Register | Login | Help |
 
Bookmark

Title: 

Treatment of inflammation with p20



Patent ID: 

US7074399


Issue Date: 

July 11, 2006



Abstract:

The present invention provides compositions, methods, and kits for treating inflammation and regulating inflammatory responses including cytokine, prostanoid, prostaglandin, and growth factor expression.


Download PDF Powered by Patents.com   (Registration Required)

Inventor(s): 
Brigham;  Kenneth L.  (Nashville,  TN,  US) , Email and Contact Information
Stecenko;  Arlene A.  (Nashville,  TN,  US) , Email and Contact Information
Sealy;  Linda  (Brentwood,  TN,  US) Email and Contact Information
Assignee:  Vanderbilt University;  (Nashville,  TN,  US)
Agent:  Needle & Rosenberg PC
Application No.:  09/789,836
Filing Date:  February 20, 2001
Primary Class:  424/93.2
Other Classes:  435/320.1 
Field of Search:  514/44 435/69.1,455,456,320.1 424/93.2,93.21
Intern'l Class:  A01N 63/00 (20060101)  A61K 48/00 (20060101) 
Primary Examiner:Whiteman; Brian
US Patent Document(s):
  4937190    Palmenberg et al.    June 01, 1990
  5215892    Kishimoto et al.    June 01, 1993
  5360894    Kishimoto et al.    November 01, 1994
  5545563    Darlington et al.    August 01, 1996
  5804445    Brasier    September 01, 1998
  5830725    Nolan et al.    November 01, 1998
  5874209    Karin et al.    February 01, 1999
  6165720    Felgner et al.    December 01, 2000
Foreign Reference(s):
Other References:J Kuby, Immunology, WH Freeman and Company,2.sup.nd Ed., pp. 7-9,313-316,318 and 559-560. cited by examiner .
GM Rubanyi, Molecular Aspects of Medicine, "The future of human gene therapy," 2001, 22, pp. 113-142. cited by examiner .
WF Anderson, Nature, "Human gene therapy," Apr. 1998, vol. 392, pp. 25-30. cited by examiner .
IM Verma et al., Nature, "Gene therapy-promises, problems and prospects," Sep. 1997, vol. 389, pp. 239-242. cited by examiner .
Akira et al. EMBO J. 1990, 9:1897-1906. cited by examiner .
Chang et al. Mol Cell Biol. 1990, 10:6642-53). cited by examiner .
Poli et al. Cell, 63, 643-653, 1990. cited by examiner .
Croniger, et al.; C/EBP and the Control of Phosphoenolpyruvate; Journal of Biological Chemistry; Nov. 28, 1998; pp. 31629-31632; vol. 273:48; USA. cited by other .
Darlington, et al.; The Role of C/EBP Genes in Adipocyte Differentiation; Journal of Biological Chemistry; Nov. 13, 1998; pp. 30057-30060; vol. 273:46; USA. cited by other .
Diehl; Roles of CCAAT/Enhancer-binding Proteins in Regulation of Liver Regenerative Growth; Journal of Biological Chemistry; Nov. 20, 1998; pp. 30843-30846; vol. 273:46; USA. cited by other .
Hanson; Biological Role of the Isoforms of C/EBP Minireview Series; Journal of Biological Chemistry; Oct. 30, 1998; p. 28543; vol. 273:44; USA. cited by other .
Harris, et al.; C/EBP Cooperates with p21 to inhibit cdk2 kinase activity and induces growth arrest independent of DNA binding; JBC Papers in Press; May 21, 2001; pp. 1-41. cited by other .
Henderson, et al.; C/EBP Proteins Activate Transcription from the Human Immunodeficiency Virus Type I Long Terminal Repeat in Macrophages/Monocytes; Journal of Virology; Sep. 1995; pp. 5337-5344; vol. 69:9. cited by other .
Honda, et al.; Type I Interferon Induces Inhibitory 16-kD CCAAT/Enhancer Binding Protein (C/EBP).beta., Repressing the HIV-I Long Terminal Repeat in Macrophages: Pulmonary Tuberculosis Alters C/EBP Expression, Enhancing HIV-I Replication; J. Exp. Med.; Oct. 5, 1998; pp. 1255-1265; vol. 188:7. cited by other .
Kowenz-Leutz, et al.; A C/EBP.beta. Isoform Recruits the SWI/SNF Complex to Activate Myeloid Genes; Molecular Cell; Nov. 1999; pp. 735-743; vol. 4. cited by other .
Lekstrom-Himes, et. al.; Biological Role of the CCAAT/Enhancer-binding Protein Family of Transcription Factors; Journal of Biological Chemistry; Oct. 30, 1998; pp. 28545-28548; vol. 273:44; USA. cited by other .
Poli, Valeria; The Role of C/EBP Isoforms in the Control of Inflammatory and Native Immunity Functions; Journal of Biological Chemistry; Nov. 6, 1998; pp. 29279-29282; vol. 273:45; USA. cited by other.

Parent Case Text: RIGHT OF PRIORITY UNDER 37 U.S.C. .sctn. 119(e) The present application claims right of priority under 37 U.S.C. .sctn. 119(e) to the benefit of the earlier filing date for U.S. Provisional Application "Treatment of Inflammation with p20", Ser. No. 60/183,584, filed Feb. 18, 2000.


Claim(s):

What is claimed is:

1. A method of treating an inflammation in a lung of a mammal in need thereof, wherein the inflammation involves C/EBP.beta.-mediated transcription of a gene encoding aninflammatory mediator, comprising administering a therapeutically effective amount of an isolated nucleic acid including a sequence encoding a p20 polypeptide to a cell of the mammal and expressing the p20 polypeptide in the cell, wherein the p20polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 7, the amino acid sequence set forth in amino acid positions 152 to 296 of SEQ ID NO: 9, or the amino acid sequence set forth in amino acid positions 153 to 297 of SEQ ID NO: 11,thereby treating the inflammation in a lung of the mammal.

2. A method of treating an inflammation in a lung of a mammal in need thereof, wherein the inflammation involves C/EBP.beta.-mediated transcription of a gene encoding an inflammatory mediator, comprising administering a therapeuticallyeffective amount of the isolated nucleic acid including a sequence encoding a p20 polypeptide to an ex vivo cell from the mammal wherein the p20 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 7, the amino acid sequence set forth inamino acid positions 152 to 296 of SEQ ID NO: 9, or the amino acid sequence set forth in amino acid positions 153 to 297 of SEQ ID NO: 11 and administering the ex vivo cell to the mammal, thereby treating the inflammation in a lung of the mammal.

3. A method of treating an inflammation in a lung of a mammal in need thereof, wherein the inflammation involves C/EBP.beta.-mediated transcription of a gene encoding an inflammatory mediator, comprising: (a) mixing an isolated polynucleotideencoding a p20 polypeptide, wherein the p20 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 7, the amino acid sequence set forth in amino acid positions 152 to 296 of SEQ ID NO: 9, or the amino acid sequence set forth in amino acidpositions 153 to 297 of SEQ ID NO: 11, with a pharmaceutically acceptable carrier to form a pharmaceutical composition, wherein the polynucleotide is capable of expressing the p20 polypeptide in a cell that is from the mammal; and (b) administering atherapeutically effective amount of the mixture from step (a) to the mammal.

4. The method of claim 3, wherein the pharmaceutically acceptable carrier includes a liposome.

5. The method of claim 3, wherein the mixture of step (a) is administered to the mammal by removing a cell from the mammal, introducing the mixture to the cell and providing the cell to the mammal.

6. The method of claim 3, wherein the inflammation comprises a symptom of a disease selected from a group consisting of: adult respiratory distress syndrome, asthma, bronchitis, bronchopulmonary dysplasia, cystic fibrosis, extensive allergicalveolitis, idiopathic pulmonary fibrosis, interstitial lung disease, and respiratory viral infection.

7. The method of claim 3, wherein the p20 polypeptide includes the amino acid sequence as set forth in SEQ ID NO: 15 or the polynucleotide includes a segment encoding the amino acid sequence as set forth in SEQ ID NO: 15.

8. A method of treating inflammation in a lung caused or exacerbated by an increased activity of a pro-inflammatory mediator in a mammal in need thereof, wherein the disease involves C/EBP.beta.-mediated transcription of a gene encoding aninflammatory mediator, comprising administering, to a cell in a mammal, a therapeutically effective amount of an isolated polynucleotide encoding a p20 polypeptide, wherein the p20 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 7,the amino acid sequence set forth in amino acid positions 152 to 296 of SEQ ID NO: 9, or the amino acid sequence set forth in amino acid positions 153 to 297 of SEQ ID NO: 11.

9. A method of inhibiting expression of an inflammatory mediator in a cell in a lung of a mammal, wherein C/EBP.beta. mediates transcription of a gene encoding the inflammatory mediator, comprising administering to the cell, in an amounteffective to inhibit the expression of the inflammatory mediator, an isolated polynucleotide encoding a p20 polypeptide, wherein the p20 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 7, the amino acid sequence set forth in aminoacid positions 152 to 296 of SEQ ID NO: 9, or the amino acid sequence set forth in amino acid positions 153 to 297 of SEQ ID NO: 11.

10. A composition comprising: an expression vector including an expression insert and at least one genetic element operably linked to the insert, wherein the expression insert includes a region encoding a membrane transport sequence and apolynucleotide segment encoding a p20 polypeptide, wherein the p20 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 7, the amino acid sequence set forth in amino acid positions 152 to 296 of SEQ ID NO: 9, or the amino acid sequenceset forth in amino acid positions 153 to 297 of SEQ ID NO: 11.

11. The composition of claim 10, wherein the genetic element is selected from a group consisting of: a promoter, an internal ribosome entry site, a Kozak sequence, a translation initiation codon, an enhancer, and a polyadenylation signal.

12. The composition of claim 10, wherein the polynucleotide segment comprises SEQ ID NO:4.

13. The composition of claim 10, wherein the polynucleotide segment hybridizes to SEQ ID NO:4 or the complement of SEQ ID NO:4 under high stringency hybridization conditions.

14. A method of manufacturing a membrane transport sequence-p20 (MTS-p20) fusion polypeptide, comprising: a) providing an expression vector including an expression insert and at least one genetic element operably linked to the insert, whereinthe expression insert includes a region encoding a membrane transport sequence and a polynucleotide segment encoding a p20 polypeptide, wherein the p20 polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 7, the amino acid sequence setforth in amino acid positions 152 to 296 of SEQ ID NO: 9, or the amino acid sequence set forth in amino acid positions 153 to 297 of SEQ ID NO: 11, b) expressing the MTS-p20 polypeptide in a cultured cell; and c) purifying the MTS-p20 polypeptide.

15. The method of claim 14, wherein the expression insert further includes a purification tag.

16. The method of claim 1, wherein the inflammation comprises a symptom of a disease selected from a group consisting of: adult respiratory distress syndrome, asthma, bronchitis, bronchopulmonary dysplasia, cystic fibrosis, extensive allergic alveolitis, idiopathic pulmonary fibrosis, interstitial lung disease, and respiratory viral infection.



Description:

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates generally to inflammation and, more particularly, to treating inflammation, regulating cytokines, and kits therefor.

2. Description of the Prior Art

Inflammation is a normal part of the response to injuries, invasion by pathogens, and may occur without known cause. The inflammatory process can protect an organism by eliminating pathogens or by removing injured tissue and promoting therestoration of new tissue. However, overabundant or persistent inflammation results in the malfunction or the destruction of vital cells and tissues. Dysregulated inflammation is a hallmark of many painful and life threatening diseases and can affectevery tissue and organ of the body.

Persistent or chronic inflammation is often characterized by increased production of pro-inflammatory mediators including cytokines, such as, interleukin 6 (IL-6) and interleukin 8 (IL-8). The stimulated expression of IL-6 and IL-8 is thought tobe regulated primarily through increased transcription. Therefore, the promoter regions of IL-6 and IL-8 have been examined to determine which transcription factors activate expression. Two transcription factors are identified as being critical formaximal IL-6 and IL-8 expression: nuclear factor-.kappa.B (NF-.kappa.B) and CCAAT/Enhancer Binding Protein (C/EBP). C/EBP is actually a group or family of transcription factors related by sequence, structure, and/or biological activity. It has beendemonstrated that one member of the C/EBP family, C/EBP.beta., can form a complex with NF-.kappa.B and DNA motifs on the promoter(s) of a target gene leading to a synergistic activation of transcription (including the IL-1.beta., IL-6, and IL-8 genesamong others, see, e.g., Stein et al., Molecular Cell Biol. (1993) 13:3964 3974; Lee et al., Molecular Cell Biol. (1996) 16:4257 4263; Kunsch et al., (1994) J. Immunol. 153:153 164; and Poli (1998) J Biol. Chem. 273(45):29279 29282).

C/EBP.beta. and Isoforms thereof

In human, murine, and rat cells, three isoforms of C/EBP.beta. are observed and are referred to as C/EBP.beta.-1, C/EBP.beta.-2, and C/EBP.beta.-3 (in order from longest to shortest). The three isoforms correlate to three in frame open readingframes (ORFs) in the C/EBP.beta. gene. The shortest C/EBP.beta. isoform, C/EBP.beta.-3, is referred to herein as p20 (a protein of approximately 20 kDa molecular weight).

The transcription of a recombinant C/EBP.beta. responsive reporter gene was found to be activated by transfection of a C/EBP.beta.-2 expressing gene and inhibited by co-transfection of a p20 gene in cultured cells (Descombes et al. (1991) Cell67:569 579).

U.S. Pat. No. 5,804,445 describes an isolated 8.8 kDa tryptic fragment of C/EBP.beta. with mutations in the N-terminus of the fragment which make the N-terminus of the fragment less negative. The mutated tryptic fragment has a higher bindingaffinity for purified DNA containing a C/EBP.beta. binding site compared to similar fragments with the wild-type sequence.

U.S. Pat. No. 5,874,209 describes a peptide consisting of amino acids 75 to 125 of C/EBP.beta., wherein residue 105 is mutated from serine to alanine to prevent phosphorylation of the 105 residue. The 105 mutated peptide competes with nativeC/EBP.beta. in cultured cells to inhibit transactivation of a reporter gene.

The Effects of Dysregulated Inflammation

Virtually all diseases of the lungs have an inflammatory component. Disorders such as idiopathic pulmonary fibrosis (IPF), adult respiratory distress syndrome (ARDS), cystic fibrosis (CF) and asthma, in particular, are characterized by overexuberant or persistent lung inflammation. In addition, overabundant or chronic inflammation is a component of many other diseases and often leads to the destruction of vital cells, tissues, and organs (e.g., the digestive tract organs and the heart andblood vessels). Currently, nonspecific suppression of inflammation with high doses of corticosteroids is used to treat these disorders. However, high dose corticosteroid therapy is itself dangerous with numerous deleterious side effects. There remainsa need for the development of specific inhibitors of inflammation, treatments for inflammation and conditions associated with inflammation, regulators of inflammation stimulating cytokines, and kits associated therewith.

SUMMARY OF THE INVENTION

The inventors have discovered that an increase in the expression of p20 is a normal mechanism for the resolution of an inflammatory response. Also, the inventors have discovered that a deficient induction of p20 expression correlates withconditions of chronic inflammation including expression of inflammatory mediators following a stimulus. Furthermore, the inventors demonstrate that administration of p20 treats inflammation and related disorders in humans and other mammals or in cellsderived therefrom.

In certain embodiments of the present invention, the production of p20 expression is suboptimal in patients with inflammation associated disorders and the resolution of inflammation is enhanced by administering p20. Certain embodiments provide amethod of treating a disease caused or exacerbated by increased activity of indicators associated with inflammation (e.g., cytokines or prostanoids) by administering p20 to a cell or tissue of a mammal in need of treatment. Certain embodiments provide amethod of treating a disease characterized by a deficient resolution phase of the inflammatory response by administering p20. The resolution phase of the inflammatory response relates to any resolution of inflammation including, for example, after astimulus or from chronic inflammation.

Inflammation is associated with numerous disorders including, but not limited to: adult respiratory distress syndrome (ARDS), allergic rhinitis, arthritis, asthma, bronchitis, bronchopulminary dysplasia, cystic fibrosis (CF), extensive allergicalveolitis, idiopathic pulmonary fibrosis (IPF), inflammatory bowel disease, interstitial lung disease, heart disease, diseases of the nerves, and respiratory viral infection.

In one example, CF is associated with chronic or unresolved inflammation (see, e.g., FIG. 6A). The present inventors discovered that the expression of p20 was suboptimal in cells from CF patients (see, e.g., FIG. 6B). The reduced induction ofp20 expression was also discovered to correlate with a prolonged inflammatory response in these cell types compared to normal controls.

It is a general object of the present invention to provide a novel class of anti-inflammatory therapeutics including p20 and methods of use thereof.

Accordingly, methods and compositions are provided for increasing an activity of p20 for treating inflammation in a subject in need thereof. The preferred subject is a mammal and the exemplary mammal is a human. The preferred method ofincreasing the activity of p20 in the mammal is by administering a therapeutically effective amount of p20 to the mammal.

In certain embodiments of the present invention, a therapeutically effective amount of p20 can be provided to the mammal by administering, for example, an isolated or purified p20 polypeptide or an isolated p20 expression vector to a cell of themammal. It is preferred that treating the inflammatory response comprises inhibiting, attenuating, or terminating the response or symptom of the response.

Thus, as used herein, administering a p20 to a mammal, in one example, can refer to administering an isolated or purified p20 polypeptide to a cell of the mammal or, in another example, it can refer to administering an isolated nucleic acidcapable of expressing a p20 polypeptide (e.g., a p20 expression vector) in a cell of the mammal. Alternatively the p20 (polypeptide or nucleic acid encoding and capable of expression the polypeptide) is administered to a mammal compatible cell orcarrier which is administered to the mammal.

Certain embodiments of the present invention provide, a method of treating a disease caused or exacerbated by increased inflammation, or a deficiency in the resolution of inflammation, in a patient in need thereof, comprising administering aneffective amount of p20 to the patient.

Certain embodiments of the present invention provide, a method of treating a disease caused or exacerbated by increased cytokine activity in a patient in need thereof, comprising administering an effective amount of p20 to the patient. Incertain embodiments thereof, the cytokine is IL-1, IL-1.beta., IL-6, TNF.alpha., or IL-8. Increased activity of other pro-inflammatory mediators is treated in certain embodiments wherein the inflammatory mediators include (not limiting): prostanoids andgrowth factors (e.g., thromboxane, TGF.beta., and fibroblast growth factor, FGF).

In certain embodiments, the p20 is mixed with a pharmaceutically acceptable carrier including any carrier known or discovered that is compatible with p20 or expression of p20 by the nucleic acid as administered to the mammal. A highly preferredpharmaceutical carrier is a liposome. The liposome is useful for the administration of both p20 polypeptide and p20 encoding nucleic acid to the cell.

The inflammatory response can be in any body component of the mammal, including any cell, tissue, or organ. Preferred body components include, but are not limited to: adipose, bladder, bone, brain, breast, central nervous system, cartilage, eye,fallopian tube, heart, intestine, joint, kidney, liver, lung, lymphoid, muscle, pancreas, paratenium, peripheral nervous system, skin, spleen, stomach, synovial space, tendon, upper respiratory tract, uterus, and vasculature. Any known or discoveredroute of administration that is compatible with the p20 and the mammal can be used for the administration of p20 to the mammal. Preferred routes of administration include, but are not limited to: buccal, by catheter, dermal, by inhalation, by injection,intradermal, intramuscular, intraocular, intraotic, intraperitoneal, intratumoral, intravenous, nasal, rectal, topical, or vaginal. Furthermore, the inflammatory response of any disease with a known or discovered inflammatory component can be treatedwith p20 in light of the present disclosure. Preferred diseases for treatment (and with a known inflammatory component) include, but are not limited to: adult respiratory distress syndrome, allergic rhinitis, arthritis, asthma, bronchitis,bronchopulminary dysplasia, cystic fibrosis, extensive allergic alveolitis, heart disease, idiopathic pulmonary fibrosis, inflammatory bowel disease, interstitial lung disease, and respiratory viral infection.

Inflammation of the lung is treated in certain embodiments of the present invention. A preferred route of administration to the lung is by aerosolization of the p20 (e.g., isolated or purified p20 polypeptide and/or isolated p20 expressionvector) and introduction to the lung by inhalation of the p20 aerosol. In this case, aerosolization of a p20 liposome pharmaceutical composition is highly preferred. However, aerosolization and liposome carriers may be used in other embodiments. Forexample, p20 liposomes may be administered by injection or by catheter and aerosols may be administered to the eye or the nasal cavities. Highly preferred diseases for treating the inflammatory component thereof are adult respiratory distress syndrome(ARDS), asthma, cystic fibrosis (CF), and idiopathic pulmonary fibrosis (IPF); each of which is known to involve inflammation of the lung.

