Arg Thr Lys Arg Arg Gln Pro Gln Val Gly Asn Ala Ala Ile Thr Ala Leu Ala Asn Gln Met Ala Leu Gln Leu Gln Val Ala Gly Leu Ala Gly Gln Ala Arg Val Arg Arg Gly Pro ArgArg Val Gln Lys Asn Lys Gln Lys Lys Lys Asn Ser Ser Asn Gly Glu Lys Pro Lys Glu Lys Lys Lys Lys Gln Lys Gln Glu Lys Lys Gly Ser Gly Gly Glu Lys Val Lys Lys Thr Arg Arg Pro Gly Lys Glu Val Arg Ile Ser ValLys Cys Ala Arg Gln 2Thr Phe Pro Val Tyr His Glu Gly Ala Ile Ser Gly Tyr Ala Val 222le Gly Ser Arg Val Phe Lys Pro Ala His Val Lys Gly Lys Ile 225 234is Pro Glu Leu Ala Asp Ile Lys Phe Gln Val Ala Glu Asp Met245 25sp Leu Glu Ala Ala Ala Tyr Pro Lys Ser Met Arg Asp Gln Ala Ala 267ro Ala Thr Met Met Asp Arg Val Tyr Asn Trp Glu Tyr Gly Thr 275 28le Arg Val Glu Asp Asn Val Ile Ile Asp Ala Ser Gly Arg Gly Lys 29Gly AspSer Gly Arg Ala Ile Thr Asp Asn Ser Gly Lys Val Val 33Gly Ile Val Leu Gly Gly Gly Pro Asp Gly Arg Arg Thr Arg Leu Ser 325 33al Ile Gly Phe Asp Lys Lys Met Lys Ala Arg Glu Ile Ala Tyr Ser 345la Ile Pro Trp Thr Arg AlaPro Ala Leu Leu Leu Leu Pro Met 355 36al Ile Val Cys Thr Tyr Asn Ser Asn Thr Phe Asp Cys Ser Lys Pro 378ys Gln Asp Cys Cys Ile Thr Ala Glu Pro Glu Lys Ala Met Thr 385 39Leu Lys Asp Asn Leu Asn Asp Pro Asn Tyr Trp AspLeu Leu Ile 44Val Thr Thr Cys Gly Ser Ala Arg Arg Lys Arg Ala Val Ser Thr 423ro Ala Ala Phe Tyr Asp Thr Gln Ile Leu Ala Ala His Ala Ala 435 44la Ser Pro Tyr Arg Ala Tyr Cys Pro Asp Cys Asp Gly Thr Ala Cys 456er Pro Ile Ala Ile Asp Glu Val Val Ser Ser Gly Ser Asp His 465 478eu Arg Met Arg Val Gly Ser Gln Ser Gly Val Thr Ala Lys Gly 485 49ly Ala Ala Gly Glu Thr Ser Leu Arg Tyr Leu Gly Arg Asp Gly Lys 55His Ala Ala AspAsn Thr Arg Leu Val Val Arg Thr Thr Ala Lys 5525 Cys Asp Val Leu Gln Ala Thr Gly His Tyr Ile Leu Ala Asn Cys Pro 534ly Gln Ser Leu Thr Val Ala Ala Thr Leu Asp Gly Thr Arg His 545 556ys Thr Thr Val Phe Glu His Gln ValThr Glu Lys Phe Thr Arg 565 57lu Arg Ser Lys Gly His His Leu Ser Asp Met Thr Lys Lys Cys Thr 589he Ser Thr Thr Pro Lys Lys Ser Ala Leu Tyr Leu Val Asp Val 595 6Tyr Asp Ala Leu Pro Ile Ser Val Glu Ile Ser Thr Val Val Thr Cys662sp Ser Gln Cys Thr Val Arg Val Pro Pro Gly Thr Thr Val Lys 625 634sp Lys Lys Cys Lys Ser Ala Asp Ser Ala Thr Val Thr Phe Thr 645 65er Asp Ser Gln Thr Phe Thr Cys Glu Glu Pro Val Leu Thr Ala Ala 667leThr Gln Gly Lys Pro His Leu Arg Ser Ala Met Leu Pro Ser 675 68ly Gly Lys Glu Val Lys Ala