The preferred p20 polypeptide is set forth in SEQ ID NO:7. Alternative p20 polypeptides include conservatively modified variants of SEQ ID NO:7 and biologically functional equivalents of p20 polypeptide. A useful biologically functionalequivalent of the human p20 polypeptide is a mouse p20 polypeptide (approximately positions 152 to 296 in SEQ ID NO:9). The preferred p20 polynucleotide sequence is set forth in SEQ ID NO:4. Alternative p20 polynucleotides include conservativelymodified variants of SEQ ID NO:4 and biologically functional equivalents of p20 polynucleotide. In certain preferred embodiments p20 polypeptide includes the peptide sequence KKTVDKHSDEYKIRRER (SEQ ID NO:15) or the encoding polynucleotide (from aboutnucleotide 196 to about 246 in SEQ ID NO:4). Without being bound to mechanism, the KKTVDKHSDEYKIRRER polypeptide (SEQ ID NO:15) is believed to be a bipartite nuclear localization signal which facilitates nuclear import of the p20 polypeptide (or p20polypeptide expressed from an introduced nucleic acid) from the cytoplasmic compartment into the nuclear compartment of the cell. It is in the nuclear compartment that p20 is believed to be active; thus, certain preferred p20 polypeptides (and encodingnucleic acids) contain the KKTVDKHSDEYKIRRER peptide sequence (SEQ ID NO:15). A second predicted nuclear localization sequence in p20 has a polypeptide sequence of RRERNNIAVRKARDKAK (SEQ ID NO:16) and may facilitate nuclear transport also. Thus, incertain preferred embodiments, the p20 polypeptide (or encoding nucleic acid) includes (or encodes) the RRERNNIAVRKARDKAK sequence (SEQ ID NO:16).

In certain preferred embodiments the p20 is included in a fusion protein or encoded in a fusion gene. A preferred fusion protein (or encoding nucleic acid) includes a membrane transport sequence (MTS). Examples of a membrane transport sequenceare provided in SEQ ID NO:12 and SEQ ID NO:13. Conservatively modified variants of SEQ ID NO:12 and SEQ ID:13 may be used in the alternative. Also, biologically functional equivalents of an MTS are useful. The identification and construction of an MTSare described in U.S. Pat. No. 5,807,746 to Lin et al., incorporated herein by reference.

The administration of a nucleic acid for the expression of p20 in the mammal, can be carried out ex vivo. Typically, in an ex vivo procedure, a cell is removed from the mammal, cultured, transfected with the p20 expressible nucleic acid, andreturned to the mammal for the expression of the p20 in the mammal. Alternatively, the nucleic acid can be transferred to a mammal compatible acceptor (such as a mammal compatible cell from another organism, a polymer, fine porous ceramic vessels, or abioreactor) outside of the mammal and then introduced into the mammal for the expression of p20 in the mammal. In the expression of p20 from a nucleic acid, it is preferred that the nucleic acid is administered to the mammal in vivo. A p20 polypeptidecan also be administered ex vivo. An MTS-p20 fusion polypeptide is a preferred polypeptide for use therewith.

A preferred nucleic acid for expressing p20 includes a segment encoding p20. The preferred sequence for the segment is set forth in SEQ ID NO:4 which is the human polynucleotide sequence for p20. Alternative segments include conservativelymodified variants of SEQ ID NO:4 and biologically functional equivalents of the human p20 polynucleotide. A biologically functional equivalent of human p20 polynucleotide is a mouse p20 polynucleotide (approximately positions 560 to 998 in SEQ ID NO:8). In general, the nucleic acid will include a non-coding region in addition to the p20 encoding segment. It is preferred that the non-coding region, and in certain embodiments, the coding region include expression control elements. It is preferred thatthe expression control elements are linked operably to the p20 encoding segment. The expression control elements are designed to provide appropriate gene expression of the p20 inside the mammalian cell and the use of such elements is known in the art.

In certain embodiments, the p20 polynucleotide sequence includes a segment that hybridizes to SEQ ID NO:4, or the complement of SEQ ID NO:4, under high stringency conditions. In certain embodiments, SEQ ID NO:4 or the complement of SEQ ID NO:4is used as a hybridization probe. Hybridization probes are known in the art to include a detectable label, such as, a radiolabel, fluorescent label, calorimetric label, etc.

In certain preferred embodiments, the nucleic acid includes an expression vector and an insert, wherein at least a portion of the insert includes the polynucleotide for human p20 (SEQ ID:4). Alternatively, the insert can include conservativelymodified variants or biologically functional equivalents of p20. It is preferred that the insert is linked operatively to the expression vector and that the nucleic acid contain at least one genetic control element. The genetic control element caninclude, but is not limited to: a promoter, a terminator, enhancer, and a polyadenylation signal. If desired, genetic control elements can be included for the temporal or tissue specific regulation of p20 gene expression. Also if desired, geneticexpression systems are known in the art for the regulation of gene expression by the administration of an exogenous activating agent.

The preferred method for administering the nucleic acid is by mixing it with a pharmaceutically acceptable liposome. It is further preferred that the p20 liposome mixture is aerosolized and that the administration include inhalation of theaerosol. This method is preferred for certain embodiments for treating inflammation by inhibiting the inflammation in a human lung, wherein the lung inflammation is a symptom of a lung disease, and wherein the nucleic acid is capable of and expressesthe p20 in the human lung cells. The preferred lung diseases for such treatment include, but are not limited to: adult respiratory distress syndrome (ARDS), asthma, cystic fibrosis (CF), and idiopathic pulmonary fibrosis (IPF).

BRIEF DESCRIPTIONOF THE DRAWINGS

FIG. 1 is a diagram of C/EBP.beta. showing the relative sizes and positions of the polypeptide and polynucleotide forms of C/EBP.beta.-1, C/EBP.beta.-2, and C/EBP.beta.-3 isoforms of C/EBP.beta. and the recognition sites of the N-terminalpeptide antibody and the C-terminal antibody (for a peptide sequence).

FIG. 2A is a diagram showing the National Center for Biotechnology Information (NCBI) LocusLink information for the C/EBP.beta. gene from human, mouse, and rat sources along with their respective gene products.

FIG. 2B is a diagram showing the LocusLink information for human C/EBP.beta.. As shown, the official gene symbol is "CEBPB" and the official gene name is "CCAAT/enhancer binding protein (C/EBP), beta".

FIG. 2C is a diagram showing the LocusLink information for mouse C/EBP.beta..

FIG. 2D is a diagram showing the LocusLink information for rat C/EBP.beta..

FIG. 3A is a diagram of an annotated human C/EBP.beta. nucleotide sequence (SEQ ID NO:1).

FIG. 3B is a diagram of an annotated human C/EBP.beta. polypeptide sequence (SEQ ID NO:5).

FIG. 3C is a diagram of an annotated mouse C/EBP.beta. nucleotide sequence (SEQ ID NO:8).

FIG. 3D is a diagram of an annotated mouse C/EBP.beta. polypeptide sequence (SEQ ID NO:9).

FIG. 3E (pages 1 2) is a diagram of an annotated rat C/EBP.beta. nucleotide sequence (SEQ ID NO:10).

FIG. 3F is a diagram of an annotated rat C/EBP.beta. polypeptide sequence provided by the present inventors (SEQ ID NO:11). The underlined "G" in FIG. 3F represents the glycine found in the inventor's C/EBP.beta. clone which differs from therat C/EBP.beta. polypeptide previously entered into the Entrez protein database, but now withdrawn, which shows an alanine (A) at this position. In the mouse and human alignments to the rat sequence (FIGS. 5B, 5C), an alanine is found at this position. Glycine and alanine are a conservative residue substitution. It is possible that the difference is simply a polymorphism between clones.

FIG. 4A is a diagram of one possible alignment of the human and mouse C/EBP.beta. polypeptides (see FIGS. 3B and 3D). This particular alignment shows a 72.8% identity between the human and mouse C/EBP.beta. polypeptides.

FIG. 4B is a diagram of one possible alignment of the human and rat C/EBP.beta. polypeptides (see FIGS. 3B and 3F).

FIG. 4C is a diagram of one possible alignment of the mouse and rat C/EBP.beta. polypeptides (see FIGS. 3D and 3F). These polypeptides are about 99% homologous.

FIG. 5 is a diagram of an annotated human C/EBP.beta.-3 polypeptide showing predicted nuclear localization sequences KKTVDKHSDEYKIRR (underlined, SEQ ID NO:15) and RRERNNIAVRKARDKAK (double line overhead, SEQ ID NO:16). Nuclear localizationsequences facilitate nuclear import of proteins or moieties bound to NLS containing proteins. Thus, preferred p20 sequences contain one or both NLS or encode one or both NLS.

FIG. 6A is a graph of the accumulated expression of IL-8 in the media of cultured cells BEAS, IB3, and C38 cells stimulated with TNF.alpha. (hours of incubation with TNF.alpha.). IB3 cells have the CF defect and BEAS cells are normal humanbronchial epithelial cells. C38 cells carry defective genomic copies of the CF gene, but express a recombinant CFTR gene. (C38 cells are referred to as CF corrected.)

FIG. 6B is a diagram showing the accumulation of human p42 and p20 isoforms of C/EBP.beta. over time in BEAS, IB3, and C38 cells.

FIG. 7 is a graph showing the accumulation of IL-6 and IL-8 in the media of cultured fibroblasts derived from the lungs of patients with IPF and from normal lungs. The control data represent determinations from two different lungs and the IPFdata represent determinations from three different lungs. IL-6 and IL-8 were measured by ELISA (see the Examples section) following 24 hours of stimulation with IL-1.beta. (1 pg/ml).

FIG. 8A is a graph showing the change in p20/p42 ratio following stimulation of normal lung fibroblasts and IPF derived fibroblasts with PGE.sub.2, a well known pro-inflammatory mediator. The ratio of p20 to p42 (isoforms of C/EBP.beta.)dramatically increases in the normal human lung fibroblasts, but shows a relatively weak increase in the IPF fibroblasts.

FIG. 8B is a graph showing the change in p20/p42 ratio following stimulation of normal lung fibroblasts and IPF derived fibroblasts with IL-1, also a well known pro-inflammatory mediator. The ratio of p20 to p42 (isoforms of C/EBP.beta.)dramatically increases in the normal human lung fibroblasts, but is essentially unchanged in the IPF fibroblasts.

FIG. 9A is a graph showing the change in p20 (C/EBP.beta.-3) expression over time in piglet lungs following perfusion of the piglet lungs and liver with and without endotoxin (lipopolysaccharide, LPS). The p20 values are relative densitometricunits determined by densitometric scans of autoradiographs of Western blots.

FIG. 9B is a graph showing the change in p20:p42 ratio over time in piglet lungs following perfusion of the piglet lungs and liver with and without endotoxin (lipopolysaccharide, LPS). The p20 values are relative densitometric units determinedby densitometric scans of autoradiographs of Western blots.

FIG. 10A is a graph showing the relative light units generated (a measure of luciferase expression) by co-transfection of various doses of a p20 expressing nucleic acid with a C/EBP.beta. responsive luciferase reporter expressing nucleic acid(weight ratio of p20 cDNA expression vector to luciferase reporter gene). A dose dependent regulation of the C/EBP.beta. responsive luciferase reporter gene by p20 is observed.

FIG. 10B shows drawing of fluorescent photomicrographs from in vivo transfection experiments with a vector including adenoviral control elements operatively linked to a p20 polynucleotide sequence. In this case, the vector further included a CMVpromoter operatively linked to the p20 polynucleotide sequence, an IRES genetic control element, and a green fluorescent protein coding sequence. Transfection of the liver and lung tissue was performed by perfusion of the vector. Expression of both p20and green fluorescent protein is observed (see left photomicrograph labeled Liver+Ad-p20). The arrows in the figure point to individual hepatocytes with green fluorescence mainly throughout the cytoplasm.

FIG. 10C is an illustration that the p20 transgene (expressed from the adenoviral p20 construct) is expressed in the liver and lung tissue in vivo. The transgenic p20 is slightly larger in apparent molecular weight (or gel migration) in theseWestern blots of extracted tissue samples because of the histidine tag included in the p20 nucleotide sequence for easy purification of the expression product.

FIG. 10D is a graph showing that the pulmonary vascular resistance (PVR) response to endotoxin (an inflammatory agent) in the piglet liver and lung is dramatically reduced in tissues treated by administering a p20 expression vector compared tocontrol tissues.

FIG. 11A is a diagram showing the construction of the pcDNA3.1HisC/EBP.beta.-3 vector from prsetALip which includes SEQ ID NO: 34 (GGATCC), SEQ ID NO: 4 and SEQ ID NO: 35 (GTGCAGATCCGAGCTCGAGATCTGCAGCTGGTACCATGGAATTC) and pcDNA3.1HisC whichincludes SEQ ID NO: 34 (GGATCC) and SEQ ID NO: 36 (GAATTC). The resultant vector adds a polyhistidine tag to the p20 (C/EBP.beta.-3) polynucleotide coding sequence and includes a CMV promoter for driving p20 expression. The pcDNA3.1HisC/EBP.beta.-3vector which includes SEQ ID NO: 34 (GGATCC), SEQ ID NO: 4 and SEQ ID NO: 35 (GTGCAGATCCGAGCTCGAGATCTGCAGCTGGTACCATGGAATTC) is referred to herein as pCMV-p20-His. The vector designation pCMV-p20 is similar to pCMV-p20-His except that no histidine tag ispresent.

FIG. 11B is a diagram showing the construction of the pLZRShisC/EBP.beta.-3 vector from the pcDNA3.1HisC/EBP.beta.-3 vector of FIG. 10A and the pLZRSpBMN-Z hybrid retroviral/Epstein Barr viral expression vector.

FIG. 11C is a diagram of the pLZRShisC/EBP.beta.-3 vector.

FIG. 11D is a diagram showing the construction of the pRSETC-NFIL6 vector (also known as the pRSETC-C/EBP.beta.-1 vector which includes SEQ ID NO: 40 (AGATCTGCAGCTGGTACCATGGAATTCCATGCA), SEQ ID NO: 41 (ATGGAAGTGGCCA), SEQ ID NO: 1 and SEQ ID NO:42 (TAGAGTCGAAGCTT)) by linking the C/EBP.beta.-1 coding segment of the CMV-C/EBP.beta.-1 vector which includes SEQ ID NO: 37 (GAATACCATGCA), SEQ ID NO: 2 and SEQ ID NO: 38 (TAGAGTCGAC) with the pRSETC vector which includes SEQ ID NO: 34 (GGATCC) and SEQID NO: 39 (AGATCTGCAGCTGGTACCATGGAATTCGAAGCTT). This adds a histidine tag to the C/EBP.beta.-1 sequence.

FIG. 11E is a diagram showing the mutagenesis of pRSETC-C/EBP.beta.-1 by replacement of a portion of the vector with mutated oligonucleotides (SEQ ID NO:21 (top strand) and SEQ ID NO:22 (bottom strand)) forming the pCDNA3.1HisA-C/EBP.beta.-1vector. The region of the wild type NFIL6 (CEBPB) sequence is SEQ ID NO: 33. The C/EBP.beta.-2 translation start site (2nd in-frame ATG, see infra) is eliminated and a perfect Kozak sequence is created around the C/EBP.beta.-1 translation start site(1st in-frame ATG, see infra). This step prevents production of the C/EBP.beta.-2 isoform and enhances production of the C/EBP.beta.-1 isoform from the resulting insert when placed in an appropriate expression vector.

FIG. 11F is a diagram showing the transfer of the mutated polyhistidine tagged C/EBP.beta.-1 insert from the pCDNA3.1HisA-C/EBP.beta.-1 vector into the pLZRSpBMN-Z vector forming the pLZRShisC/EBP.beta.-1 vector. The pLZRSpBMN-Z vector is ahybrid retroviral/Epstein Barr expression vector (described in U.S. Pat. No. 5,830,725 to Nolan et al., incorporated herein by reference). The pLZRShisC/EBP.beta.-1 vector expresses C/EBP.beta.-1 in infected mammalian cells. The pLZRShisC/EBP.beta.-1vector is not capable of expressing C/EBP.beta.-2.

FIG. 11G is a diagram of the pLZRShisC/EBP.beta.-1 vector.

FIG. 12 is a diagram of the preferred human DNA codons with the order of preference from left to right adjacent to each amino acid.

FIG. 13 is a graph which quantifies treatment by administering p20 to human cystic fibrosis (CF) bronchial epithelial airway cells (IB3 cells) which are used as an in vitro model system for analyzing the chronic inflammation of CF. Accumulationof IL-6 (in ng/10.sup.6 cells) is shown at 24 hours and 48 hours (normalized to IL-6 present at 0 hours) for untreated IB3 cells (open bars), IB3 cells treated with control retrovirus (without a p20 insert, crosshatched bars), and IB3 cells treated withpLZRShisC/EBP.beta.-3 (p20 expressing IB3 cells, solid bars).

FIG. 14 shows the importation of MTS-p20 into the nuclei of NIH 3T3 cells by contacting the cells with the MTS-p20 as detected by fluorescent conjugated anti-p20 antibody (top right panel). The other panels show controls. The locations cellnuclei are shown in the left top and left bottom panels. The bottom right panel shows that p20 is not imported without the MTS (and without other methods of translocation of the cellular membrane).

DETAILED DESCRIPTION OF THE INVENTION

1.00 Definitions

In describing the present invention, the following terms are used. The meanings of the terms are understood by one of ordinary skill in the art and include the information provided below, which is listed by way of example so that the inventionmay be more easily understood.

All patents, patent publications, references, and citations listed herein are hereby incorporated in their entirety by reference and made part of this application.

No aspect, embodiment, objective, claim, or other element of the present invention is bound by theory or mechanism.

The singular forms "a," "an," and "the" include plural references in this specification, including the claims, unless the content clearly dictates otherwise.

As used herein, "isolated polynucleotide" means a polynucleotide the structure of which is not identical to that of any naturally occurring nucleic acid or to that of any fragment of a naturally occurring genomic nucleic acid spanning more thanthree separate genes naturally contiguous genes. The term therefore covers, for example, (a) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical toany naturally occurring vector or genomic DNA; (b) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (c) a recombinant nucleotide sequence that is part of ahybrid gene, i.e., a gene encoding a fusion protein. This definition of "isolated polynucleotide" supersedes and controls all other definitions known in the art.

As used herein, "hybridization probe" means a nucleic acid or mimetic that is labeled for detection, such as labeling with radiation (e.g., 33P, 32P, 14C, 3H labeled nucleotides), fluorescence, color, enzymatic detection, and the like. Labelsand labeling systems or kits are readily available in the art. Hybridization probes (including nucleic acid mimetics, such as, peptide nucleic acids) are well known in the art.

As used herein, "culturing the cell" means providing culture conditions that are conducive to polypeptide expression. Such culturing conditions are well known in the art.

As used herein, "high stringency hybridization conditions" or "highly stringent hybridization conditions" means the following: hybridization at 42 C in the presence of 50% formamide; a first wash at 65 C with about 2.times.SSC containing 1% SDS;followed by a second wash at about 65 C with 0.1.times.SSC.

The terms "nucleotide", "nucleic acid", "nucleic acid sequence", "nucleotide sequence", "DNA", and "RNA" are known to one of ordinary skill in the art. Definitions of these terms are also found in the World Intellectual Property Organization(WIPO) Handbook on Industrial Property Information and Documentation, Standard ST.25: Standard for the Presentation of Nucleotide and Amino Acid Sequence Listings in Patent Applications (1998), including Tables 1 through 6 in Appendix 2, incorporatedherein by reference. (Hereinafter "WIPO Standard ST.25 (1998)"). In certain embodiments of the present invention, the terms "nucleic acid", "nucleic acid sequence", "DNA", and "RNA" include derivatives and biologically functional equivalents. Incertain embodiments of the present invention, the terms "nucleic acid", "nucleic acid sequence", "polynucleotide" and "nucleotide sequence" are used interchangeably. These terms refer to a polymer of nucleotides (dinucleotide and greater), includingpolymers of 2 to about 100 nucleotides in length, including polymers of about 101 to about 1,000 nucleotides in length, including polymers of about 1,001 to about 10,000 nucleotides in length, and including polymers of more than 10,000 nucleotides inlength.

The terms "amino acid" and "amino acid sequence" are known to one of ordinary skill in the art. Definitions of these terms are also found in the WIPO Standard ST.25 (1998)". In certain embodiments of the present invention, the terms "aminoacid" and "amino acid sequence" include derivatives, mimetics, and analogues including D- and L-amino acids which may not be specifically defined in WIPO Standard ST.25 (1998). The terms "peptide", "polypeptide", and "amino acid sequence" are usedinterchangeably herein and refer to any polymer of amino acids (dipeptide or greater) typically linked through peptide bonds. The terms "peptide", "polypeptide", and "amino acid sequence" include oligopeptides, protein fragments, analogues, nuteins, andthe like.

An "isolated" or "purified" polypeptide or polynucleotide as used herein refers to a polypeptide or polynucleotide that has been at least partially removed from its natural environment. An "isolated p20 polypeptide" is separated to some extentfrom the natural milieu of proteins and factors found in a mammalian cell expressing p20. In one example, a p20 polypeptide expressed in a host cell not of mammalian origin is an isolated p20 polypeptide. An "isolated p20 polynucleotide" does notinclude more than three contiguous genes (including the p20) as found in native genomic DNA.

The term "fusion protein" means a polypeptide sequence that is comprised of two or more polypeptide sequences linked by a peptide bond(s). "Fusion proteins" that do not occur in nature can be generated using recombinant DNA techniques. Forexample, a nucleic acid encoding a membrane transport sequence (membrane transport sequence) is part of an expression insert that also includes a nucleic acid sequence encoding p20. Expression of the insert results in the production of an MTS-p20 fusionprotein. This could also be called a fusion polypeptide.

A "membrane transport signal" (also known as an "importation competent signal peptide") is a sequence of amino acids generally of a length of about 10 (possibly fewer) to about 50 or more amino acid residues, many (typically about 55 60%)residues of which are hydrophobic such that they have a hydrophobic, lipid-soluble portion. The hydrophobic portion is a common, major motif of the signal peptide, and it is often a central part of the signal peptide of protein secreted from cells. TheMTS peptides of this invention are "importation competent," i.e., capable of penetrating through the cell membrane from outside the cell to the interior of the cell. Specific MTS sequences are provided in U.S. Pat. No. 6,043,339 to Lin et al. and U.S. Pat. No. 5,807,746 to Lin et al., each patent incorporated herein by reference.

Meanings of the term "gene expression" are known to those with skill in the art. "Gene expression" includes the production of a polypeptides or proteins from RNA and the production of a RNA from a DNA. A gene is said to be "expressed" when itis transcribed into RNA, but this meaning also includes translation into a peptide or protein. The term "gene expression" is often shortened to "expression", "expressed", or the like. Additional meanings of the term "gene expression" are known to thosewith skill in the art.

The term "consensus" sequence is used herein to indicate a sequence of general agreement between multiple nucleic acid or peptide sequences that are aligned and examined for sequence similarities.

The terms "transfecf", "transfection" or "transfecting" are used to indicate the act or method of introducing a molecule, usually a nucleic acid, into a cell.

The terms "treating" and "therapy" mean the reduction or elimination of symptoms of a disease of interest. This can be through alteration of physiological or molecular level abnormalities. Therapy can also refer, herein, to the reduction orelimination of signs, symptoms, or conditions of disease through unknown mechanism as the present invention is not bound by theory or mechanism. The term "treatment" can also refer to a substance or process applied to an experimental or medicalcondition.

The terms "disease", "disorder", and "condition" are used interchangeably herein.

With reference to an inflammation or an inflammatory response, it is understood that the terms "inhibiting", "attenuating", and "terminating" mean that the inflammatory response is decreased and/or stopped. For example, inhibiting aninflammatory response means that the severity of the response or symptoms of the response are decreased for eliminated. In another example, terminating an inflammatory response means that the response is substantially eliminated, but may or may not becompletely eliminated.

Meanings of the terms used herein are known to those of ordinary skill in the art and, unless stated otherwise, can include meanings not specifically mentioned in the definitions above. Additional terms and meanings are provided herein.

2.00 Inflammation

Inflammation is a natural response of a subject to injuries, immunologic reactions, infections, altered endogenous substances, defective endogenous pathways, and foreign substances. In certain cases, the cause of inflammation is unknown. Theprocess of inflammation typically serves to destroy, dilute, or wall off both the injurious agent and the injured cells or tissues. It is characterized in the acute form by the classical clinical signs of pain, heat, redness, swelling, and loss offunction. Histologically inflammation is indicated by dilatation of arterioles, capillaries, and venules, with increased permeability and blood flow; exudation of fluids, including plasma proteins; and leukocyte migration into the inflammatory focus. Inflammation can be detected in subjects as simple as single cells. For example, expression or secretion of interleukin-6 (IL-6) and/or IL-8 into the cell medium is an indication of an inflammatory response in cultured cells.

2.01 Acute-Phase Reaction

The acute-phase reaction includes the early inflammatory response to insult or injury that consists of fever, an increase in inflammatory humoral factors, and an increased synthesis by hepatocytes of a number of proteins or glycoproteins usuallyfound in the plasma; the reaction is typically mediated by endogenous pyrogens, the hypothalamus, adrenal hormones, cytokines, and other factors. The neutrophil is generally the predominate inflammatory cell present during the acute-phase reaction. Theacute phase is followed by a maintenance phase and, in optimal conditions, resolution of the inflammation with restoration of tissue without significant damage. In less than optimal conditions, resolution may result in suppuration (formation of pus oran abscess which typically produces scarring), fibrosis (a scar characterized by a fibrin mesh, collagen, fibroblasts, macrophages, and capillaries), or chronic inflammation. Chronic inflammation can also occur without the observance of an acute phase.

2.02 Resolution Phase of Inflammation

In a normal response to an inflammatory stimulus or injury (including exposure to certain cytokines, prostanoids, and other biological factors), the cells, tissues, organs, and/or body typically attenuate the inflammation in what is called theresolution phase. Current knowledge about the resolution of inflammation is limited. Certain aspects of the present invention are that a cellular p20 expression is part of the normal mechanism for the resolution of inflammation and that deficiencies inthe p20 response are associated with a prolonged or persistent inflammatory reaction and/or chronic inflammation.

2.03 Chronic Inflammation

A condition of chronic inflammation often develops when the inflammatory response is unable to eliminate the injurious agent or to repair the injured tissue to its normal physiological state. For example, when foreign particles are too large tobe internalized by the neutrophil through phagocytosis, the neutrophil can be killed, spilling its enzymes and cytotoxic chemicals into the extracellular matrix, further enhancing the response including attracting additional cells, such as macrophages. In general, the tissue becomes the site of a long term inflammatory response. The primary inflammatory cells observed in sites of chronic inflammation include (non-limiting): macrophages, lymphocytes (T-cells and B-cells), cytotoxic natural killercells, eosinophils (especially in allergic reactions), and neutrophils. Although specific terms have been associated with the inflammatory response in these sections (e.g., acute or chronic), it is clear that inflammation is a continuum; thus, theseterms are not meant to be limiting.

2.10 Inflammation as a Component of Disease

The medical literature is rife with examples of inflammation (acute and chronic) being associated with painful and life-threatening diseases including, but not limited to: asthma, cystic fibrosis (CF), adult respiratory distress syndrome (ARDS),idiopathic fibrosis (IPF), Crohn's disease, viral infection, bacterial infection (including of the stomach or intestine), peptic ulcer, psoriasis, diabetes, sepsis syndrome, cirrhosis of the liver, encephalitis, allergic rhinitis. In addition,inflammation is a normal, but sometimes undesirable, component of mechanical injuries; such as a sprained ankle, surgery, or inhalation of a noxious substance. Certain diseases are described in more detail below for purposes of example and theirspecific mention is not meant to limit the scope of the invention.

2.11 Cystic Fibrosis (CF)

Cystic fibrosis is an inherited disease of exocrine glands, affecting most characteristically the pancreas, respiratory system, and sweat glands, usually beginning in infancy and typified by chronic respiratory infections, pancreaticinsufficiency, and susceptibility to heat prostration. About 30,000 children and young adults suffer from CF in the United States and more than fifty percent of them do not live beyond their mid-thirties. Cirrhosis of the liver occurring duringchildhood is common and may produce portal hypertension, splenomegaly, and hypersplenism. Ten million Americans carry a defect in the cystic fibrosis transmembrane regulator (CFTR) gene which underlies CF, but are asymptomatic. The CF defect disruptstransport of sodium and chloride within epithelial cells that line various organs and leads to hallmark inflammation of the lungs and pancreas.

2.12 Asthma

Asthma is a leading cause of morbidity among children in the United States and throughout the world with about 14.9 million Americans afflicted from the disease. In addition, there is convincing evidence to suggest that its prevalence andmorbidity are increasing despite a better definition of its pathogenesis and increased use of anti-asthma therapy. The reasons for this increase are not fully understood and probably multifactorial.

Our understanding of the pathogenesis of asthma has changed during the past decades, with the recognition that inflammation underlies the clinical syndrome. The degree of inflammatory changes within the lung is generally believed to be relatedto airway hyper-responsiveness. Analyses of endobronchial biopsies and bronchoalveolar lavage fluids have revealed that subjects with mild asthma often have evidence of inflammation within their lungs. A review of studies by the Expert Panel of theNational Heart, Lung and Blood Institute National Education Program (1991) led to the conclusion that airway inflammation is present in virtually all patients with asthma. Superimposed on this chronic inflammatory state are acute inflammatory episodestriggered by several environmental factors which lead to worsening airway hyper-responsiveness and exacerbation of asthma symptoms.

2.13 Idiopathic Pulmonary Fibrosis (IPF)

IPF is characterized by alveolitis which is inflammation of the alveoli (air sacs) in the lungs. In time, the alveoli tissues and intrastitium develop fibrosis (scarring) that makes the lungs stiff and impedes gas transfer. Breathing becomesincreasingly difficult and in many cases the resulting low oxygen pressure causes pulmonary hypertension (high blood pressure inside the lungs). The average survival rate after diagnosis is about five years. The cause of IPF is not known, but mightinvolve a auto-immune reaction or an infection as the trigger for inflammation. Treatment of IPF consists of high dose corticosteroids, the efficacy of which is unproven. Lung transplantation is a last resort treatment.

2.14 Adult Respiratory Distress Syndrome (ARDS)

ARDS is the rapid onset of progressive malfunction of the lungs. It is usually observed in conjunction with multiple organ failure due to an inability to absorb oxygen. Typically, a massive inflammatory response to trauma, infection (especiallysepsis), pneumonia, or shock underlies the alteration in oxygen absorption. The fatality rate in ARDS is approximately fifty percent even with assisted respiration and ARDS affects approximately 150,000 people in the United States annually. ARDS istreated with respiratory intervention and anti-inflammatory agents. Anti-inflammatory treatment consists of high dose corticosteroids, the efficacy of which is questionable.

2.15 Sepsis Syndrome

Sepsis syndrome is a systemic response to infection, characterized by hypothermia or hyperthermia, tachycardia, tachypnea, a clinically evident focus of infection or positive bacterial blood cultures, one or more end organs with eitherdysfunction or inadequate perfusion, cerebral dysfunction, hypoxemia, increased plasma lactate or unexplained metabolic acidosis, and oliguria. It is one of the most common causes of ARDS. While usually related to infection, it can also be associatedwith noninfectious insults such as trauma, burns, and pancreatitis.

2.16 Heart Disease

Information provided by the American Heart Association describes a role for chronic inflammation in heart disease (including atherosclerosis and stroke). Evidence suggests that inflammation is a indicator of risk for future heart attacks andstrokes. Researchers have found that blood levels of a protein that reflects underlying levels of chronic inflammation are elevated many years before a first heart attack or stroke (Ridker et al. (1997) New England Journal of Medicine 366:973 979,incorporated herein by reference). The particular protein tested was C-reactive protein (CRP). The study found that among 1,086 apparently healthy men participating in the Physicians' Health Study, followed over an eight-year period for futuredevelopment of their first myocardial infarction (heart attack), stroke or venous thrombosis (a blood clot in a vein), the men with the highest levels of C-reactive protein, compared to men with lower levels of the protein, have a threefold increase intheir risk of future heart attack, have a twofold increase in their risk of future stroke. These risks were independent of other traditional risk factors for heart disease and stroke, including high cholesterol, smoking, high blood pressure and obesity.

Moreover, elevated levels of C-reactive protein were found to predict risk of first heart attacks as many as six to eight years into the future. That is enough time for affected persons to begin an aggressive program of prevention. Thus, incertain embodiments, treatment with p20 (protein, or as expressed from a p20 encoding nucleic acid) is used to lower the risks of heart attack and stroke and other diseases associated with chronic inflammation. In certain embodiments, for example, apatient with an elevated level of CRP, IL-6, IL-8, or other inflammatory indicator is treated by administering a therapeutically effective amount of p20. A therapeutically effective amount of p20 (protein or encoding nucleic acid) is an amount whichlowers the level of an inflammatory indicator. Preferably, the level (or expression) of the inflammatory indicator is lowered below a level indicative of risk for heart or other disease. Measurements of the inflammatory indicator can be determined bysampling the blood or tissue and can utilize standard immunoassays and the like. The new data suggest that measurement of the body's response to inflammation may provide new means for preventing diseases related to inflammation including cardiovasculardisease.

2.20 C/EBP.beta. and the C/EBP Family of Transcription Factors

C/EBP.beta. is one of six currently known members of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors which includes C/EBP.alpha., C/EBP.beta., C/EBP.gamma., C/EBP.delta., C/EBP.epsilon., and C/EBP.xi.. The C/EBPfamily is involved in several biological activities including roles in the regulation of development, metabolism, proliferation, differentiation, and inflammation (for review, see Poli (1998) J Biol Chem 273(45):29279 29282, incorporated herein byreference). C/EBP transcription factors are modular proteins comprised of a basic domain-leucine zipper (bZIP) and a transactivation domain. The bZIP enables two compatible bZIP molecules, including various C/EBP family members, to noncovalently bindtogether through their leucine zipper domains into a dimeric structure. The dimeric form is then capable of noncovalently binding to specific deoxyribonucleic acid (DNA) sequences through interactions with the basic DNA binding domain of the bZIP. Higher order multimeric structures may also be possible. Upon binding to a DNA site, the transactivation domain is positioned to interact with other transcriptional machinery to stimulate, or otherwise regulate, gene expression. Additional mechanismsof action including direct protein-protein interactions are also contemplated.

2.30 Isoforms of C/EBP.beta.

The human, mouse, and rat C/EBP.beta. genes contain three open reading frames (ORFs) with in-frame ATG translation start sites which correspond to three C/EBP.beta. isoforms; referred to herein as C/EBP.beta.-1, C/EBP.beta.-2, and C/EBP.beta.-3(see FIGS. 1, 3A, 3B, 3C, 3D, 3E, and 3F). The first ATG gives rise to C/EBP.beta.-1 (52 kDa in humans and 42 kDa in mice and rats). The second ATG gives rise to C/EBP.beta.-2 (45 kDa in humans and 36 kDa in mice and rats). The C/EBP.beta.-1 isoformis about 23 amino acids longer than the C/EBP.beta.-2 isoform in human cells and about 21 amino acids longer in mice and rats. The molecular weights are approximate as determined by SDS-PAGE and can additionally vary by phosphorylation and othermodifications. The third ATG gives rise to C/EBP.beta.-3 (20 kDa in both humans and mice). Alternate names used for C/EBP.beta.-3 include p20 (in reference to a protein with approximate molecular weight of 20 kDa) and liver-enriched transcriptionalinhibitor protein (LIP). The term p20 is commonly used herein and refers to the C/EBP.beta.-3 isoform of C/EBP.beta..

As used herein, the term "C/EBP.beta." means a C/EBP.beta.-1 isoform and/or a C/EBP.beta.-2 isoform. As used herein, the term "C/EBP.beta." does not mean a C/EBP.beta.-3 isoform (p20).

3.00 Autoregulation of IL-6 and IL-8 is Defective in CF

The inventors examined the production of the pro-inflammatory mediators, IL-6 and IL-8, over time following an inflammatory stimulus of normal human bronchial epithelial cells (BEAS cells), a cell line derived from bronchial epithelial cells of apatient with CF (IB3), and a CF bronchial epithelial cell line that has been corrected with the (cystic fibrosis transmembrane conductance regulator) CFTR gene (C38 cells). Samples of each cell type were incubated in cell culture with 30 ng/mlTNF.alpha. using serum free media. At multiple time points the subsets of the cells were counted and the supernatants were assayed for IL-6 and IL-8 expression (ng cytokine/10.sup.6 cells). Additional cells of each type were incubated in serum freemedia for determination of basal cytokine expression. For each time point, the basal cytokine concentration was subtracted from the raw TNF.alpha. stimulated concentration to determine the cumulative TNF.alpha.-stimulated IL-6 or IL-8 production(measured in units of ng/10.sup.6 cells). This is the amount of IL-6 or IL-8 that accumulated in the supernatant of each cell culture normalized for basal expression.

The inventors found that cells which express wild-type CFTR autoregulate IL-6 and IL-8 production so that no further generation of these cytokines occurs after a period of time despite the continued presence of the stimulating agent (FIG. 6A). In marked contrast, there was no evidence for such autoregulation in the CF cells. FIG. 6A summarizes three independent studies conducted in the three cell types and highlights the presence of an "off-switch" in the normal and the corrected CF cells andcomplete lack of autoregulation in the CF cells. After 24 to 32 h of TNF.alpha. there was no further increase in IL-8 accumulation in the normal or the corrected cells. In the CF cells, IL-8 continued to accumulate during the second 24 h ofstimulation and the accumulation rate actually accelerated. Therefore, at the end of the 48-h period of TNF.alpha. stimulation there was on average about 7 ng of IL-8 per million normal cells (BEAS), about 14 ng IL-8/one million CF corrected cells(C38), and about 70 ng IL-8 per one million CF cells (IB3). Thus, a dysregulation of IL-8 production was observed in the CF cells, specifically a defect in down regulating IL-8 expression following an inflammatory stimulus such as TNF.alpha. administration.

A similar dysregulation of cytokine production after stimulation by an inflammatory agent (e.g., TNF.alpha., IL-1, chronic inflammation) was discovered in the production of IL-6. The CF cells failed to turn off IL-6 generation after 24 hours ofTNF.alpha. stimulation whereas the BEAS and the corrected CF cells were able to down-regulate the production of IL-6. Taken together, the inventors have found that with continued TNF.alpha. stimulation, normal cells (with normal CFTR regulation) arecapable of autoregulating IL-8 and IL-6 generation and that this "off-switch" is absent or non-functional in CF cells. Furthermore, the CF cells and the expression of inflammatory mediators therefrom (e.g., IL-6 and IL-8) are a model system for CF inhumans and other mammals and a model system for chronic, dysregulated, or persistent inflammation, in general, also in mammals and other humans.

3.10 Expression of p20 Correlates with Resolution of Inflammation

The inventors conducted experiments designed to determine the expression pattern of C/EBP.beta. in CF and corrected CF cells in addition to normal lung airway cells. The inventors incubated IB3, C38, and BEAS cells with TNF.alpha. (30 ng/ml)using serum free media conditions for 0 to 48 h and evaluated full length C/EBP.beta. (p42) and p20 in whole cell lysate using Western blot (known to one with skill in the art) and an antibody to the C-terminal 19 amino acids of C/EBP.beta. which iscommon to all three C/EBP.beta. isoforms. This antibody is commercially available from Santa Cruz.

FIG. 6B shows data from this experiment. The p42 isoform was observed in all three cell types to a similar degree in the unstimulated state (lanes 1, 10, and 19). A small amount of basal p20 synthesis was observed in the BEAS and CF cells(lanes 1, 10, and 19). In contrast, the expression of p20 was dramatically increased by TNF.alpha. stimulation in the wild-type BEAS cells, peaking at 8 hours post TNF.alpha. stimulation. The stimulation of p20 expression was intermediate in the CFcorrected cells and nearly nonexistent in the CF cells. Accordingly, the ratio of full-length C/EBP.beta. to p20 decreased with time post TNF.alpha. stimulation in the wild-type (BEAS) and CF corrected cells (C38); however, as can be seen in FIG. 6B,the ratio of full length C/EBP.beta. to p20 remained dramatically higher in the CF cells (IB3) compared to the BEAS and CF corrected cells.

Thus, in normal BEAS cells and the corrected CF cells, the stimulation of p20 expression and/or the decrease in the relative ratio of full-length C/EBP.beta. to p20 correlates with the suppression of IL-6 and IL-8 production following TNF.alpha. stimulation. However, the production of little or no p20 in CF cells and the relatively high ratio of full length C/EBP.beta. to p20 in the TNF.alpha. stimulated CF cells correlates with the continued production of IL-6 and IL-8 in the inflammationprone CF cells. It is believed by the present inventors that p20 functions in the autoregulation of pro-inflammatory cytokines in normal cells. Without being bound to theory or mechanism, in certain aspects of the present invention it is consideredthat the braking action of p20 is lost in cells in which the regulation of inflammation or the ability to resolve inflammation is reduced or is defective.

3.20 The Inflammatory Response in Normal and IPF Lung Fibroblasts

In an effort to define differences in fibroblast phenotype which might be relevant to idiopathic pulmonary fibrosis (IPF), the inventors have cultured fibroblasts from the lungs of 7 patients with IPF from either biopsy specimens or from lungsremoved at the time of transplantation and from 12 normal lungs from organ donors. These cells can be maintained in primary culture for 8 10 passages and the inventors utilize stocks of cells frozen in early passage for experimentation.

Primary cultures of two different normal lung fibroblasts and three different IPF lung fibroblasts were stimulated with IL-1.beta. (1 pg/ml culture media) for twenty-four hours. IL-6 and IL-8 production were measured by ELISA for the IL-1.beta. stimulated cultures and compared to identical cultures that were not stimulated with IL-1.beta. (baseline). As shown in FIG. 7, the IPF and normal lung fibroblasts produce similar amounts of IL-8 compared to baseline when stimulated with IL-1.beta. (reported as fold increase of IL-8 over baseline). However, the IPF fibroblasts consistently produce approximately five times more of the pro-inflammatory cytokine IL-6 when stimulated with IL-1.beta. compared to baseline (FIG. 7).