Arg Ile Pro Phe Pro Phe Pro Pro Glu 69Ala Thr Cys Arg Val Ser Val Ala Pro Leu Pro Ser Ile Thr Tyr 77Glu Glu Ser Asp Val Leu LeuAla Gly Thr Ala Lys Tyr Pro Val Leu 725 73eu Thr Thr Arg Asn Leu Gly Phe His Ser Asn Ala Thr Ser Glu Trp 745ln Gly Lys Tyr Leu Arg Arg Ile Pro Val Thr Pro Gln Gly Ile 755 76lu Leu Thr Trp Gly Asn Asn Ala Pro Met His Phe TrpSer Ser Val 778yr Ala Ser Gly Asp Ala Asp Ala Tyr Pro Trp Glu Leu Leu Val 785 79His Thr Lys His His Pro Glu Tyr Ala Trp Ala Phe Val Gly Val 88Cys Gly Leu Leu Ala Ile Ala Ala Cys Met Phe Ala Cys Ala Cys 823rg Val Arg Tyr Ser Leu Val Ala Asn Thr Phe Asn Ser Asn Pro 835 84ro Pro Leu Thr Ala Leu Thr Ala Ala Leu Cys Cys Ile Pro Gly Ala 856la Asp Gln Pro Tyr Leu Asp Ile Ile Ala Tyr Phe Leu Gly Val 865 878ly Trp SerAla Leu Leu Val Ile Leu Ala Tyr Val Gln Ser Cys 885 89ys Ser Tyr Glu His Thr Val Val Val Pro Met Asp Pro Arg Ala Pro 99Tyr Glu Ala Val Ile Asn Arg Asn Gly Tyr Asp Pro Leu Lys Leu 9925 Thr Ile Ser Val Asn Phe Thr Val Ile SerPro Thr Thr Ala Leu Glu 934rp Thr Cys Ala Gly Val Pro Ile Val Glu Pro Pro His Val Gly 945 956ys Thr Ser Val Ser Cys Pro Ser Asp Leu Ser Thr Leu His Ala 965 97he Thr Gly Lys Ala Val Ser Asp Val His Cys Asp Val His ThrAsn 989yr Pro Leu Leu Trp Gly Ala Ala His Cys Phe Cys Ser Thr Glu 995 Thr Gln Val Ser Ala Val Ala Ala Thr Val Ser Glu Phe Cys Ala Gln Asp Ser Glu Arg Ala Glu Ala Phe Ser Val His Ser Ser Ser Val 3r Ala Glu Val Leu Val Thr Leu Gly Glu Val Val Thr Ala Val His 5Val Tyr Val Asp Gly Val Thr Ser Ala Arg Gly Thr Asp Leu Lys Ile 65 l Ala Gly Pro Ile Thr Thr Asp Tyr Ser Pro Phe Asp Arg Lys Val 8Val Arg IleGly Glu Glu Val Tyr Asn Tyr Asp Trp Pro Pro Tyr Gly 95 a Gly Arg Pro Gly Thr Phe Gly Asp Ile Gln Ala Arg Ser Thr Asn r Val Lys Pro Asn Asp Leu Tyr Gly Asp Ile Gly Ile Glu Val Leu 3Gln Pro Thr Asn Asp HisVal His Val Ala Tyr Thr Tyr Thr Thr Ser 45 y Leu Leu Arg Trp Leu Gln Asp Ala Pro Lys Pro Leu Ser Val Thr 6Ala Pro His Gly Cys Lys Ile Ser Ala Asn Pro Leu Leu Ala Leu Asp 75

s Gly Val Gly Ala Val Pro Met Ser Ile Asn Ile Pro Asp Ala Lys 9e Thr Arg Lys Leu Lys Asp Pro Lys Pro Ser Ala Leu Lys Cys Val Val Asp Ser Cys Glu Tyr Gly Val Asp Tyr Gly Gly Ala Ala Thr Ile 25r Tyr Glu Gly His Glu Ala Gly Lys Cys Gly Ile His Ser Leu Thr 4Pro Gly Val Pro Leu Arg Thr Ser Val Val Glu Val Val Ala Gly Ala 55 n Thr Val Lys Thr Thr Phe Ser Ser Pro Thr Pro Glu Val Ala Leu 7u ValGlu Ile Cys Ser Ala Ile Val Lys Cys Ala Gly Glu Cys Thr 9Pro Pro Lys Glu His Val Val Ala Thr Arg Pro Arg His Gly Ser Asp Pro Gly Gly Tyr Ile Ser Gly Pro Ala Met Arg Trp Ala Gly Gly Ile 2Val Gly Thr Leu Val ValLeu Phe Leu Ile Leu Ala Val Ile Tyr Cys 35 l Val Lys Lys Cys Arg Ser Lys Arg Ile Arg Ile Val Lys Ser 54 282 PRT Salmon pancreatic disease virus capsid 4 Met Phe Pro Met Gln Phe Thr Asn Ser Ala Tyr Arg Gln Met Glu Pro Phe Ala Pro Gly Ser Arg Gly Gln Val Gln Pro Tyr Arg Pro Arg 2 Thr Lys Arg Arg Gln Glu Pro Gln Val Gly Asn Ala Ala Ile Thr Ala 35 4u Ala Asn Gln Met Ser Ala Leu Gln Leu Gln Val Ala Gly Leu Ala 5 Gly Gln Ala Arg Val Asp Arg Arg GlyPro Arg Arg Val Gln Lys Asn 65 7 Lys Gln Lys Lys Lys Asn Ser Ser Asn Gly Glu Lys Pro Lys Glu Lys 85 9s Lys Lys Gln Lys Gln Gln Glu Lys Lys Gly Ser Gly Gly Glu Lys Lys Lys Thr Arg Asn Arg Pro Gly Lys Glu Val Arg Ile Ser Val Cys Ala Arg Gln Ser Thr Phe Pro Val Tyr His Glu Gly Ala Ile Gly Tyr Ala Val Leu Ile Gly Ser Arg Val Phe Lys Pro Ala His Val Lys Gly Lys Ile Asp His Pro Glu Leu Ala Asp Ile Lys Phe Gln AlaGlu Asp Met Asp Leu Glu Ala Ala Ala Tyr Pro Lys Ser Met Asp Gln Ala Ala Glu Pro Ala Thr Met Met Asp Arg Val Tyr Asn 2Glu Tyr Gly Thr Ile Arg Val Glu Asp Asn Val Ile Ile Asp Ala 222ly Arg Gly Lys Pro Gly AspSer Gly Arg Ala Ile Thr Asp Asn 225 234ly Lys Val Val Gly Ile Val Leu Gly Gly Gly Pro Asp Gly Arg 245 25rg Thr Arg Leu Ser Val Ile Gly Phe Asp Lys Lys Met Lys Ala Arg 267le Ala Tyr Ser Asp Ala Ile Pro Trp 275 28PRT Salmon pancreatic disease virus E3 5 Thr Arg Ala Pro Ala Leu Leu Leu Leu Pro Met Val Ile Val Cys Thr Asn Ser Asn Thr Phe Asp Cys Ser Lys Pro Ser Cys Gln Asp Cys 2 Cys Ile Thr Ala Glu Pro Glu Lys Ala Met Thr Met Leu Lys Asp Asn 354u Asn Asp Pro Asn Tyr Trp Asp Leu Leu Ile Ala Val Thr Thr Cys 5 Gly Ser Ala Arg Arg Lys Arg 65 7 PRT Salmon pancreatic disease virus E2 6 Ala Val Ser Thr Ser Pro Ala Ala Phe Tyr Asp Thr Gln Ile Leu Ala His Ala Ala AlaSer Pro Tyr Arg Ala Tyr Cys Pro Asp Cys Asp 2 Gly Thr Ala Cys Ile Ser Pro Ile Ala Ile Asp Glu Val Val Ser Ser 35 4y Ser Asp His Val Leu Arg Met Arg Val Gly Ser Gln Ser Gly Val 5 Thr Ala Lys Gly Gly Ala Ala Gly Glu Thr Ser Leu Arg TyrLeu Gly 65 7 Arg Asp Gly Lys Val His Ala Ala Asp Asn Thr Arg Leu Val Val Arg 85 9r Thr Ala Lys Cys Asp Val Leu Gln Ala Thr Gly His Tyr Ile Leu Asn Cys Pro Val Gly Gln Ser Leu Thr Val Ala Ala