Further investigation of the regulation of inflammation in IPF fibroblasts revealed that stimulation of IPF fibroblasts, this time with PGE.sub.2 (1 .mu.M) for four hours, results in a dramatic increase in the ratio of p20 to p42 in normal lungfibroblasts compared to IPF lung fibroblasts (FIG. 8A). The p20 and p42 content was determined by Western blot as described herein and the data were quantified by densitometric scanning of a autoradiograph of the Western blot. HF-NL in FIG. 8A meanshuman fibroblasts from normal lung. HF-IPF in FIG. 8A means human fibroblasts for lung samples from patients with IPF. The increase in p20 to p42 ratio was predominately affected by the dramatic 2.5 fold increase in p20 expression observed in thenormal lung fibroblasts (FIG. 8B). Essentially no increase in p20 expression was observed in the PGE.sub.2 stimulated IPF fibroblasts (FIG. 8B).

Once again, the inventors have discovered that an increase in p20 expression is a normal cellular response to an inflammatory stimulus. This has been demonstrated for two different diseases herein, CF and IPF, both of which are associated with adysregulated inflammatory response and more specifically an inability to downregulate inflammation (i.e., the resolution phase). It is an aspect of the present invention that increasing an activity of p20 in a subject will inhibit or terminateinflammation in the subject. In another aspect of the present invention, a method of preventing an inflammatory response in a subject comprises increasing an activity of a p20 in the subject. The activity of p20 can be increased, for examples, byadministering p20 polypeptide or nucleic acid encoding and capable of expression p20 to cells associated with the inflammation (or distal to the inflammation, but wherein the effects of p20 administration are felt through the reduction of inflammatoryfactors from the cells which travel to other sites in the tissue, organ, or body).

3.30 Expression of p20 Inhibits C/EBP.beta. Mediated Transactivation

The inventors determined whether they could transfect cells with a construct expressing the p20 gene and whether this would inhibit C/EBP.beta.-dependent gene expression. The commonly used RSV promoter contains a C/EBP.beta. binding site and isregulated by C/EBP.beta., but the CMV promoter does not contain a C/EBP.beta. binding site and is not regulated by C/EBP.beta.. The inventors co-transfected cells with an RSV-luciferase construct (pRSV-luc) and a CMV-p20 (pCMV-p20) construct andmeasured luciferase in cell lysates as the outcome variable. FIG. 10A shows luciferase in a series of studies in which the amount of pRSV-luc was held constant while varying the amount of pCMV-p20 (and keeping total DNA constant with irrelevant plasmidDNA). There is a clear dose-related inhibition of luciferase expression by co-transfection with the p20 expression vector (FIG. 10A). These data demonstrate that delivery of a functioning p20 gene to mammalian cells achieves inhibition of C/EBP.beta. related gene expression.

3.40 Treatment of an Inflammatory Response with p20

In normal cells or in a normal inflammatory response, there is an down-regulation of the expression of pro-inflammatory mediators (such as, IL-6 and IL-8) in cells or tissues which corresponds to the resolution phase of the inflammatory reaction. CF cells are characterized by a persistent inflammatory response and the data presented in FIG. 6A show that stimulated CF cells exhibit a dysfunctional autoregulation (or down-regulation) of IL-6 and IL-8 expression. Additional data in IPF fibroblastsdemonstrate that these cells display a characteristic dysfunction of C/EBP.beta. activity with over stimulation of full length C/EBP.beta. (C/EBP.beta.-1 and/or C/EBP.beta.-2) production in the IPF fibroblasts in response to stimulation with PGE.sub.2and IL-1.

Furthermore, the inventors have discovered that an increase in the expression of the p20 isoform of C/EBP.beta. is correlated with the resolution of inflammation in normal cells, but that the increase in expression of p20 in the CF cells isdysfunctional (non-existent or nearly non-existent, see FIG. 6B). Thus, an increase in p20 expression is a characteristic of the resolution of the inflammatory response. Accordingly, the present invention provides compositions and methods for providingp20 to a subject for the inhibition of an inflammatory response and/or the suppression of inflammation related factors (e.g., IL-6 and IL-8 cytokine production).

The inventors determined that expression of p20 in vivo, results in a decrease in inflammatory indicators. The inventors injected an adenoviral vector containing a CMV promoter driven p20 gene and a CMV driven fluorescent green protein gene(GFP) intravenously into a piglet. In this embodiment, the vector included adenoviral genetic control elements, two CMV promoters, a p20 gene sequence, a fluorescent green protein gene sequence, and an IRES genetic control element. An IRES is an"internal ribosome entry site" and is used to drive expression of multiple genes from a single transcript vector (STV).

After 72 hours, a liver-lung in situ preparation was made with the animal using standard techniques. The inventors took baseline blood and lung and liver tissue samples. While continuously monitoring perfusion flow rate and lung inflow andoutflow pressures (in order to calculate pulmonary vascular resistance), 25 ug endotoxin was added to the perfusate reservoir monitoring was continued for 2 hours; several perfusate samples were taken over this period for measurement of cytokines andprostanoids. Additional tissue samples of liver and lung were also taken at the conclusion of the experiment.

FIG. 10B shows fluorescent photomicrographs of control piglet liver and liver and lung tissue from the transfected animal at the time of the perfusion experiment. There was extensive green fluorescence in liver tissue (left panel, FIG. 10B),including in hepatocytes, but essentially no fluorescence was detected in the lungs (right panel, FIG. 10B). No specific fluorescence was observed in control untransfected liver (middle panel, FIG. 10B).

That the transgenes were expressed predominantly in the liver is also illustrated a Western blot of samples extracted from tissues taken 72 hours after endotoxin perfusion (FIG. 10C). The slightly larger size of the transgene generated p20compared to native p20 is probably because the transgene includes a histidine tag for purification the expression product. Tissue samples were also taken before (0 time) and 2 hours after (120 min) the addition of endotoxin to the perfusion Thetransgene generated p20 is detected predominantly in the liver. Endogenous p20 decreased following endotoxin treatment in both liver and lung (this is probably part of the pathology associated with a response to endotoxin). Transgene generated p20 isexuberantly expressed in the liver at baseline and after endotoxin as would be expected.

FIG. 10D shows the pulmonary vascular resistance (PVR) response to endotoxin in the transfected animal compared to the response in untransfected animals. The upper line is from control studies in which only endotoxin was given. The lower lineis the response in a pig 72 hours after intravenous delivery of an adenoviral vector containing a p20 transgene driven by a CMV promoter. This is the same p20 expression vector and animal from which the tissue for FIGS. 10B and 10C were obtained. Theendotoxin-induced PVR response was dramatically attenuated in the p20 transfected animals. Thus, administration of p20 to the animal resulted in a reduction in the inflammatory response observed to an inflammatory agent.

Human cystic fibrosis (CF) bronchial epithelial airway cells (IB3 cells) are used as an in vitro model system for analyzing the chronic inflammation of CF and identifying and quantifying treatments for such inflammation. Indicators ofinflammation were analyzed following stimulation of CF cells with TNF.alpha. (approximately 30 ng/ml of culture medium) at 0, hours, 24 hours and 48 hours post-stimulation. The IB3 cells were in one of the following groups: untransfected controls,infected with control retrovirus (e.g., pLZRS), and IB3 infected with high titer pLZRShisC/EBP.beta.-3 (for p20 expression) virus (approximately 2.times.10.sup.6 (infectious units). As shown in FIG. 13, the p20 expressing IB3 cells show an ability toresolve the inflammatory stimulation of the TNF.alpha. by 48 hours. This is similar to the case for normal cells. The control cells (untransfected and control retrovirus) show an inability to resolve the inflammatory stimulation (see FIG. 13). Thus,administering p20 to CF cells and other cells with a defective or reduced inflammation resolving capacity is a method of treating the inflammation thereof.

Without being bound to this mechanism, it is contemplated that one pathway through which p20 inhibits the inflammatory response is by competing with C/EBP.beta. (C/EBP.beta.-1 and/or C/EBP.beta.-2) for binding to the C/EBP.beta. promoterelement in the IL-6 and IL-8 genes. In this case, the ratio of C/EBP.beta. (C/EBP.beta.-1 and/or C/EBP.beta.-2) to p20 (C/EBP.beta.-3) is considered to be important to the balance of regulatory power for IL-6 and IL-8 expression. When the ratio ofC/EBP.beta. to p20 is high, the cell will express greater amounts of the pro-inflammatory cytokines IL-6 and IL-8. When the ratio of full length C/EBP.beta. to p20 is lower, the cell will express reduced amounts of these pro-inflammatory cytokines. Another pathway through which p20 is contemplated to inhibit the inflammatory response (again without being bound by mechanism) is by disrupting protein to protein interactions between full length C/EBP.beta. and NF-.kappa.B, especially in the relationto the synergistically activating promoter elements for C/EBP.beta. and NF-.kappa.B in the IL-6 and/or IL-8 genes.

In certain embodiments, p20 based therapy is used in the treatment of an inflammatory response in a subject in need thereof. In certain preferred embodiments, p20 based therapy is used in the treatment of cystic fibrosis (CF), idiopathicpulmonary fibrosis (IPF), adult respiratory distress syndrome (ARDS), allergic rhinitis, and asthma. Each of these diseases is characterized by over-exuberant or persistent inflammation, increased amounts of the pro-inflammatory cytokines, IL-6 and IL-8are produced, C/EBP.beta. is an important up-regulator of IL-6 and IL-8 expression, and nonspecific suppression of inflammation with high doses of corticosteroids has been used as therapy in each of these diseases (although the efficacy of high doescorticosteroids is doubtful in IPF and ARDS).

5.00 How to Make and Use p20 as an Anti-Inflammatory Agent

In certain embodiments, the present invention provides compositions and methods for treating an inflammation in a subject in need thereof by increasing the activity of p20 in the subject by an anti-inflammatory amount.

A preferred subject for treatment is a human or other mammal (including, but not limited to: pets, horses, racehorses, show horses, livestock (cattle, sheep, goats, etc.) and competition livestock). The exemplary subject is a human. In certainembodiments the subject is a cell in culture, wherein the cell is derived from a human or other mammal. The cell can be physiologically normal with regard to inflammation or express a deficiency or defect in the resolution of inflammation (e.g., asdetermined by detecting or measuring inflammatory factors, such as, IL-6 and IL-8).

The preferred method for increasing the activity of the p20 in the mammal is by administering a therapeutically effective amount of the p20 to a cell of the mammal. Administering the p20 to a tissue, an organ, or body component is equivalent toadministering p20 to a cell of the mammal. Such administration can be in vivo, in vitro, or ex vivo. It is preferred that p20 is combined with an excipient for administration. As used herein, the term "excipient" means the same as the phrase"pharmaceutically acceptable carrier", both terms are known in the art.

One example of a preferred method for increasing the activity of the p20 in a mammal is by administering a p20 polypeptide to a cell of the mammal. Another example of a preferred method for increasing the activity of the p20 in the subject is byadministering a nucleic acid encoding p20 to a cell of the mammal wherein the nucleic acid expresses a p20 expression product in the cell of the mammal. Alternatively, the activity of p20 can be increased in a cell by administering an exogenous compoundto stimulate p20 production in the cell. For example, TNF.alpha. stimulates p20 production, at least in normal cells.

Administration of p20 or a nucleic acid encoding p20 can be carried out by contacting the cell with the p20 or the nucleic acid encoding p20. In preferred examples, the p20 or nucleic acid encoding the p20 are mixed with a pharmaceuticallyacceptable carrier forming a pharmaceutical composition. It is preferred that administration of a pharmaceutical composition containing p20 to a cell results in the introduction of the p20 into the cell. Likewise, it is preferred that administration ofa pharmaceutical composition containing a nucleic acid encoding p20 to a cell results in the introduction of the nucleic acid into the cell and expression of the p20 from the nucleic acid in the cell.

The p20 may be made using any method known to one with skill in the art for the purposes of the present invention as long as the method of production is consistent with pharmaceutical administration of the p20. Functionally equivalent and/ormodified forms of p20 may be made using any method known to one with skill in the art for the purposes of the present invention as long as: the method of production is consistent with pharmaceutical administration of the equivalent and/or modifiedvariants of p20 and at least one biological activity of the variants (inhibition of inflammation, inhibition of inflammatory mediators (TNF.alpha., IL-1, etc.), inhibition of cytokine production (such as IL-6 or IL-8), or inhibition of clinical symptomsof inflammation) is retained such that a therapeutically effective amount of the variant can be administered. Several simple tests for determining the activity, including the anti-inflammation biological activity of p20, functional equivalents, andmodified variants are described herein.

In using p20 (including functional variants) as an anti-inflammation agent, the polypeptide form of p20 may be contacted to a cell or introduced into a cell through any of a variety of manners known to those with skill in the art. In certainembodiments, the preferred method of administering p20 polypeptide is in combination with an excipient (forming a p20 pharmaceutical composition). The p20 pharmaceutical composition may be administered by any mode or route known and to any cell, tissue,or organ of the mammal.

In preferred embodiments, the production of p20 is caused in a cell by the introduction of a nucleic acid, wherein at least a portion of the nucleic acid encodes p20 or variant thereof, wherein the nucleic acid is compatible with the cellularmachinery for the expression of the encoded product. Whether the p20 is supplied as a protein or encoded in a nucleic acid, it is preferred that it is combined with a pharmaceutically acceptable carrier for optimization of delivery. A number of suchformulations are described herein, but any that are known in the art may be employed in light of the present disclosure.

A variety of nucleic acid expression systems and methods for their introduction into a cell are known in the art and are useful in conjunction with the present invention. In general, a nucleic acid expression system is comprised of an expressionvector into which a polynucleotide insert (or inserts) can be cloned. A nucleic acid expression system may also refer to an expression vector complete with polynucleotide insert. Genetic elements are typically included in the expression vector or, incertain cases included in the insert, that drive the production or expression of the polynucleotide insert in the proper environment. The set of exogenous genetic elements for driving expression include, but are not limited to: promoters, enhancers,ribosomal binding sites, internal ribosome entry sites, polyadenylation signals, nuclear localization signals, etc. A number of these elements are described in U.S. Pat. No. 5,910,488 to Nabel et al.; incorporated herein by reference. Expressionenvironments include in vitro expression, wherein all necessary expression factors (either purified or partially purified) are added in a mixture for the support of expression. Additional environments encompass cellular expression (in vivo expression). In embodiments described herein, the preferred expression environment is a mammalian cell.

As used herein, a "p20 nucleic acid expression system" includes an expression vector and a p20 polynucleotide insert, designed for expression of p20 in a mammalian cell. At least a portion of the p20 insert encodes a p20 polypeptide. The codingsequence may or may not be interrupted, such as with a recombinant intron. Such expression can result in the generation of p20 mRNA. Such expression also can result in the generation of p20 protein in the targeted cells.

Techniques for obtaining a p20 polynucleotide sequence and for incorporating the sequence into an appropriate expression system are known in the art (Descombes et al. (1991) Cell:569 579, incorporated herein by reference; U.S. Pat. No.5,215,892 to Kishimoto et al., incorporated herein by reference; and U.S. Pat. No. 5,360,894 to Kishimoto et al., incorporated herein by reference). The selection of specific restriction endonucleases to cleave the expression vector and to cleave ap20 polynucleotide sequence is known to one of skill in the art and is aided by the sequence listings and FIGS. 2A 2D, 3A 3F. The cloning of a p20 polynucleotide into a vector containing a CMV promoter is described in FIG. 11. Methods for ligating theexpression vector with one insert in the proper orientation for expression and methods for selection and analysis of p20 expression vector clones including sequencing of the clones by dideoxy sequencing (the Sanger method and variations thereof) are allknown to one with ordinary skill in the art. Furthermore, methods for inserting multiple p20 inserts (including multiple variants) or p20 and a non-p20 expression insert into an expression vector are known in the art. In certain embodiments, aninternal ribosome entry site (IRES) is used to drive expression of multiple copies of p20 from a single transcript vector (STV); as described in U.S. Pat. No. 4,937,190 to Palmenberg et al., incorporated herein by reference.

For example, RNA or DNA encoding p20 may be introduced to the cell by any manner known in the art. In certain preferred embodiments, the p20 is introduced into the cell through the introduction of a DNA segment which encodes p20. In some suchembodiments, it is envisioned that the DNA segment further comprises the p20 gene operatively linked to expression control sequences. The p20 gene may be operatively linked to a suitable promoter and a suitable terminator sequence. The construction ofsuch gene/control sequence DNA constructs is well-known within the art. In particular embodiments, the promoter is selected from the group consisting of CMV, SV40 IE, and RSV LTR. The construction and use of the CMV promoter is described in U.S. Pat. No. 5,385,839 to Stinski, incorporated herein by reference and U.S. Pat. No. 5,168,062 to Stinski, incorporated herein by reference.

In certain embodiments, the DNA segment and expression control sequences may be located on a vector, preferably an expression vector. For example, a preferred expression vector is a plasmid DNA expression vector. Another preferred vector is aviral-based expression vector. The viral vector may be, for example, a retroviral vector or an adenoviral vector, or another vial-based vector. The genetic elements of a viral derived vector may have been subsequently modified by nature or by the handof man. Preferably, the viral-based expression vector with a p20 insert supports the expression of p20 in a mammalian cell to which the vector is introduced, especially a human cell. The term "insert" refers to the nucleic acid segment orpolynucleotide incorporated into the vector for expression. Preferred inserts include nucleic acids encoding p20. The insert may include non-coding polynucleotide sequences such as restriction enzyme sites and introns. The vector may be used todeliver a p20 gene to a cell in certain gene therapy embodiments of the invention. Also, such vectors can be used to transform cultured cells, and such cultured cells could be used, inter alia, for the expression of p20 gene products in vitro and forthe transfer of p20 expressing cells into a compatible mammalian host (ex vivo gene transfer).

Methods of identifying an inflammatory response or symptom of inflammation are known in the art. Such methods include observation or measurement of increased inflammatory cells (e.g., neutrophils, macrophages, lymphocytes (T-cells and B-cells),cytotoxic natural killer cells, and eosinophils) and mediators (e.g., IL-6, IL-8, and IL-1) in the organ or tissue and clinical signs and symptoms. Classic symptoms of inflammation include pain, heat, redness, swelling, and loss of function. Histologically dilatation of arterioles, capillaries, and venules, with increased permeability and blood flow is seen in inflammation. Exudation of fluids, including plasma proteins; and leukocyte migration into the inflammatory focus is also observed.

Pharmaceutical formulations for both protein and nucleic acid based therapeutics, dosage, modes and routes of administration, and methods of measuring therapeutic effectiveness are known to those with skill in the art and any of these methods andformulations may be used in conjunction with the present invention provided that they are pharmaceutically acceptable. Several of these compositions and methods are described herein.

5.01 Special Considerations for C/EBP.beta.-3 Expression

In certain embodiments, it is preferred that nucleic acids for the expression of p20 include the full length C/EBP.beta. gene sequence (e.g., SEQ ID NO:1 genomic human, SEQ ID NO:2 C/EBP.beta.-1 CDS). Using such compositions and methods hascertain advantages including the possibility of a more natural distribution of expression (cell type and temporal) by inclusion of additional C/EBP.beta. genetic control elements (both known and unknown). Also, if p20 is generated by a proteolyticmechanism within the cell, then the synthesis (meaning expression) of C/EBP.beta.-1 from an exogenously introduced nucleic acid is contemplated to result in the production of p20 by these mechanisms. However, it is preferred that C/EBP.beta.-2, andoptionally, C/EBP.beta.-1 are not expressed from the C/EBP.beta. encoding nucleic acid. Therefore, in certain preferred embodiments, the nucleic acid is modified to prevent a production of the C/EBP.beta.-2 isoform.

Possible modes of C/EBP.beta.-2 production include, but are not limited to: translation initiation at the C/EBP.beta.-2 ATG translation initiation start site, proteolytic cleavage of a more encompassing polypeptide (e.g., a C/EBP.beta.-1polypeptide), RNA processing, and blockage of other translation initiation start sites (e.g., the C/EBP.beta.-1 AUG). Any of these modes of C/EBP.beta.-2 production, and others, can be blocked to prevent C/EBP.beta.-2 expression.

The preferred method of preventing C/EBP.beta.-2 isoform production from a C/EBP.beta. polynucleotide is by using site-directed mutagenesis to eliminate the C/EBP.beta.-2 translation initiation start site (located in human CEBPB at approximatelypositions 368 370 of SEQ ID NO:1, see FIG. 3A). It is also preferred that alternative sequences of C/EBP.beta. such as mouse and rat C/EBP.beta. are modified to eliminate the C/EBP.beta.-2 translation initiation start site. As a result of theelimination of the C/EBP.beta.-2 translation start site, C/EBP.beta. polynucleotides (including C/EBP.beta.-1) are not able to, or do not, express C/EBP.beta.-2 in cells into which they are introduced. These nucleic acids will express p20 and arecontemplated to express C/EBP.beta.-1.

Optionally, it is preferred to prevent expression of both C/EBP.beta.-1 and C/EBP.beta.-2 from a C/EBP.beta. clone. The preferred method for preventing C/EBP.beta.-1 expression from a C/EBP.beta. clone is the same as for C/EBP.beta.-2;elimination of the ATG translation initiation site. These nucleic acids will express p20 only. These methods may apply to any expression of p20 (in vitro, in vivo, ex vivo, etc.)