Thr Leu Asp ThrArg His Gln Cys Thr Thr Val Phe Glu His Gln Val Thr Glu Phe Thr Arg Glu Arg Ser Lys Gly His His Leu Ser Asp Met Thr Lys Lys Cys Thr Arg Phe Ser Thr Thr Pro Lys Lys Ser Ala Leu Tyr Val Asp Val Tyr Asp AlaLeu Pro Ile Ser Val Glu Ile Ser Thr Val Thr Cys Ser Asp Ser Gln Cys Thr Val Arg Val Pro Pro Gly 2Thr Val Lys Phe Asp Lys Lys Cys Lys Ser Ala Asp Ser Ala Thr 222hr Phe Thr Ser Asp Ser Gln Thr Phe Thr Cys GluGlu Pro Val 225 234hr Ala Ala Ser Ile Thr Gln Gly Lys Pro His Leu Arg Ser Ala 245 25et Leu Pro Ser Gly Gly Lys Glu Val Lys Ala Arg Ile Pro Phe Pro 267ro Pro Glu Thr Ala Thr Cys Arg Val Ser Val Ala Pro Leu Pro 275 28er Ile Thr Tyr Glu Glu Ser Asp Val Leu Leu Ala Gly Thr Ala Lys 29Pro Val Leu Leu Thr Thr Arg Asn Leu Gly Phe His Ser Asn Ala 33Thr Ser Glu Trp Ile Gln Gly Lys Tyr Leu Arg Arg Ile Pro Val Thr 325 33ro Gln Gly IleGlu Leu Thr Trp Gly Asn Asn Ala Pro Met His Phe 345er Ser Val Arg Tyr Ala Ser Gly Asp Ala Asp Ala Tyr Pro Trp 355 36lu Leu Leu Val Tyr His Thr Lys His His Pro Glu Tyr Ala Trp Ala 378al Gly Val Ala Cys Gly Leu Leu AlaIle Ala Ala Cys Met Phe 385 39Cys Ala Cys Ser Arg Val Arg Tyr Ser Leu Val Ala Asn Thr Phe 44Ser Asn Pro Pro Pro Leu Thr Ala Leu Thr Ala Ala Leu Cys Cys 423ro Gly Ala Arg Ala 435 7 32 PRT Salmon pancreatic diseasevirus 6K 7 Asp Gln Pro Tyr Leu Asp Ile Ile Ala Tyr Phe Leu Gly Val Arg Gly Ser Ala Leu Leu Val Ile Leu Ala Tyr Val Gln Ser Cys Lys Ser 2 8 46almon pancreatic disease virus E Glu His Thr Val Val Val Pro Met Asp Pro ArgAla Pro Ser Tyr Ala Val Ile Asn Arg Asn Gly Tyr Asp Pro Leu Lys Leu Thr Ile 2 Ser Val Asn Phe Thr Val Ile Ser Pro Thr Thr Ala Leu Glu Tyr Trp 35 4r Cys Ala Gly Val Pro Ile Val Glu Pro Pro His Val Gly Cys Cys 5 Thr SerVal Ser Cys Pro Ser Asp Leu Ser Thr Leu His Ala Phe Thr 65 7 Gly Lys Ala Val Ser Asp Val His Cys Asp Val His Thr Asn Val Tyr 85 9o Leu Leu Trp Gly Ala Ala His Cys Phe Cys Ser Thr Glu Asn Thr Val Ser Ala Val Ala Ala Thr ValSer Glu Phe Cys Ala Gln Asp Glu Arg Ala Glu Ala Phe Ser Val His Ser Ser Ser Val Thr Ala Val Leu Val Thr Leu Gly Glu Val Val Thr Ala Val His Val Tyr Val Asp Gly Val Thr Ser Ala Arg Gly Thr Asp Leu Lys IleVal Ala Pro Ile Thr Thr Asp Tyr Ser Pro Phe Asp Arg Lys Val Val Arg Gly Glu Glu Val Tyr Asn Tyr Asp Trp Pro Pro Tyr Gly Ala Gly 2Pro Gly Thr Phe Gly Asp Ile Gln Ala Arg Ser Thr Asn Tyr Val 222ro Asn Asp Leu Tyr Gly Asp Ile Gly Ile Glu Val Leu Gln Pro 225 234sn Asp His Val His Val Ala Tyr Thr Tyr Thr Thr Ser Gly Leu 245 25eu Arg Trp Leu Gln Asp Ala Pro Lys Pro Leu Ser Val Thr Ala Pro 267ly Cys Lys Ile SerAla Asn Pro Leu Leu Ala Leu Asp Cys Gly 275 28al Gly Ala Val Pro Met Ser Ile Asn Ile Pro Asp Ala Lys Phe Thr 29Lys Leu Lys Asp Pro Lys Pro Ser Ala Leu Lys Cys Val Val Asp 33Ser Cys Glu Tyr Gly Val Asp Tyr Gly Gly AlaAla Thr Ile Thr Tyr 325 33lu Gly His Glu Ala Gly Lys Cys Gly Ile His Ser Leu Thr Pro Gly 345ro Leu Arg Thr Ser Val Val Glu Val Val Ala Gly Ala Asn Thr 355 36al Lys Thr Thr Phe Ser Ser Pro Thr Pro Glu Val Ala Leu Glu Val 378le Cys Ser Ala Ile Val Lys Cys Ala Gly Glu Cys Thr Pro Pro 385 39Glu His Val Val Ala Thr Arg Pro Arg His Gly Ser Asp Pro Gly 44Tyr Ile Ser Gly Pro Ala Met Arg Trp Ala Gly Gly Ile Val Gly 423eu ValVal Leu Phe Leu Ile Leu Ala Val Ile Tyr Cys Val Val 435 44ys Lys Cys Arg Ser Lys Arg Ile Arg Ile Val Lys Ser 456DNA Artificial Sequence Description of Artificial Sequence primer 9 tgcatgcggc cgcatgtttc ccatgcaatt caccaac 37 NAArtificial Sequence Description of Artificial Sequence primer tgcggc cgcttgtatt gaaaatttta aaaccaa 37 NA Artificial Sequence Description of Artificial Sequence primer tgcggc cgcatgacac gcgctccggc cctcctg 37 NA ArtificialSequence Description of Artificial Sequence primer tgcggc cgctcacgcg cgagcccctg gtatgcaaca 4 DNA Artificial Sequence Description of Artificial Sequence primer tgcggc cgcatggctg tgtctacgtc gcctgcc 37 DNA Salmon pancreaticdisease virus CDS (4) 6K caa ccc tac ttg gac atc att gcc tac ttg tgg acc aac agc aaa 48 Asp Gln Pro Tyr Leu Asp Ile Ile Ala Tyr Leu Trp Thr Asn Ser Lys gcc ttc ggg cta caa ttt gcg gcg ccc gtg gcc tgt gtg ctc atc 96 Val Ala PheGly Leu Gln Phe Ala Ala Pro Val Ala Cys Val Leu Ile 2 att aca tac gcc ctt agg cac tgc aga ttg tgc tgc aag tct ttt tta Thr Tyr Ala Leu Arg His Cys Arg Leu Cys Cys Lys Ser Phe Leu 35 4g gta aga ggg tgg tca gcc ctg ctg gtc atc ctt gcgtat gta cag Val Arg Gly Trp Ser Ala Leu Leu Val Ile Leu Ala Tyr Val Gln 5 agc tgc aag agc 2Cys Lys Ser 65 RT Salmon pancreatic disease virus Gln Pro Tyr Leu Asp Ile Ile Ala Tyr Leu Trp Thr Asn Ser Lys AlaPhe Gly Leu Gln Phe Ala Ala Pro Val Ala Cys Val Leu Ile 2 Ile Thr Tyr Ala Leu Arg His Cys Arg Leu Cys Cys Lys Ser Phe Leu 35 4y Val Arg Gly Trp Ser Ala Leu Leu Val Ile Leu Ala Tyr Val Gln 5 Ser Cys Lys Ser 65

* * * * *