In certain embodiments, it is preferred to enhance the expression of p20 from a nucleic acid. For example, a polynucleotide segment including p20 is mutated through site-directed mutagenesis to create a Kozak sequence at the C/EBP.beta.-1translation initiation site (approximately positions 299 to 301 in SEQ ID NO:1(see FIG. 3A). The use of a Kozak sequence to enhance expression of a gene is well known in the art. In the present invention, the Kozak sequence may be used to selectivelyenhance the expression of one C/EBP.beta. isoform over another For example, p20 expression is enhanced over C/EBP.beta.-1 and C/EBP.beta.-2 expression through the use of a Kozak sequence at the p20 start site.

If undesirable proteolytic digestion of C/EBP.beta.-1, C/EBP.beta.-2, or C/EBP.beta.-3 (p20) is found to occur in a particular system, the protease binding site can be optionally mutated to prevent proteolysis. Significant proteolytic cleavageis not expected to arise, however. In other methods, the C/EBP.beta. isoform protein can be combined with a protease inhibitor, protein stabilizing agent, or stored under protein stabilizing conditions (i.e., refrigeration, freezing, desiccated, etc.).

5.02 Special Considerations for Nuclear Import

It is believed by the inventors that p20 acts in the nuclear compartment of the cell (without being bound to mechanism). Therefore, in certain preferred embodiments, compositions including a p20 sequence contain a nuclear localization sequence(NLS) to facilitate nuclear import (either peptide or encoding nucleic acid). C/EBP.beta. contains two putative NLS segments. Both of these segments are in the p20 portion of the C/EBP.beta. gene/polypeptide as determined by PSORT II an onlinesequence analysis tool.

The results of the PSORT II analysis tool predict that KKTVDKHSDEYKIRR (SEQ ID NO:19 and NLS A in FIG. 5) and RRERNNIAVRKSRDKAK (SEQ ID NO:20 and NLS B in FIG. 5) are nuclear localization sequences. Both of these sequences are located in theC-terminal portion of C/EBP.beta. reference sequence and are contained within p20. In certain embodiments of the present invention, any NLS may function to facilitate nuclear import of p20 (see e.g., Stochaj et al. (1993) J of Cell Science 104:89 95,incorporated herein by reference). A preferred NLS is RRERNNIAVRKSRDKAK (SEQ ID NO:16) and certain preferred polypeptide sequences (or encoding nucleic acids) will include this peptide sequence (or encoding nucleic acid sequence). An even morepreferred NLS is KKTVDKHSDEYKIRR (SEQ ID NO:15) and certain even more preferred polypeptide sequences (or encoding nucleic acids) will include this peptide sequence (or encoding nucleic acid sequence). In certain embodiments, preferred sequences willinclude both NLS A and NLS B (FIG. 5). The threonine with an "*" over it in FIG. 5 and at approximately position 68 (SEQ ID NO:7) is a potential phosphorylation site that the inventors believe may enhance p20 activity. In certain preferred embodiments,polypeptides (or encoding nucleic acids) will include this threonine.

5.10 Preferred and Alternative Sequences of p20

Preferred polynucleotide and polypeptide sequences of p20 are the human reference or consensus sequences. The p20 sequence can be found in databases provided by the National Center for Biotechnology Information (NCBI) located at the UnitedStates National Library of Medicine (NLM). The NLM is physically located at 8600 Rockville Pike, Besthesda, Md. 20894; phone: 301-594-5983. One of ordinary skill in the art is able to use the identification assignments shown in FIGS. 2A 2D todetermine the reference or consensus sequence for human and mouse C/EBP.beta., respectively. The positions of C/EBP.beta.-1, C/EBP.beta.-2, and C/EBP.beta.-3 (p20) within the C/EBP.beta. sequence can be determined through the literature by one ofordinary skill in the art and are provided in FIGS. 3A 3F).

FIG. 1 provides a diagram of the genetic structure of the C/EBP.beta. gene and the relationship between C/EBP.beta.-1, C/EBP.beta.-2, and C/EBP.beta.-3 (p20) isoforms. It is believed that the expression products of the isoforms arise in thecell from a leaky ribosomal translation initiation of a single mRNA polynucleotide. However, the present invention is not bound by this mechanism of production. It is also possible that the C/EBP.beta.-2 and/or p20 protein isoforms arise in the cellthrough proteolytic cleavage of a longer polypeptide (i.e., C/EBP.beta.-1 or C/EBP.beta.-2, respectively); however, the inventors do not believe this mechanism to be correct or, at least, physiologically relevant. The mechanism is not important becauseit is shown herein that p20 functions as an anti-inflammatory agent. In addition, for a given population of cells, it is shown herein that p20 inhibits the production of the pro-inflammatory cytokines IL-6 and IL-8.

It is evident from FIG. 1 that C/EBP.beta.-1, C/EBP.beta.-2, and C/EBP.beta.-3 (p20) are all generated from the genetic material of the CEBPB locus in mammalian genomes. The genomic DNA for the C/EBP.beta. gene does not contain an intron; thus,the mRNA corresponds to the genomic sequence without interruption. All three isoforms of C/EBP.beta. have similar 3' or C-terminal ends (DNA, RNA, or protein). In humans, C/EBP.beta.-1 is comprised of about 345 amino acids (SEQ ID NO:5 and FIG. 3B)coded for by about 1038 nucleotides (including the TAG stop codon) (SEQ ID NO:2 and FIG. 3A). Human C/EBP.beta.-2 is comprised of the about 322 C-terminal amino acids (SEQ ID NO:6) coded for by the about 969 nucleotides (SEQ ID NO:3). HumanC/EBP.beta.-3 (p20) is comprised of the about 147 C-terminal amino acids (SEQ ID NO:7) coded for by the about 444 nucleotides (SEQ ID NO:4). The human C/EBP.beta. isoforms are best viewed in FIGS. 1, 3A, and 3B.

A preferred p20 polynucleotide is the human p20 nucleic acid coding sequence set forth in SEQ ID NO:4 and shown in FIG. 3A. This is the "consensus" human C/EBP.beta.-3 polynucleotide consisting of approximately the 444 basepairs and a portion ofthe sequence identified by Accession Number X52560 in GenBank as annotated in FIG. 3A. The C/EBP.beta.-3 isoform of the CEBPB gene originates from the third in frame "ATG start codon" FIGS. 1 and 3A).

A preferred p20 polypeptide is the human p20 peptide sequence set forth in SEQ ID NO:7 and shown in FIG. 3B. Information provided by LocusLink on the C/EBP.beta. polypeptide is shown in FIGS. 2A 2D. The consensus p20 polypeptide can be used inthe present invention. It is preferred that pharmaceutical formulations of p20 are in a purified form containing minimal amounts of C/EBP.beta.-1 or C/EBP.beta.-2. In certain embodiments, pharmaceutical formulations including partially purified p20 arepreferred. Minimal amounts of C/EBP.beta.-1 or C/EBP.beta.-2 means herein that p20 is the major protein in the purified composition. In certain preferred embodiments, p20 accounts for about 51% or more of the protein in the sample Protein compositioncan be determined easily by SDS-PAGE and silver staining techniques as is known in the art and may include Western blot techniques for further identification. The amount of each type of protein in a lane of a silver stained gel can be measureddensitometrically. In certain more preferred embodiments, p20 accounts for about 52% to about 85% of the protein in the sample; in even certain more preferred embodiments, p20 accounts for about 85% to about 95% or more of the protein in the sample; instill more preferred embodiments, p20 accounts for about 99% or more of the protein in the sample. The sample then being used to mix with a pharmaceutically acceptable carrier forming a pharmaceutical composition or formulation.

Alternative p20 sequences include the mouse p20 nucleotide sequence of approximately positions 560 to 998 of SEQ ID NO:8 (FIG. 3C) and the mouse p20 polypeptide sequence of approximately residues 152 to 196 of SEQ ID NO:9 (FIG. 3D). The mousep20 coding sequence (CDS) is located at approximately residues 560 to 998 (including the TAG stop codon) of SEQ ID NO:8 (FIG. 3C). The basic isoform structure of the mouse CEBPB locus is similar to the human structure as shown in FIG. 1 and FIG. 4A. FIG. 4A shows one possible alignment of the human and mouse C/EBP.beta. polypeptides along with the start site of each C/EBP.beta. isoform and the C-terminal cysteine at about position 345 (human) or 296 (mouse) in the peptide sequences. In thisalignment, gaps in the mouse polypeptide relative to the human polypeptide are shown as dashes and identical amino acids (residues) are shown by the star symbol "*". Non-identical amino acids are shown by a space.

5.20 Biological Functional Equivalents

In certain embodiments, it is desirable to utilize biologically functional equivalents of polypeptides and polynucleotides described herein. Preferred and alternative polynucleotide and polypeptide sequences useful for embodiments of the presentinvention are provided herein. Thus, it is generally not necessary to identify additional polynucleotide or polypeptide sequences to practice the present invention. However, as is known to one with skill in the art, the biological function or activityof a gene product may not correspond directly to an absolute polynucleotide or polypeptide sequence of the gene product. Therefore, the inventors specifically contemplate that alterations to sequences provided herein, including in the Sequence Listingsof this Specification, may be made or used wherein the altered sequences, or methods of use thereof, are equivalent to sequences, or methods of use thereof, and are within the spirit and scope of the present invention. These equivalent sequences arereferred to as biologically functional equivalents, or simply as functional equivalents. Functional equivalents can include, but are not limited to: conservatively modified variants, degeneracy of the nucleic acid code, polymorphisms, certain insertionsand deletions, and certain length variants. Methods for altering sequence residues and testing the altered sequences for function or activity are known in the art or described herein. These alterations may be natural or made by the "hand of man".

At the nucleotide level, different codons can encode the same amino acid. In other words, the genetic code is degenerate (Alberts et al., Molecular Biology of the Cell, (1989) 2nd Edition, Garland Publishing, Inc., and incorporated herein byreference). The terms "wobble" and "nucleic acid degeneracy" are used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine. FIG. 12 lists the preferred human codons. The codons are listed indecreasing order of preference from left to right in the table (Wada et al. (1990) Nuc. Acids. Res., 18:2367 2411, included herein by reference). Codon preferences for other organisms also are well known to those of skill in the art (Wada et al.,1990, supra). Thus, one with skill in the art knows that two different polynucleotides can encode identical polypeptide sequences due to codon wobble.

It is understood in the art that amino acid and nucleic acid sequences may include additional residues, such as additional N-terminal or C-terminal amino acids or 5' or 3' sequences, and yet still be essentially as set forth in one of thesequences disclosed herein; so long as the sequence meets the criteria set forth herein, including the maintenance of at least one biological protein activity where protein expression is concerned. The addition of terminal sequences particularly appliesto nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes betweencoding regions (Alberts et al., supra, incorporated herein by reference). Thus; about 1, 2, 3, 4, 5, 6, 7, or more than 7 amino acids could be added to a polypeptide and the polypeptide may still retain at least one biological activity. Or; about 1, 2,3, 4, 5, 6, 7, or more than 7 nucleotides could be added to a polynucleotide and expression products of the polynucleotide may still retain at least one biological activity.

It also is understood in the art that amino acid and nucleic acid residues may be removed from the N-terminal or C-terminal ends of polypeptide or 5' or 3' ends of polynucleotide sequences, and yet still be essentially as set forth in one of thesequences disclosed herein; so long as the sequence meets the criteria set forth herein, including the maintenance of at least one biological protein activity where protein expression is concerned. The removal of terminal sequences particularly appliesto nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes betweencoding regions (Alberts et al., supra, incorporated herein by reference). Thus; about 1, 2, 3, 4, 5, 6, 7, or more than 7 amino acids could be removed from a polypeptide and the polypeptide may still retain at least one biological activity. Or, about1, 2, 3, 4, 5, 6, 7, or more than 7 nucleotides could be removed from a polynucleotide and expression products of the polynucleotide may still retain at least one biological activity.

C/EBP.beta. does not contain an intron as found in various organisms including, but not limited to: human, mouse, and rat. However, if desired, it is possible using techniques known to one with skill in the art, to include an intron in arecombinant C/EBP.beta. polynucleotide sequence. For example, a bovine growth hormone (bGH) intron including splice sites may be added. In certain instances, the addition of an intron to a recombinant polynucleotide has been observed to increaseexpression of the encoded expression product in eukaryotic cells. It is understood that the addition of an intron creates a functionally equivalent sequence.

It is understood further in the art that insertions and deletions may be made within the amino acid and nucleic acid sequence, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets thecriteria set forth herein, including the maintenance of biological protein activity where protein expression is concerned. In general, insertions or deletion of residues in the coding region of a listed nucleic acid encoding a p20 protein should be madesuch that the net insertion or deletion is a multiple of 3. Thus, it is preferred that the reading frame of the polynucleotide sequence be maintained, as is known in the art (Alberts et al., supra, incorporated herein by reference).

Excepting intronic or flanking regions, and allowing for the degeneracy of the genetic code, sequences that have between about 70% and about 79%; or more preferably, between about 80% and about 89%; or even more preferably, between about 90% andabout 99% of nucleotides that are identical to the nucleotides shown in the sequences of SEQ ID NO:1 4, 8, 10 and 17 20 will be sequences that are "essentially as set forth in SEQ ID NO:1 4, 8, 10 and 17 20". Sequences that are essentially the same asthose set forth in SEQ ID NO:1 4, 8, 10 and 17 20 also may be functionally defined as sequences that are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO:1 4, 8, 10 and 17 20 under high stringency conditions. Suitable conditions are described in the summary herein.

At the protein level, peptide sequences that are essentially the same, in general, are capable of cross-reacting with antibody raised against the respective peptide factor. However, in the case of C/EBP.beta., an antibody raised against aC-terminal epitope that is common to each isoform will then cross-react with each isoform containing the common epitope. Thus, for example, one may wish to use an antibody raised against the peptide in SEQ ID NO:14 for the positive identification ofC/EBP.beta.-1. Methods for isolating, resolving, and analyzing protein/antibody interactions are well known in the art including techniques such as SDS-PAGE and Western analysis. Using SDS-PAGE and Western analysis in conjunction with the C-terminalC/EBP.beta. antibody (FIG. 1), one with skill in the art can resolve and identify proteins that cross react with p20 from biological samples through observation of molecular weight and reaction with the antibody. Polypeptides that cross react with p20and migrate with a similar molecular weight are essentially the same as p20 (the molecular weight is not absolute, because some N-terminal or C-terminal amino acids may be added as described above (or encoded in a nucleic acid)).

Naturally, the present invention also encompasses nucleic acid segments that are complementary, or essentially complementary, to the sequences set forth in SEQ ID NO:1 4, 8, 10 and 17 20. Nucleic acid sequences that are "complementary" includethose that are capable of base-pairing according to the standard Watson-Crick complementarity rules. As used herein, the term "complementary sequences" means nucleic acid sequences that are substantially complementary, as may be assessed by the samenucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO:1 4, 8, 10 and 17 20 under high stringency conditions.

The nucleic acid segments of the present invention, regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiplecloning sites, other coding segments, nuclear localization sequences, membrane transport sequences, and the like, such that their overall length may vary considerably. It is therefore contemplated that a nucleic acid fragment of almost any length may beemployed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol. Therefore, the terms "p20 gene" or "p20 polynucleotide" may also comprise any combination of associated controlsequences. Furthermore, those skilled in the art of mutagenesis will appreciate that other analogs, as yet undisclosed or undiscovered, may be used to construct p20 analogs (mutants, variants, etc). Additional meanings of biological functionalequivalents, similarity, percent similarity, equivalents, substantially identical sequences, essentially the same, and essentially similar sequences and activities are described in U.S. Pat. No. 5,922,688 to Hung et al., incorporated herein byreference.

Naturally, the present invention also encompasses peptides and polypeptides (or the nucleic acid sequences that encode such peptides and polypeptides) that contain conservatively modified variants of the sequences listed in the Sequence Listings. One with skill in the art is able to readily determine conservative sequence modifications. In the case of a polypeptide, amino acid substitutions, such as those which might be employed in modifying C/EBP.beta. are generally based on the relativesimilarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like.

An analysis of the size, shape and type of the amino acid side-chain substituents reveals that arginine, lysine and histidine are all positively charged residues; that alanine, glycine and serine are all a similar size; and that phenylalanine,tryptophan and tyrosine all have a generally similar shape. Therefore, based upon these considerations, arginine, lysine and histidine; alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine; are defined herein as biologicallyfunctional equivalents.

In making such changes, the hydropathic index of amino acids may be considered. Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics, these are: isoleucine (+4.5); valine (+4.2);leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte et al., J. Mol. Biol. (1982) 157(1):105 32, incorporated herein by reference). It is knownthat certain amino acids may be substituted for other amino acids having a similar hydropathic index or score and still retain a similar biological activity. In making changes based upon the hydropathic index, the substitution of amino acids whosehydropathic indices are within .+-.2 is preferred, those which are within .+-.1 are particularly preferred, and those within .+-.0.5 are even more particularly preferred.

It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Pat. No. 4,554,101 to Hopp, incorporated herein by reference, states that the greatest local averagehydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and antigenicity, i.e. with a biological property of the protein. It is understood that an amino acid can be substituted foranother having a similar hydrophilicity value and still obtain a biologically equivalent protein.

As detailed in U.S. Pat. No. 4,554,101, supra, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0.+-.1); glutamate (+3.0.+-.1); serine (+0.3); asparagine (+0.2);glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5.+-.1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

In making changes based upon similar hydrophilicity values, the substitution of amino acids whose hydrophilicity values are within .+-.2 is preferred, those which are within .+-.1 are particularly preferred, and those within .+-.0.5 are even moreparticularly preferred.

While discussion has focused on functionally equivalent polypeptides arising from amino acid changes, it will be appreciated that these changes may be effected by alteration of the encoding DNA; taking into consideration also that the geneticcode is degenerate and that two or more codons may code for the same amino acid.

5.30 Sequence Modification Techniques

Modifications to p20 sequences may be made during chemical synthesis of the polymers (either nucleotide or peptide synthesis). Although, chemical synthesis of p20 polymers is possible, it is not cost effective at the time of filing. Therefore,the preferred method for changing the sequence of a p20 polymer is through site directed mutagenesis of an encoding nucleic acid, i.e., human CEBPB (SEQ ID NO:1). Where the p20 protein is desired, then the mutated sequence is expressed in culture (invitro or ex vivo) or in vivo through administration and expression in cells of the mammal in need of treatment.

Site-specific mutagenesis is a technique useful in the preparation of individual peptides, or biologically functional equivalent proteins or peptides, through specific mutagenesis of the underlying DNA. Several methods for site directedmutagenesis are described in U.S. Pat. No. 4,873,192 to Kunkel, incorporated herein by reference and in U.S. Pat. No. 4,351,901 to Ball, incorporated herein by reference. The technique further provides a ready ability to prepare and test sequencevariants, for example, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA. Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotidesequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletionjunction being traversed. Typically, a primer of about 14 to about 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence being altered.

The technique of site-specific mutagenesis is well known in the art as exemplified by publications (Adelman et al., (1983) DNA 2(3)183 193, incorporated herein by reference). As will be appreciated, the technique typically employs a phage vectorwhich exists in both a single stranded and double stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the M13 phage. These phage are readily commercially available and their use is well known to those skilled inthe art. Double stranded plasmids are also routinely employed in site directed mutagenesis which eliminates the step of transferring the gene of interest from a plasmid to a phage. Kits for phage based site directed mutagenesis are commerciallyavailable. In addition PCR based methods which may, or may not, involve phage are known in the art and kits for such purposes are commercially available.

In certain known techniques, site-directed mutagenesis is performed by first obtaining a single-stranded vector or melting apart the two strands of a double stranded vector which includes within its sequence a DNA sequence which encodes thedesired CEBPB isoform. An oligonucleotide primer bearing the desired mutated sequence is prepared, generally synthetically as is known to one of ordinary skill in the art. This primer is then annealed with the single-stranded vector, and subjected toDNA polymerizing enzymes such as Escherichia coli (E. coli) polymerase I Klenow fragment, in order to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non-mutated sequence andthe second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate cells, such as E. coli cells, and clones are selected which include recombinant vectors bearing the mutated sequence arrangement. Variousselection methods that increase the percentage of specifically modified clones over wild-type are known and available commercially.

Kalderon et al. (1984) report several mutagenic methods which have proved useful in mutating the native LT gene. Specifically, Kalderon et al. teach deletion mutations by displacement-loop mutagenesis and by the random insertion of Eco RIlinkers into the LT gene. Further, point mutation by deletion-loop mutagenesis is taught. The reference also teaches screening procedures for determining the success of such mutations. The teachings of Kalderon et al. (1984) Virology 139(1)109 137 areincorporated herein by reference.

The preparation of sequence variants of the selected gene using site-directed mutagenesis is provided as a method of producing potentially useful p20 and is not meant to be limiting as there are other ways in which sequence variants of thesepeptides may be obtained. For example, recombinant vectors encoding the desired genes may be treated with mutagenic agents to obtain sequence variants for the mutagenesis of plasmid DNA using hydroxylamine or random mutagenesis may be performed usingthe PCR technique. Sequence analysis of a potentially mutant nucleic acid sequence is carried out by methods known in the art, typically by either Sanger dideoxy sequencing (Sanger et al., PNAS (1977) 74:5363 5467, incorporated herein by reference; U.S. Pat. No. 4,871,929 to Barnes; and U.S. Pat. No. 4,962,020 to Tabor et al., each patent incorporated herein by reference) or automated sequencing (U.S. Pat. No. 5,365,455 to Tibbetts et al., incorporated herein by reference).

In addition to the C/EBP.beta. peptidyl compounds described herein, the inventors also contemplate that other sterically similar compounds may be formulated to mimic the key portions of the peptide structure. Such compounds may be used in thesame manner as the peptides of the invention and hence are also functional equivalents. The generation of a structural functional equivalent may be achieved by the techniques of modeling and chemical design known to those of skill in the art. It willbe understood that all such sterically similar constructs fall within the scope of the present invention.

In addition to sequence equivalents, the inventors also specifically contemplate further biological variations of p20 that are functionally equivalent to p20. For example, p20 may be altered by phosphorylation, glycosylation, or other biologicalmodification. The expression of p20 in mammalian cells is known to result in a biologically active molecule with regard to these additional modifications, as demonstrated herein. Sequences modified by any technique can be tested for biological activityaccording to known methods including those described in the Examples section in order to determine if that modified sequence is an equivalent, a conservatively modified variant, a biologically function equivalent, a biological variant, or is otherwisesimilar to a sequence described or listed herein.

5.40 Polynucleotide Compositions and Methods of Use thereof

In certain exemplary embodiments, the administration of an anti-inflammatory amount of p20 includes introducing a nucleic acid to a cell, wherein the nucleic acid includes a polynucleotide insert having at least a portion encoding p20. It ispreferred to administer the nucleic acid directly to a cell in the mammal and that an anti-inflammation amount of p20 is expressed in the cell. These methods may be referred to as in vivo gene therapy or p20 gene therapy. However, other methods areacceptable including ex vivo administration to a cell taken from the mammal or administration to a cell from another organism that is compatible with introduction into the mammal (not immunogenic to the mammal).

It is preferred that the nucleic acid including the polynucleotide segment encoding p20, further include an expression vector operatively linked to the segment and include at least one control element for expression of the p20 isoform in thecell. In a general sense, the polynucleotide segment is often referred to as an "insert" or an "expression vector insert". The construction and use of expression vectors in genetic expression systems is well known in the art. In general, an insertencoding a factor to be expressed is cloned into the expression vector utilizing a bank of restriction sites located such that control elements in the vector will regulate expression of the insert (expression of a product from the insert). Geneticcontrol elements may also be included in the insert. Exogenous genetic elements for driving expression include, but are not limited to: promoters, enhancers, ribosomal binding sites, nuclear localization sequences, membrane transport sequences,polyadenylation signals, etc. A number of these elements are described in U.S. Pat. No. 5,910,488 to Nabel et al.; incorporated herein by reference. The terms "control elements", "genetic regulatory elements", "genetic control elements", andgrammatically similar expressions are used interchangeably herein. In certain embodiments, preferred inserts include, but are not limited to, the p20 polynucleotide segment (SEQ ID NO:4).

Numerous gene expression systems or expression vectors, methods for the construction of the expression vectors, methods for the insertion of desired nucleic acid sequences into the vectors, and methods for optimizing gene product expression fromthe vectors in various cells are known to those with skill in the art and may be used in conjunction with the present invention. The specific insertion of nucleic acid sequences encoding p20 into an expression vector of choice will be obvious to onewith skill in the art including the techniques of molecular cloning which are described by numerous sources (see, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press), incorporated herein byreference). In certain preferred embodiments, the expression vector contains the nucleic acid sequence encoding p20 along with various genetic elements that promote the constitutive or inducible expression of the desired gene product.

5.41 Expression Vectors

Many desirable expression vectors, including plasmid expression vectors, are available through commercial sources (e.g., Roche, Stratagene, In Vitrogene, Promega, etc) and are useful for the expression of p20 in mammalian cells. In certainembodiments, the nucleic acid is transcribed and it is preferred that the resulting transcript is translated into a protein. Thus, in certain embodiments, expression includes both transcription of a gene and translation of a RNA into a gene productincluding p20. In other embodiments, expression only includes transcription of the nucleic acid, for example, to generate antisense constructs.

Particularly useful vectors are contemplated to be those vectors in which a coding portion of the DNA segment, whether encoding a full length protein, polypeptide or smaller peptide, is positioned under the transcriptional control of a geneticcontrol element. One highly preferred control element includes a promoter. In certain aspects "promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specifictranscription of a gene. The phrases "operatively positioned", "under control" "regulates", or "under transcriptional control" include the meaning that the promoter is in the correct location and orientation in relation to the nucleic acid to controlRNA polymerase initiation and expression of the gene. These terms are known to one of ordinary skill in the art.

The promoter may be in the form of the promoter that is naturally associated with a gene, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment or exon, for example, using recombinant cloning and/orpolymerase chain reaction (PCR.TM.) technology (see U.S. Pat. No. 4,683,202 to Mullis; U.S. Pat. No. 4,683,195 to Mullis et al.; U.S. Pat. No. 4,800,159 to Mullis et al.; U.S. Pat. No. 4,965,188 to Mullis et al.; U.S. Pat. No. 5,656,493 toMullis et al.; each patent incorporated herein by reference).

In other embodiments, it is contemplated that certain advantages will be gained by positioning the coding DNA segment under the control of a recombinant, or heterologous, promoter. As used herein, a recombinant or heterologous promoter isintended to refer to a promoter that is not normally associated with a gene in its natural environment. Such promoters may include promoters normally associated with other genes, and/or promoters isolated from any other bacterial, viral, eukaryotic, ormammalian cell, and/or promoters made by the hand of man that are not "naturally occurring," i.e., containing elements from different promoters, or mutations that increase, decrease, or alter expression.

Naturally, it will be important to employ a promoter that effectively directs the expression of the DNA segment in the cell type, organism, or mammal, chosen for expression; the exemplary mammal being a human. The use of promoter and cell typecombinations for protein expression, including various types of human cells, is known to those of skill in the art of molecular biology (for example, see Sambrook et al. (1989), supra). The promoters employed may be constitutive, or inducible, and canbe used under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins or peptides.

Generally at least one module in a promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminaldeoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.

Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region about 30 110 base pairs upstream of the start site, although a number of promoters have been shown to containfunctional elements downstream of the start site as well. The spacing between promoter elements is often observed to be flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter,the spacing between promoter elements can be increased to 50 basepairs apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription.

In certain embodiments, the particular promoter that is employed to control the expression of a nucleic acid is not believed to be critical, so long as it is capable of expressing the nucleic acid in the targeted cell. Thus, where a human cellis targeted, it is preferable to position the nucleic acid coding region adjacent to and under the control of a promoter that is capable of being expressed in a human cell. Generally speaking, such a promoter might include either a human or viralpromoter. In other embodiments, a particular promoter that directs expression to a certain tissue or allows for regulation of expression by an additional control element may be desired. The selection and use of such particular promoters will beapparent to those with skill in the art (see, e.g., U.S. Pat. No. 5,858,774 to Malbon et al.; Gene-Expression Systems (1998) Fernandez et al., eds. Academic Press; M. Kriegler, Gene Transfer and Expression: A Laboratory Manual (1991) Oxford UniversityPress; Gene Therapy of Cancer (1999) Lattime et al., (eds.) Academic Press; and Gene Expression: General and Cell Type Specific (1993) M. Karin (ed.) Birkhauser; each reference being incorporated herein by reference).

In various embodiments, the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, and the Rous sarcoma virus long terminal repeat can be used to obtain high-level expression of the nucleic acid. The use of otherviral or mammalian cellular promoters which are well-known in the art to achieve expression are contemplated as well, provided that the levels of expression are sufficient for a given purpose as stated in the specification including the claims. Forexample, in certain embodiments herein, the purpose is the treatment of an inflammatory response and inhibition of pro-inflammatory mediators (e.g., IL-6 and IL-8). Elements and promoters from the following genes and viral genomes may be useful, in thecontext of the present invention, to regulate the expression of a gene: .beta.-Actin, metallothionein, H2B (TH2B) histone, mouse or type I collagen, SV40, polyoma virus, retroviral promoters, papilloma virus, hepatitis B virus, human immunodeficiencyvirus, cytomegalovirus, RSV LTR, whey acidic protein (WAP), and .beta.-casein.

Inducible elements and promoter can be derived from the following genes and viral genomes with the inducing agent in parentheses: MT II (phorbol ester (TFA) and heavy metals), mouse mammary tumor virus (MMTV, stimulated by glucocorticoids),adenovirus 5 E2 (E1a), and SV40 (TPA). In certain embodiments, it is preferable to employ inflammation-specific promoters (i.e. promoters that are more active in inflamed cells than in non-inflamed cells). Preferred examples of such a promotersinclude, the interleukin 1.beta. (IL-1.beta.) promoter and the CMV promoter. These lists are not intended to be exhaustive of all the possible useful promoter elements involved in the promotion of expression, but they are exemplary thereof. Additionalcontrol elements are discussed, infra.

By employing a promoter with well-known properties, the level and pattern of expression of a polynucleotide following transfection can be optimized. For example, selection of a promoter which is active in specific cells, such as tyrosinase(melanoma), alpha-fetoprotein and albumin (liver), CC10 (lung) and prostate-specific antigen (prostate) will permit tissue-specific expression of p20 polynucleotides. This list is not intended to be exhaustive of all the possible elements useful in thepromotion of p20 expression but, merely, to be exemplary thereof. In certain preferred embodiments, the promoter of choice is the CMV promoter which remains active with high levels of p20 expression. The CMV promoter and methods of use thereof, aredescribed in U.S. Pat. Nos. 5,385,839 and 5,168,062 to Stinski, each patent incorporated herein by reference.

Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. They are composed of many individual elements, each of which binds to one or moretranscriptional proteins. The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter has one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers generally lack such specifics. Promoters and enhancers are often overlapping andcontiguous, often seeming to have a very similar modular organization. Additionally any promoter and enhancer combination could also be used to drive expression. Additional promoters and enhancers are described in the Eukaryotic Promoter Database(Rouaida Cavin Perier et al. (1999) Nuc Acid Res 27:307 309, incorporated herein by reference and located on the World Wide Web at the URL "http//www.epd.isb-sib.ch", incorporated herein by reference).

In embodiments that use an expression vector, it is preferred that the vector contain an insert having at least a portion encoding p20, conservatively modified variant thereof, or a biologically functional equivalent genetic sequence of p20. Thep20 genes should be positioned in the vector relative to control elements such that the p20 genes are transcribed and ultimately translated in a desired environment in the cell targeted by the treatment. Preferred control elements include, but are notlimited to: promoters, enhancers, polyadenylation signals, translation control elements, nuclear localization signals, and membrane transport sequences. The control elements may enhance transcription, RNA processing, translation, secretion, cellularcompartmentalization, or any other useful biological process. The control elements may regulate the biological processes of gene expression such that p20 is expressed from the vector when stimulated by an catalyst applied during treatment. Anotherelement that may be used to enhance p20 expression is the creation of a Kozak sequence at the start site of p20 translation. A Kozak sequence is a translation initiation enhancer sequence. (For examples of translational enhancer compositions andmethods of use thereof, see U.S. Pat. No. 5,807,707 to Andrews et al., incorporated herein by reference; U.S. Pat. No. 5,723,332 to Chernajovsky, incorporated herein by reference; U.S. Pat. No. 5,891,665 to Wilson, incorporated herein byreference).

Control may regulate translation in addition to transcription. Thus, another preferred control element includes an internal ribosome entry site (IRES), described in U.S. Pat. No. 4,937,190 to Palmenberg et al., incorporated herein byreference. The IRES facilitates the delivery of two proteins into animal cells using a single-transcript vector (STV). In such constructs a multiple cloning site (MCS) is located immediately downstream of a single promoter and is followed by the IRESsequence and a second multiple cloning site (or at least one unique restriction site for inserting a second gene sequence). This configuration enables two gene sequences on a single transcript to both be translated into protein. This system has beenused with retroviral IRES-STVs in which a selectable drug marker gene was inserted immediately following the IRES. After drug selection, up to 99% of infected cells expressed the MCS-inserted gene as well. The ITES technology is available throughClontech Laboratories, Inc., Palo Alto, Calif.

In certain embodiments of the invention, the delivery of an expression vector in a cell may be identified in vitro or in vivo by including a marker in the expression vector. The marker would result in an identifiable change to the transfectedcell permitting easy identification of expression. Usually the inclusion of a drug selection marker aids in cloning and in the selection of transformants. Alternatively, enzymes such as herpes simplex virus thymidine kinase (tk) (eukaryotic) orchloramphenicol acetyltransferase (CAT) (prokaryotic) may be employed. Immunologic markers also can be employed. Red and Green Fluorescent Protein Markers are available from Clontech, supra. The selectable marker employed is not believed to beimportant, so long as it is capable of being expressed along with the polynucleotide encoding p20. Further examples of selectable markers and methods for constructing and using markers are well known to one of skill in the art.

One typically will include a polyadenylation signal (polyA) to effect proper polyadenylation of the transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any suchsequence may be employed. The inventors prefer the bovine growth hormone (bGH) polyA for or plasmid vectors, the Moloney murine leukemia virus (MoMLV) polyA for retroviral vectors, the SV40 polyA for adenoviral vectors, in that it was convenient andknown to function well in the target cells employed. Also contemplated as an element of the expression construct, but not preferred, is a terminator separate from the polyA. These elements can serve to enhance message levels and to minimize readthrough from the construct into other sequences.

Other expression vectors known in the art that may be useful for the expression of encoded genes in mammalian cells include, but are not limited to: pUC and Bluescript.TM. plasmid series, direct uptake of naked DNA, as well as receptor-mediateduptake of DNA complexes, DNA-liposome complexes (described in U.S. Pat. No. 5,676,954 to Brigham, incorporated herein by reference), cosmids, and phage constructs. A general resource for the construction and use of plasmid, recombinant, and viralvectors for gene-therapy that can be used, in certain embodiments, in light of the present invention is U.S. Pat. No. 5,545,563 to Darlington et al., incorporated herein by reference.

Once the expression construct has been delivered into the cell the nucleic acid encoding the gene of interest may be positioned and expressed at different sites within the cell. In certain embodiments, the nucleic acid encoding the gene may bestably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or "episomes" encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How theexpression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed.

In certain embodiments, gene transfer may more easily be performed under ex vivo conditions. Ex vivo gene therapy commonly refers to the isolation of cells from the mammal, the delivery of a nucleic acid into the cells, in vitro, and then thereturn of the modified cells back into the mammal. This may involve the surgical removal of tissue/organs from the mammal or the primary culture of cells and tissues. U.S. Pat. No. 5,399,346 to Anderson et al., incorporated herein by reference,disclose several ex vivo therapeutic methods. The preferred animal herein is a mammal and an especially preferred animal is a human. Particularly good methods of administration of plasmid expression vectors is by injection of naked DNA, inhalation ofaerosolized naked DNA, incorporation into liposomes and uptake by treated cells, association with cationic liposomes by charge-charge interactions, instillation, and injection or aerosolization in general.

Advantages to plasmid expression vector based expression systems include: plasmids generally do not integrate into the genomic DNA of the host cell, plasmid systems are typically less immunogenic than viral based expression systems, broad rangeof host expression cell available, selective expression in certain host cells possible, temporal expression possible, and the bystander effect allows effective treatment even when gene transmission rates are low. The bystander effect is an known in theart as a substantial therapeutic effect resulting from transduction of a relatively small population of targeted cells. For example, an illustration of the bystander effect would be the regression of a tumor following gene therapy of the tumor in whichfewer than 10% of the tumor cells were transformed by the gene therapy. The bystander effect is contemplated to influence treatment of inflammation also. The bystander effect is described in Gene Therapy of Cancer (1999) Lattime et al., (eds.) AcademicPress, especially Chapter 10, incorporated herein by reference. The bystander effect also is described in U.S. Pat. No. 5,866,340 to Vogelstein et al., incorporated herein by reference. The description of the benefit plasmid based gene therapy by thebystander effect is not meant to limit the present invention, but merely to be illustrative thereof. The bystander effect is expected to benefit viral expression vector based therapy and other embodiments as well.

In certain embodiments of the present invention, expression vectors (including viral-based expression vectors, infra) are used to transduce various cell types including, but not limited to: BEAS, IB3, C38), and primary cells derived from pig andhuman lung samples. Primary cell samples are obtained from animal models and patients with diseases including, but not limited to: allergic rhinitis, asthma, adult respiratory distress syndrome (ARDS), cystic fibrosis (CF), and idiopathic pulmonaryfibrosis (IPF). In certain embodiments, expression vectors (including viral-based expression vectors) are used for ex vivo or in vivo transduction of mammalian tissues or cell types including, but not limited to: epithelial, endothelial, hepatocyte,lymphoid, myeloid, vascular endothelium, and lung and bronchial epithelium. In certain embodiments, a measurements are made of IL-6 and IL-8 secretion from cells that are treated with p20.

5.42 Viral-Based Expression Vectors

In certain embodiments, viral expression vectors are preferred. Preferred viral based expression vectors include hybrid retrovirus/Epstein Barr virus vector (e.g., pLZRSpBMN-Z described in U.S. Pat. No. 5,830,725 to Nolan et al., incorporatedherein by reference; see Examples 2 and 3, FIGS. 9A D, and 10A C) and adenoviral expression vectors (e.g., pGEM-RecA; see Examples 4 and 5).

The viral vectors described in certain embodiments herein are non-replicating, meaning that no further virus spread occurs after infection. To distinguish this process from a natural virus infection where the virus continues to replicate andspread, the terms "transduce", transduced", and "transduction" are commonly used and may be used herein.

Numerous viral-based viral expression systems are described in the prior art and the use of any of these systems, or any system developed in the future, in conjunction with the compositions and methods of the present invention and in light of thepresent disclosure, is contemplated. However, it is preferred that the viral expression system is compatible with administration to a mammal and that it facilitate the expression of p20 in a mammalian cell.

5.43 Retrovirus

The retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA to infected cells by a process of reverse-transcription (Retroviruses (1997) Coffin et al. (eds.), Cold SpringHarbor Laboratory; incorporated herein by reference; Gene Therapy of Cancer (1999) Lattime et al., (eds.) Academic Press, Chapter 4, incorporated herein by reference). Typically, the resulting DNA then stably integrates into cellular chromosomes as aprovirus and directs synthesis of viral proteins. The integration results in the retention of the viral gene sequences in the recipient cell and its descendants. The retroviral genome contains gag, pol, and env genes that code for capsid proteins,polymerase enzyme, and envelope components, respectively. A sequence found upstream from the gag gene, termed .psi. contains a signal for the packaging of the viral genome into virions. Two long terminal repeat (LTR) sequences are present at the 5'and 3' ends of the viral genome. These contain strong promoter and enhancer elements and also direct integration of the viral nucleic acid into the host cell genome.

In order to construct a retroviral vector, in general, a nucleic acid encoding a promoter is inserted into the viral genome replacing the gag, pol, and env genes producing a replication deficient virus genome. In order to produce virions, apackaging cell line containing the gag, pol, and env genes; but without the LTR and .psi. components is constructed. Numerous packaging cell lines are known to one with skill in the art, are available commercially, and are available through theAmerican Type Culture Collection (ATCC, Rockville, Md.).

When a recombinant plasmid containing a human cDNA, together with the retroviral LTR and .psi. sequences is introduced into the packaging cell line (by calcium phosphate precipitation for example), the .psi. sequence allows the RNA transcriptof the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media. The media containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer. Retroviral vectorsare able to infect a broad variety of cell types. However, integration and stable expression is enhanced by the division of host cells.

Several concerns regarding the use of retroviral vectors include the potential for disruption of native genes of the host cell through random integration and the possibility of regeneration of a replication-competent particle throughrecombination in the packaging cell line. However, packaging cell lines are now available that should greatly decrease the likelihood of recombination (Markowitz et al. (1988) Virology 167(2):400 406; Markowitz et al. (1988) J. Virol. (62)1120 1124;Hersdorffer et al. (1990) DNA Cell Biol., (9) 713 723; each incorporated herein by reference). Another limitation to the use of retrovirus vectors in vivo is the limited ability to produce retroviral vector titers greater than 10.sup.6 U/milliliter. Titers 10- to 1,000-fold higher are preferred for many in vivo applications.

Nevertheless, several innovations in the application of retroviruses demonstrate the utility of retroviral vectors for delivering the anti-inflammatory agent p20 in conjunction with the present invention. U.S. Pat. No. 5,911,983 to Barrangeret al., incorporated herein by reference, describes the use of a retroviral vector for gene therapy of Gaucher disease. U.S. Pat. No. 5,910,434 to Rigg et al., incorporated herein by reference, describes packaging cell lines and methods of generatinghigh titer retrovirus useful for gene therapy. U.S. Pat. No. 5,741,486 to Pathak et al., incorporated herein by reference, describes a method of preventing the formation of replication competent retrovirus particles by providing a retroviral vectorthat deletes an essential encapsidation sequence upon reverse transcription in the target cells. U.S. Pat. No. 6,017,761 to Rigg et al., describes a method for obtaining retroviral packaging cell lines producing high transducing efficiency retroviralsupernatant. The treatment of tumors in a mammal using retroviral vectors and a p53 gene is described in U.S. Pat. No. 5,532,220 to Lee et al., incorporated herein by reference.

5.44 Hybrid Retrovirus

The preferred expression system for high efficiency gene transfer in the present invention includes a hybrid Epstein-Barr virus(EBV)/retroviral vector construct (LZRSpBMN-Z ) (U.S. Pat. No. 5,830,725 to Nolan et al., incorporated herein byreference). In addition to a murine retroviral backbone with a polylinker region to facilitate insertion of cDNAs, the LZRSpBMN-Z vector contains the Epstein-Barr virus Nuclear Antigen (EBNA) gene, EBV origin of replication and nuclear retentionsequences (oriP), and a puromycin resistance gene (FIG. 11C). The nuclear replication and retention functions of this vector allow for rapid establishment of recombinant retroviral producer DNA as stable episomes within human retroviral packaging celllines. Episomes are maintained at 5 20 copies per cell (approximately) for up to 2 3 months, given selection for puromycin resistance, resulting in high viral titers. The retroviral backbone in this vector consists of full-length Moloney murineleukemia virus longer repeat (LTR) and extended .psi. packaging sequences derived from the MFG series of retroviral vectors developed by Mulligan and colleagues (U.S. Pat. No. 4,868,116 to Morgan et al., incorporated herein by reference).

Helper-free retrovirus is produced by transfecting the LZRS-based his-C/EBP.beta.-1, his-C/EBP.beta.-3, or a control .beta.-gal construct (see Examples 2 and 3) into a 293T-based amphotropic packaging cell line termed (.phi.)nx-ampho (provided byGary Nolan, Stanford University, Calif., USA). The 293T-derived cell lines are transfected with high efficiency (50% to 80%, or more of total cells being transfected) using calcium phosphate mediated transfection. The (.phi.)nx-ampho packaging cellline was specifically developed by G. Nolan to produce high titer, helper free recombinant retrovirus. The improvements were designed to alleviate instability of retroviral production capacity and potential recombination problems. Thus, hygromycin anddiphtheria toxin resistance genes were introduced as co-selectable markers for the gag-pol and amphotropic envelope constructs respectively. To reduce the potential for recombination, the gag-pol and envelope constructs are driven by different,non-MoMuLV promoters. The risk of rearrangements is further reduced when LZRS-based constructs are maintained episomally in fnx-based packaging lines, resulting in the safe production of helper-free retroviral stocks.

5.45 Adenovirus

Another method for in vivo delivery, including gene therapy, involves the use of an adenovirus vector. The use of adenoviral vectors for the delivery of gene therapy is known in the art. Adenoviral vectors and methods for use thereof, thatinclude non-native coat proteins for reduced immunogenicity and increased cellular uptake are described in U.S. Pat. No. 5,965,541 to Wickham et al.; the life cycle of adenovirus, adenoviral vector compositions, and methods of use thereof for genetherapy are described in U.S. Pat. No. 5,731,190 to Wickham et al.; the use of adenoviral vectors incorporating a novel tumor suppressor gene in the treatment of cancer is described in U.S. Pat. No. 5,922,688 to Hung et al.; each patent isincorporated herein by reference.

Viral vectors based on the adenovirus are particularly suited for gene transfer and gene therapy because of its mid-sized genome, ease of manipulation, high titer viral particle production, wide target-cell range, and high infectivity. Both endsof the viral genome contain 100 200 base pair inverted repeats (ITRs), which are cis elements necessary for viral DNA replication and packaging. The early (E) and late (L) regions of the genome contain different transcription units that are divided bythe onset of viral DNA replication. The E1 region (E1A and E1B) encodes proteins responsible for the regulation of transcription of the viral genome and a few cellular genes. The expression of the E2 region (E2A and E2B) results in the synthesis of theproteins for viral DNA replication. These proteins are involved in DNA replication, late gene expression and host cell shut-off. The products of the late genes, including the majority of the viral capsid proteins, are expressed only after significantprocessing of a single primary transcript issued by the major late promoter (MLP). The MLP, located at 16.8 m.mu. is particularly efficient during the late phase of infection, and all the mRNA's issued from this promoter possess a 5'-tripartite leader(TL) sequence which makes them preferred mRNA's for translation.

In some cases, recombinant adenovirus is generated from homologous recombination between a shuttle vector and a provirus vector. Due to the possible recombination between two proviral vectors, wild-type adenovirus may be generated from thisprocess. Therefore, it is critical to isolate a single clone of virus from an individual plaque and examine its genomic structure. Use of the YAC system is an alternative approach for the production of recombinant adenovirus.

In certain embodiments, a method of introducing the p20 to a mammal is to introduce a replication-deficient adenovirus containing a polynucleotide segment or insert encoding p20. Certain preferred constructs are made replication deficient bydeletion of the viral E1B and E3 genes. This avoids viral reproduction inside the cell and transfer to other cells and infection of other people. In other words, the viral infection activity is shut down after it transduces the target cell, but the p20gene is still expressed inside the cells. Also, adenovirus is able to transfer the p20 gene efficiently into both proliferating and non-proliferating cells. Further, the extrachromosomal location of adenovirus in the infected cells decreases the chanceof cellular oncogene activation within the treated mammal (adenoviruses do not generally integrate into the host cell genome).

The nature of the adenovirus vector is not believed to be crucial to the successful practice of the invention. Of course, as discussed above, it is advantageous if the adenovirus vector is replication defective, or at least conditionallydefective, The adenovirus may be of any of the 42 different known serotypes or subgroups A F. Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in certainembodiments of the present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as avector. The preferred adenoviral vector is pGEM-RecA (see Examples section).

Adenovirus is easy to grow and manipulate and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g., 10.sup.9 10.sup.11 plaque-forming units per ml, and the particles are highly infective. The life cycle of adenovirus does not require integration in to the host cell genome. The foreign genes delivered by adenovirus vectors are episomal and, therefore, have low genotoxicity to host cells. No side effects have been reported in certainstudies of vaccination with wild-type adenovirus, demonstrating their safety and therapeutic potential as in vivo gene transfer vectors. However, other findings have shown a limitation with regard to immunogenic responses to adenoviral antigens.

U.S. Pat. No. 5,923,210 to Gregory et al., incorporated herein by reference, and U.S. Pat. No. 5,824,544 to Armentano et al., incorporated herein by reference, describe modifications to adenoviral vectors, and medical uses thereof, thatdecrease the potential for spontaneous generation of a replication competent adenovirus; thus, making the vectors even more safe for clinic use. The patents involve the deletion of the E1A (both patents) and E1B adenovirus genes (U.S. Pat. No.5,923,210) and deletion (U.S. Pat. No. 5,923,210) or relocation (U.S. Pat. No. 5,824,544) of the adenovirus IX gene.

U.S. Pat. No. 5,792,453 to Hammond et al., incorporated herein by reference, describes adenoviral vectors useful for gene therapy for peripheral vascular disease and heart disease, including myocardial ischemia. The adenoviral vector isadministered by intra-femoral artery or intracoronary injection conducted deeply in the lumen of the one or both femoral or coronary arteries (or graft vessels) in an amount sufficient for transfecting cells in a desired region.

Enhanced gene transfer to cancers arising from epithelial cells using adenoviral vectors and a transfer enhancing reagent, namely ethanol, is described in U.S. Pat. No. 5,789,244 to Heidrun et al., incorporated herein by reference.

Enhanced gene transfer to vascular cells using adenoviral and retroviral vectors and a transfer enhancing reagent, namely polyols, is described in U.S. Pat. No. 5,552,309 to March, incorporated herein by reference.

Successful delivery and expression of the cystic fibrosis transmembrane conductance regulator (CFTR) gene into the tracheobronchial passages of rhesus monkeys including the alveolar sacs using an adenovirus 5 based vector with a CFTR geneinsertion and a technique for generating a viral aerosol is described in U.S. Pat. No. 5,952,220 to Sene et al., incorporated herein by reference.

5.45 Other Expression Systems

It is believed that the choice of expression vector, including viral-based expression vectors, is limited only by the pharmaceutical administration of the vector to the cell or mammal depending on the embodiment. Thus, it is preferred that thevector does not elicit an adverse immunological (meaning toxic) response in the mammal when treatment of a mammal is concerned. It is preferred that the vector does not support integration into the host cell genome because this may disrupt host cellgene expression. It is preferred, also, that the vector system support a level of expression of a composition of the present invention in a chosen cell that is therapeutically effective according to the particular embodiment (e.g., treating aninflammatory response or decreasing cellular pro-inflammatory cytokine production). Therefore, in addition to the non-infectious vectors, retroviral vectors, hybrid EBV/retroviral vectors, and adenoviral vectors; other expression vector systems, bothknown and to be developed, are contemplated to be useful in certain embodiments of the present invention in light of the present disclosure.

Alternative expression systems are pointed out below by way of example only. In certain embodiments of the present invention, the expression construct can be introduced into the cell using adenovirus assisted transfection. Increasedtransfection efficiencies have been reported in cell systems using adenovirus mediated systems as described in U.S. Pat. No. 5,928,944 to Seth et al. and U.S. Pat. No. 5,830,730 to German et al., each patent incorporated herein by reference. Otherviral vectors may be employed as expression constructs in the present invention including, but not limited to: avipox, suipox, iridoviruses, picornavirus, calicivirus, and togavirus (all described in U.S. Pat. No. 5,656,465 to Panicali et al.,incorporated herein by reference); a vaccinia virus modified for use in gene therapy (U.S. Pat. No. 5,858,373 to Paoletti et al., incorporated herein by reference); and gene therapy of liver tumors utilizing transcriptional elements ofalpha-fetoprotein incorporated into SIN vectors is described in U.S. Pat. No. 5,843,776 to Tamaoki et al., incorporated herein by reference.

In vitro and in vivo gene therapy including the eye using LUX viral vector and Rb insert is described in U.S. Pat. No. 5,858,771 to Lee et al., incorporated herein by reference. Ocular gene therapy using recombinant vector and adenovirusvector is described in U.S. Pat. No. 5,827,702 to Cuthbertson, incorporated herein by reference. Gene therapy of the myocardium utilizing intra-femoral artery or intracoronary injection of adenoviral gene therapy vectors deep in the lumen of one orboth femoral or coronary arteries (or graft vessels) is described in U.S. Patent Hammond et al., incorporated herein by reference.

U.S. Pat. No. 5,770,580 to Ledley et al., incorporated herein by reference, describes somatic gene therapy to cells associated with fluid spaces, such as follicles of the thyroid, the synovium of the joint, the vitreous of the eye and the inneror middle ear. Formulated DNA expression vectors are introduced with or without formulation elements into fluid spaces under conditions in which cells associated with the fluid space can incorporate the formulated DNA expression vector. Formulated DNAexpression-mediated gene therapy allows treatment of diseases involving cells associated with fluid spaces. Recombinant viral and plasmid vectors for gene-therapy directed to the lung are described in U.S. Pat. No. 5,240,846 to Collins et al.,incorporated herein by reference.

Generation of high titers of recombinant adeno-associated virus (AAV) vectors and the application of AAV vectors in gene therapy is described in U.S. Pat. No. 5,658,776 to Flotte et al., incorporated herein by reference. AAV-mediated genetherapy is also described in Gene Therapy of Cancer (1999) Lattime et al., (eds.) Academic Press, Chapter 6, incorporated herein by reference.

5.50 Production and Purification of p20 Protein

In certain embodiments, p20 polypeptide is used for treatments described in the present invention. Although the p20 polypeptide can be isolated from natural sources such as rat, mouse, or human cells; it is preferred that they be produced usingrecombinant techniques due to the increased risk of contamination by pathogens when derived from native sources. The cloning of and propagation of the human C/EBP.beta. nucleotide sequence in plasmid vectors are described in U.S. Pat. No. 5,215,892to Kishimoto et al. and U.S. Pat. No. 5,360,894 to Kishimoto et al., each patent incorporated herein by reference. Additional methods for cloning and propagation of nucleotide sequences in general, and the p20 nucleotide sequence in particular isknown to one with ordinary skill in the art. Methods for obtaining such sequences from different sources (i.e., murine, rat, chicken, xenopus, etc.) are also known.

In general, p20 protein can be made by inserting an encoding nucleic acid sequence into an expression vector suitable for expression in the host cell of choice including bacteria (e.g., BL21-pLysS, which does not phosphorylate the proteinproduct), yeast (e.g., SF9), insect (phosphorylated peptides, used in conjunction with a baculovirus vector), and mammalian host cells which provide wild type phosphorylation. These recombinant expression systems are known in the art and commerciallyavailable.

The present invention also provides purified, and in certain preferred embodiments, substantially purified p20 polypeptide. The term "purified p20 polypeptide" as used herein, is intended to refer to a p20 proteinaceous composition, isolatablefrom endogenous or recombinant sources, wherein the p20 polypeptide is purified to any degree relative to its naturally-obtainable state, i.e., relative to its purity within a cellular extract. A purified p20 polypeptide therefore also refers to awild-type or mutant p20 polypeptide free from the environment in which it naturally occurs.

Generally, "purified" will refer to a p20 polypeptide composition that has been subjected to fractionation to remove various non-p20 proteins, polypeptides, or peptides, and which composition substantially retains its p20 activity (Examples). Where the term "substantially purified" is used, this will refer to a composition in which the p20 polypeptide forms the major component of the composition, such as constituting about 51% of the proteins in the composition or more. In preferredembodiments, a substantially purified protein will constitute more than 70%, 80%, 90%, or even more than 95% of the proteins in the composition. In even more preferred embodiments, a substantially purified protein will constitute 99%, or even more than99% of the proteins in the composition. The amount of a particular protein can be determined by comparing the opacity of the protein band with other proteins in the same lane after running the sample by SDS/PAGE and visualizing the proteins by silverstaining as is known in the art.

A peptide, polypeptide or protein that is "purified to homogeneity," as applied to the present invention, means that the peptide, polypeptide or protein has a level of purity where the peptide, polypeptide or protein is substantially free fromother proteins and biological components. For example, a purified peptide, polypeptide or protein will often be sufficiently free of other protein components so that degradative sequencing may be performed successfully.

Various methods for quantifying the degree of purification of p20 protein will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific p20 protein activity of a fraction, orassessing the number of polypeptides within a fraction by gel electrophoresis. Assessing the number of polypeptides within a fraction by SDS/PAGE analysis will often be preferred in the context of the present invention as this is straightforward.

To purify a p20 polypeptide a natural or recombinant composition comprising at least some p20 polypeptides will be subjected to fractionation to remove various non-p20 components from the composition. In addition to those techniques, variousother techniques suitable for use in protein purification will be well known to those of skill in the art. These include, for example, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation;chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite, lectin affinity and other affinity chromatography steps; isoelectric focusing; gel electrophoresis; and combinations of such and other techniques.

Another example is the purification of an p20 fusion protein using a specific binding partner. Such purification methods are routine in the art. As the Kishimoto U.S. Pat. No. 5,215,892 patent provides a C/EBP.beta. nucleotide sequence; thenany fusion protein purification method can now be practiced. This is exemplified by the generation of an p20 glutathione S-transferase fusion protein, expression in E. coli, and isolation (including to homogeneity) using affinity chromatography onglutathione-agarose. Given the DNA and proteins described in the present invention, any purification method can now be employed.

The preferred method of protein isolation is by affinity chromatography of a 6.times.His Tag included in the nucleic acid encoding the p20 protein products (see the Examples section). The 6.times.His Tag adds an additional 0.84 kDa to theoverall molecular weight of the protein product and does not interfere with the p20 activity. The expression product is then purified by chromatography on a nickel-nitrilotriacetic acid (Ni-NTA) column. If the 6.times.His Tag is found to interfere withan activity of the protein product for a specific purpose, the tag can be removed. All of these protein product purification techniques are known to one with skill in the art (see e.g., Petty (1996) Current Protocols in Molecular Biology Vol. 2, JohnWiley and Sons Publishers, incorporated herein by reference) and are commercially available from Qiagen (Valencia, Calif. 91355).

Although preferred for use in certain embodiments, there is no general requirement that the p20 polypeptide always be provided in their most purified state. Indeed, it is contemplated that less substantially purified p20 compositions which arenonetheless enriched in p20 protein, relative to the natural state, will have utility in certain embodiments. These include, for example, antibody generation where subsequent screening assays using purified p20 proteins are conducted. Methodsexhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein. Inactive products also have utility in certain embodiments, such as, e.g., in antibodygeneration.

Turning to the expression of the proteins, once a suitable clone or clones have been obtained, whether they be cDNA based or genomic, one may proceed to prepare an expression system. The engineering of DNA segment(s) for expression in aprokaryotic or eukaryotic system may be performed by techniques generally known to those of skill in recombinant expression. It is believed that virtually any expression system may be employed in the expression of the proteins.

Both cDNA and genomic sequences are suitable for eukaryotic expression, as the host cell will generally process the genomic transcripts to yield functional mRNA for translation into protein. Generally speaking, it may be more convenient toemploy as the recombinant gene a cDNA version of the gene. In general, it is believed that the use of a cDNA version will provide advantages in that the size of the gene will generally be much smaller and more readily employed to transfect the targetedcell than will a genomic gene, which will typically be up to an order of magnitude or more larger than the cDNA gene. Although, it is contemplated that a genomic version of a particular gene may be employed where desired. In the present case, however,C/EBP.beta. (including C/EBP.beta.-3) does not contain an intron. Thus, the genomic and cDNA sequences are similar without intervening intron(s).

In expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and anysuch sequence may be employed. Preferred embodiments include the SV40 polyadenylation signal and the bovine growth hormone polyadenylation signal, convenient and known to function well in various target cells. Also contemplated as an element of theexpression cassette, in certain embodiments, is a terminator. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.

A specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon and adjacent sequences. Exogenous translational control signals, including the ATG initiation codon,may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired codingsequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcriptionenhancer elements.

In certain embodiments, the translation initiation site for C/EBP.beta.-1 and/or C/EBP.beta.-2 may be modified to prevent expression of C/EBP.beta.-1 and/or C/EBP.beta.-2. Such nucleic acids are contemplated to be useful for the expression andpurification of p20 (C/EBP.beta.-3). The amount of C/EBP.beta.-1 and/or C/EBP.beta.-2 in the starting fraction would be reduced or eliminated depending on the host cell (certain mammalian cells may express some C/EBP.beta.-1 and/or C/EBP.beta.-2, butother cells will not). Such a construct may be useful also in conjunction with a vector for gene therapy in certain embodiments. Preferred methods to modify the translation start site include eliminating the ATG (for C/EBP.beta.-1 and/or C/EBP.beta.-2)by site-directed mutagenesis. In certain embodiments, it is also preferred that a Kozak sequence be formed around the third ATG (for enhanced p20 expression).

It is proposed that proteins, polypeptides or peptides may be co-expressed with other selected proteins, wherein the proteins may be co-expressed in the same cell or a gene(s) may be provided to a cell that already has another selected protein. Co-expression may be achieved by co-transfecting the cell with two distinct recombinant vectors, each bearing a copy of either of the respective DNA. Alternatively, a single recombinant vector may be constructed to include the coding regions for both ofthe proteins, which could then be expressed in cells transfected with the single vector. In either event, the term "co-expression" herein refers to the expression of both the gene(s) and the other selected protein in the same recombinant cell.

As used herein, the terms "engineered" and "recombinant" cells or host cells are intended to refer to a cell into which an exogenous DNA segment or gene, such as a cDNA or gene encoding an protein has been introduced. Engineered cells are thuscells having a nucleic acid, a gene, or genes introduced through the hand of man. Therefore, engineered cells are distinguishable from naturally occurring cells which do not contain a recombinantly introduced exogenous DNA segment or gene. Recombinantcells include those having an introduced cDNA or genomic gene, and may also include genes positioned adjacent to a promoter not naturally associated with the particular introduced gene.

To express a recombinant protein, polypeptide or peptide, whether mutant or wild-type, in accordance with the present invention one would prepare an expression vector that comprises a wild-type, or mutant protein-encoding nucleic acid under thecontrol of one or more promoters. To bring a coding sequence "under the control of" a promoter, one positions the 5' end of the transcription initiation site of the transcriptional reading frame generally between about 1 and about 50 nucleotides"downstream" (i.e., 3') of the chosen promoter. The "upstream" (i.e., 5') promoter stimulates transcription of the DNA and promotes expression of the encoded recombinant protein. This is a meaning of "recombinant expression" in this context.

Many standard techniques are available to construct expression vectors containing the appropriate nucleic acids and transcriptional/translational control sequences in order to achieve protein, polypeptide or peptide expression in a variety ofhost-expression systems. Cell types available for expression include, but are not limited to, bacteria, such as E. coli and B. subtilis transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors. The use of cosmid DNAand artificial chromosomes is common particularly in yeast or mammalian expression systems.

Certain examples of prokaryotic hosts are E. coli strains:DH5.alpha. (preferred), HB101, E. coli BL21, E. coli BL21-pLysS, E. coli BL21-pLysE, RR1, E. coli LE392, E. coli B, E. coli X 1776 (ATCC No. 31537) as well as E. coli W3110 (F-, lambda-,prototrophic, ATCC No. 273325); bacilli such as Bacillus subtilis; and other enterobacteriaceae such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species.

In general, plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as markingsequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli is often transformed using derivatives of pBR322, a plasmid derived from an E. coli species. pBR322 contains genes for ampicillin and tetracyclineresistance and thus provides easy method for identifying transformed cells. The pBR plasmid, or other microbial plasmid or phage must also contain, or be modified to contain, promoters which can be used by the microbial organism for expression of itsown proteins.

In addition, phage vectors containing replicon and control sequences that are compatible with the host microorganism can be used as transforming vectors in connection with these hosts. For example, the phage lambda GEM.TM.-11 may be utilized inmaking a recombinant phage vector which can be used to transform host cells, such as E. coli LE392.

Further useful vectors include pIN vectors (Inouye et al., 1985); and pGEX vectors, for use in generating glutathione S-transferase (GST) soluble fusion proteins for later purification and separation or cleavage. Other suitable fusion proteinsare those with .beta.-galactosidase, ubiquitin, and the like.

Promoters that are most commonly used in recombinant DNA construction include the .beta.-lactamase (penicillinase), lactose and tryptophan (trp) promoter systems. While these are the most commonly used, other microbial promoters have beendiscovered and utilized, and details concerning their nucleotide sequences have been published, enabling those of skill in the art to ligate them functionally with plasmid vectors. In certain preferred embodiments, the T7 promoter is used.

The following details concerning recombinant protein production in bacterial cells, such as E. coli, are provided by way of exemplary information on recombinant protein production in general, the adaptation of which to a particular recombinantexpression system will be known to those of skill in the art.

Bacterial cells, for example, E. coli, containing the expression vector are grown in any of a number of suitable media, for example, LB. The expression of the recombinant protein may be induced, e.g., by adding IPTG to the media or by switchingincubation to a higher temperature. After culturing the bacteria for a further period, generally of between 2 and 24 hours, the cells are collected by centrifugation and washed to remove residual media.

The bacterial cells are then lysed, for example, by disruption in a cell homogenizer or by sonication (preferred) and centrifuged to separate the dense inclusion bodies and cell membranes from the soluble cell components. This centrifugation canbe performed under conditions whereby the dense inclusion bodies are selectively enriched by incorporation of sugars, such as sucrose, into the buffer and centrifugation at a selective speed.

If the recombinant protein is expressed in the inclusion bodies, as is the case for C/EBP.beta. isoforms, the inclusion bodies can be washed in any of several solutions to remove some of the contaminating host proteins, then solubilized insolutions containing high concentrations of urea (e.g. 8M) or chaotropic agents such as guanidine hydrochloride in the presence of reducing agents, such as .beta.-mercaptoethanol or DTT (dithiothreitol). These techniques are known in the art.

In certain embodiments, it is preferred to incubate the protein for several hours under conditions suitable for the protein to undergo a refolding process into a conformation which more closely resembles that of the native protein. Suchconditions generally include low protein concentrations, less than 500 mg/ml, a reducing agent (high levels of a reducing agent are preferred for the present invention), concentrations of urea less than 2 M and often the presence of reagents such as amixture of reduced and oxidized glutathione which facilitate the interchange of disulfide bonds within the protein molecule.

The refolding process can be monitored, for example, by SDS-PAGE, or with antibodies specific for the native molecule (which can be obtained from animals vaccinated with the native molecule or smaller quantities of recombinant protein). Following refolding, the protein can then be purified further and separated from the refolding mixture by chromatography on any of several supports including ion exchange resins, gel permeation resins or on a variety of affinity columns. As describedsupra, a polyhistidine tag and Ni-agarose chromatography are preferred.

For expression in Saccharomyces, the plasmid YRp7, for example, is commonly used. This plasmid already contains the trpl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for exampleATCC No. 44076 or PEP4-1. The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

Suitable promoting sequences in yeast vectors include the promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase,glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. In constructing suitable expression plasmids, the termination sequences associated with these genes are mayalso by ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination.

Other suitable promoters, which have the additional advantage of transcription controlled by growth conditions, include the promoter region for alcohol dehydrogenase, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogenmetabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.

In addition to micro-organisms, cultures of cells derived from multicellular organisms may also be used as hosts. In principle, any such cell culture is workable, whether from vertebrate or invertebrate culture. In addition to mammalian cells,these include insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus); and plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus (CaMV) or tobacco mosaic virus, (TMV)) ortransformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing one or more protein, polypeptide or peptide coding sequences.

In a useful insect system, Autograph californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The protein, polypeptide or peptide coding sequences are clonedinto non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of the coding sequences results in the inactivation of the polyhedringene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed(e.g., U.S. Pat. No. 4,215,051, Smith, incorporated herein by reference).

Examples of useful mammalian host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines. In addition, a host cell strain may be chosen that modulates the expressionof the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation, phosphorylation) and processing (e.g., cleavage) of protein products may be important for the function of theprotein in certain embodiments. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cells lines or host systems can be chosen to ensure the correctmodification and processing of the foreign protein expressed. In addition, the protein product (e.g., p20) may be co-expressed with a specific kinase which will provide the desired phosphorylation of the protein product.

Expression vectors for use in mammalian cells ordinarily include an origin of replication (as necessary), a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylationsite, and possibly transcriptional terminator sequences. The origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g., polyoma virus, adenovirus,VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.

The promoters may be derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Further, it is also possible, and may bedesirable, to utilize promoter or control sequences normally associated with the gene sequence(s), provided such control sequences are compatible with the host cell systems.

A number of viral based expression systems may be utilized, for example, commonly used promoters are derived from polyoma, Adenovirus 2, and frequently Simian Virus 40 (SV40). The early and late promoters of SV40 virus are particularly usefulbecause both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication. Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 basepair sequence extending fromthe Hind III site toward the Bg1I site located in the viral origin of replication.

In cases where an adenovirus is used as an expression vector, the coding sequences may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then beinserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1, E3, or E4) will result in a recombinant virus that is viable and capable of expressing proteins,polypeptides or peptides in infected hosts.

Specific initiation signals may also be required for efficient translation of protein, polypeptide or peptide coding sequences. These signals include the ATG initiation codon and adjacent sequences. Exogenous translational control signals,including the ATG initiation codon, may additionally need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be in-frame (orin-phase) with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiencyof expression may be enhanced by the inclusion of appropriate transcription enhancer elements and transcription terminators.

In eukaryotic expression, one will also typically desire to incorporate into the transcriptional unit an appropriate polyadenylation site (e.g., 5'-AATAAA-3') if one is not contained within the original cloned segment. Typically, the poly Aaddition site is placed about 30 to 2000 nucleotides "downstream" of the termination site of the protein at a position prior to transcription termination.

For long-term, high-yield production of a recombinant protein, polypeptide or peptide, stable expression is preferred. For example, cell lines that stably express constructs encoding an protein, polypeptide or peptide by the methods disclosedherein may be engineered. Rather than using expression vectors that contain viral origins of replication, host cells can be transformed with vectors controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences,transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of foreign DNA, engineered cells may be allowed to grow for 1 2 days in an enriched media, and then are switched to a selective media. Theselectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.

A number of selection systems may be used, including, but not limited to, the herpes simplex virus thymidine kinase (tk), hypoxanthine-guanine phosphoribosyltransferase (hgprt) and adenine phosphoribosyltransferase (aprt) genes, in tk-, hgprt- oraprt- cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for dihydrofolate reductase (dhfr), that confers resistance to methotrexate; gpt, that confers resistance to mycophenolic acid; neomycin (neo), that confersresistance to the aminoglycoside G-418; and hygromycin (hygro), that confers resistance to hygromycin. Also, puromycin is often used.

Animal cells can be propagated in vitro in two modes: as non-anchorage dependent cells growing in suspension throughout the bulk of the culture or as anchorage-dependent cells requiring attachment to a solid substrate for their propagation (i.e.,a monolayer type of cell growth). Non-anchorage dependent or suspension cultures from continuous established cell lines are the most widely used method of large scale production of cells and cell products. However, suspension cultured cells havelimitations, such as tumorigenic potential and lower protein production than adherent cells.

Large scale suspension culture of mammalian cells in stirred tanks is a common method for production of recombinant proteins. Two suspension culture reactor designs are in wide use: the stirred reactor and the airlift reactor. The stirreddesign has successfully been used on an 8000 liter capacity for the production of interferon. Cells are grown in a stainless steel tank with a height-to-diameter ratio of 1:1 to 3:1. The culture is usually mixed with one or more agitators, based onbladed disks or marine propeller patterns. Agitator systems offering less shear forces than blades have been described. Agitation may be driven either directly or indirectly by magnetically coupled drives. Indirect drives reduce the risk of microbialcontamination through seals on stirrer shafts.

The airlift reactor, also initially described for microbial fermentation and later adapted for mammalian culture, relies on a gas stream to both mix and oxygenate the culture. The gas stream enters a riser section of the reactor and drivescirculation. Gas disengages at the culture surface, causing denser liquid free of gas bubbles to travel downward in the downcomer section of the reactor. The main advantage of this design is the simplicity and lack of need for mechanical mixing. Typically, the height-to-diameter ratio is 10:1. The airlift reactor scales up relatively easily, has good mass transfer of gases and generates relatively low shear forces.

It is contemplated that the proteins, polypeptides or peptides produced by the methods of the invention may be "overexpressed", i.e., expressed in increased levels relative to its natural expression in cells. Such overexpression may be assessedby a variety of methods, including radio-labeling and/or protein purification. However, simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or western blotting, followed by quantitative analyses, such asdensitometric scanning of the resultant gel or blot. A specific increase in the level of the recombinant protein, polypeptide or peptide in comparison to the level in natural cells is indicative of overexpression, as is a relative abundance of thespecific protein, polypeptides or peptides in relation to the other proteins produced by the host cell and, e.g., visible on a gel.

5.60 Pharmaceutical Compositions, Administration, and Dosage

In preferred embodiments, the administration of p20 comprises introducing p20 protein and/or p20 encoding nucleic acid to a mammalian cell. Preferably, the nucleic acid form expresses p20 in the mammalian cell. The administration to the cellcan be conducted in vivo, ex vivo, or in vitro. These terms are known in the art. In certain preferred embodiments, the ex vivo approach is used where tissue is removed from the mammal (or an acceptable donor organism), treated, and placed back intothe mammal. In certain exemplary embodiments, the in vivo approach is used where the cell is treated directly in the mammal. Naturally, it is preferred that the p20 is administered to the cell in the context of a pharmaceutical formulation orcomposition.

In certain embodiments, the preferred method of administering the p20 isoform of C/EBP.beta. is in combination with an excipient (a pharmaceutically acceptable carrier). The excipient combined with the p20 may be administered by any mode orroute known and to any cell, tissue, or organ of the mammal. The combination of an pharmaceutically acceptable carrier and the pharmaceutically active ingredient (including, but not limited to, p20 as other active ingredients may be included) isreferred to herein as a pharmaceutical formulation.

The particular excipient is not believed to be critical as long as it is compatible with the biological activity of the active ingredient and compatible with administration to the subject (including a cell, mammal, or human). The choice ofexcipient depends on the nature of the inflammation or cell being treated, the location of treatment, and the active ingredient. A pharmaceutical formulation of liposomes (excipient) and hybrid retro/EBV-p20 expression vector is highly preferred incertain embodiments. This formulation can be injected into the local tissue or the afferent blood supply for treatment of inflammation or the prevention of inflammation in a population of cells, it can be combined with additional inert or carrieringredients and used as a topical salve (e.g., for treatment of inflammation-associated skin disease), and it can be used with an aerosolization device for inhalation (e.g., to treat a bronchiopulmonary inflammatory reaction). The inventors specificallycontemplate that p20 will be used to prevent inflammation or inflammatory reactions (e.g., an inhaler that delivers a metered and aerosolized dose of p20 may be used to prevent an asthmatic reaction to cold, exercise, and allergen).

As mentioned, the choice of excipient depends on the type, location, and nature of the inflammation; as well as, the route and mode of administration. The choice of pharmaceutically acceptable carrier can be made by one with skill in the art,such as the treating physician. The liposome/adenoviral formulation and additional recommended carriers, formulations, and modes of administration are described below.

Pharmaceutical compositions of the present invention will have an effective amount of a gene or peptide for therapeutic administration in combination with a pharmaceutically acceptable carrier. The gene or peptide may be dissolved or dispersedin the carrier and the carrier may be as simple as water. Although purified and sterile water is preferred and the addition of salts, pH buffers, and preservatives may be desired.

As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents forpharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients, its use in the therapeutic compositions is contemplated. Thus, the numerous examples ofpharmaceutically acceptable carriers that are provided herein, are provided by way of example and are not meant to limit the scope of the present invention. Supplementary active ingredients, such as other anti-inflammatory agents either known ordiscovered after the filing date hereof, can also be incorporated into the compositions. Also, compounds that are found to act synergistically with agents of the present invention may be used in combination or incorporated into the pharmaceuticalcompositions. The present invention may also be performed in combination with surgery. In one example, the present compositions and methods may be used to render an untreatable inflammatory response, treatable by other known methods. So, the presentinvention can be applied to an inflammatory response making the inflammatory response treatable by, for example, corticosteroid treatment.

The expression vectors and delivery vehicles of the present invention may include classic pharmaceutical preparations. Administration of these compositions according to the present invention will be via any common route so long as the targettissue is available via that route. This includes, but is not limited to: oral, dermal, nasal, buccal, rectal, vaginal or topical. Administration may be by orthotopic, intradermal, subcutaneous, intramuscular, intraocular, intraperitoneal orintravenous injection. An exemplary route of administration is inhalation of an aerosol for treatment of inflammation associated with the lungs. Such compositions would normally be administered as pharmaceutically acceptable compositions, describedsupra.

In certain embodiments, pharmaceutical formulations of the present invention are directly injected into an inflamed foci or among a population of cells. In the case of direct injection, it is preferred that the pharmaceutical formulation isinjected into the foci, optionally multiple times, optionally multiple times spaced about 5 millimeters apart over the area of the foci.

In embodiments wherein an inflammatory response is identified, the response can be in and treated in any body component or in multiple body components including, but not limited to the: adipose, bladder, bone, brain, central nervous system,cartilage, cervix, eye, fallopian tube, heart, intestine, joint, kidney, liver, lung, lymphoid, muscle, ovary, pancreas, peripheral nervous system, peritoneum, prostate, skin, spleen, stomach, tendon, testicle, uterus, and vasculature.

In certain embodiments the above body components are treated when an inflammatory response has not been identified (e.g., for the prevention of inflammation) or when a subject has not been examined for inflammation. The purposes of suchtreatment include, but are not limited to: the prevention of inflammation and the inhibition of pro-inflammatory mediators.

The vectors of the present invention are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable may be solubilized or suspended in liquid prior to injection. Thesepreparations also may be emulsified. In certain embodiments, a typical composition comprises about 50 mg or up to about 100 mg of human serum albumin per milliliter of phosphate buffered saline. Other pharmaceutically acceptable carriers includeaqueous solutions, salts, preservatives, buffers and the like. Examples of non-aqueous solvents are propylene glycol polyethylene glycol. vegetable oil and injectable organic esters, such as theyloleate. Aqueous carriers include water,alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antimicrobial agents, anti-oxidants, chelating agentsand inert gases. The pH and exact concentration of the various components in the pharmaceutical are adjusted according to well known parameters.

Additional formulations are suitable for oral administration. Oral formulations include such typical excipients as; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesiumcarbonate, and the like. The compositions take the form of solutions. suspensions tablets, pills, capsules, sustained release formulations or powders. When the route is topical, the form may be a cream, ointment, salve or spray.

An effective amount of the therapeutic agent is determined based on the intended goal. The term "unit dose" refers to a physically discrete unit suitable for use in a subject, each unit containing a predetermined quantity of the therapeuticcomposition calculated to produce the desired response in association with its administration, i.e., the appropriate route and treatment regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on thesubject to be treated, the state of the subject and the protection desired. Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual.

All the essential materials and reagents required for treating an inflammation may be assembled together in a kit. When the components of the kit are provided in one or more liquid solutions, the liquid solution preferably is an aqueoussolution, with a sterile aqueous solution being particularly preferred. Containers for the components may include an inhalant, syringe, pipette, eye dropper, or other apparatus, from which the formulation may be applied to an infected area of the body,such as the lungs, injected into a mammal, or even applied to and mixed with the other components of the kit.

The components of the kit may also be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent alsomay be provided in another container within the kit. The kits of the invention may also include an instruction sheet defining administration of p20 polypeptide therapy and/or gene therapy and the pharmaceutical indications of the kit components.

The kits of the present invention also will typically include a vessel for containing the vials in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired vials are retained. Irrespective of the number or type of containers, the kits of the invention also may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement of the ultimate complex composition within the body of amammal. Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.

Parenteral administration, such as intravenous or intramuscular injection, is an exemplary method of delivering the anti-inflammation agents of the present invention to many cell populations. Administration of polypeptides and nucleic acids byinjection for the treatment of disease is described in U.S. Pat. No. 5,580,859 Felgner et al., incorporated herein by reference. Alternatively non-parenteral administration may be desired, including: oral administration; time release capsules; and anyother form known in the art, including cremes, lotions, mouthwashes, inhalants and the like. In one example, gene therapy using the intestine is described in U.S. Pat. No. 5,821,235 to Henning et al., incorporated herein by reference.

The active compounds of the present invention will often be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, subcutaneous, and intraperitoneal routes. Typically, such compositions canbe prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for preparation of solutions or suspensions upon the addition of a liquid prior to injection may be desired; and the preparations can also be emulsified.

Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethyleneglycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.

Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterileinjectable solutions or dispersions can be used. It is preferred that the form is sterile and that it is fluid to the extent that it can be aspirated into a syringe. It should be stable under the conditions of manufacture and storage and should bepreserved against the contaminating action of microorganisms, such as bacteria and fungi.

The active compounds may be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acidssuch as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium,potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.

The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils. Theproper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can bebrought about by various antibacterial ad antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as needed, followed by filter sterilization. Generally,dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for thepreparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filteredsolution thereof.

In certain cases, the therapeutic formulations of the invention could also be prepared in forms suitable for topical administration, such as in cremes and lotions. These forms may be used for treating skin-associated diseases, such as varioussarcomas.

Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type ofinjectable solutions described above, with even drug release capsules and the like being employable.

For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions areespecially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. The sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosagecould be dissolved in 1 milliliter of isotonic NaCl solution and either added to about 1 liter of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035 1038and 1570 1580, incorporated herein by reference). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose forthe individual subject.

Targeting of inflamed tissues may be accomplished in any one of a variety of ways. Plasmid vectors and retroviral vectors, adenovirus vectors, and other viral vectors all present methods by which to target human inflamed. The inventorsanticipate particular success for the use of liposomes to transfer polynucleotides and polypeptides of the present invention into cells including inflamed or non-involved lung cells. In one of the first series of clinical phase to be performed, DNAencoding p20 will be mix with liposomes, and this p20-vector/liposome complex will be administered to patients with certain forms of advanced stage adult respiratory distress syndrome (ARDS) by inhalation of an aerosol. The preferred vector for theinitial phase is the pCMV-p20(His) (see FIG. 11A, also called pcDNA3.1HisC/EBP.beta.-3) because administration of this vector backbone (containing a different insert) is known by the inventors to not elicit an inflammatory response when administered asan aerosol to the lungs of a human patient. Intravenous injection into the afferent blood supply to the organ can also be used to direct the gene to most or all cells of the lung. Directly injecting the liposome-p20 based pharmaceutical formulationinto the proximity of an inflamed foci can also provide for targeting of the formulation. Of course the potential for liposomes that are selectively taken up by a certain populations of cells exists, and such liposomes will also be useful for targetingthe gene.

Those of skill in the art will recognize that the best treatment regimens for using compositions of the present invention, including p20, to suppress inflammation can be straightforwardly determined. This is not a question of experimentation,but rather one of optimization which is routinely conducted in the medical arts. The in vivo studies in nude mice provide a starting point from which to begin to optimize the dosage and delivery regimes. The frequency of injection will initially beonce a week. However, this frequency might be optimally adjusted from one day to every two weeks to monthly, depending upon the results obtained from the initial clinical trials and the needs of a particular patient. Human dosage amounts can initiallybe determined by extrapolating from tests with anti-tumor biological therapeutics; for example, U.S. Pat. No. 5,922,688 to Hung et al., incorporated herein by reference. Accordingly, approximately 15 .mu.g of nucleic acid (p20 encoding, referred tohere as p20 DNA) per 50 kg body weight is desirable. Based on this, a 50 kg woman would receive a dose of approximately 15 mg of p20 DNA per treatment. In certain embodiments it is envisioned that this dosage may vary from between about 100 .mu.g/50 kgbody weight to about 5 .mu.g/g body weight; or from about 90 .mu.g/50 kg body weight to about 10 .mu.g/g body weight or from about 80 .mu.g/50 kg weight to about 15 .mu.g/g body weight; or from about 75 .mu.g/50 kg body weight to about 20 .mu.g/g bodyweight; or from about 60 .mu.g/50 kg body weight to about 30 .mu.g/g body weight about 50 .mu.g/50 kg body weight to about 40 .mu.g/g body weight. In certain embodiments this dose may be about 0.015, 0.15, 0.5, 1, 2, 3, 5, 8, 10 15, or 20 .mu.g/50 kg ofbody weight. Of course, these dosage amounts may be adjusted upward or downward, as is routinely done in such treatment protocols, depending on the results of the initial clinical trials and the needs of a particular patient. Dosage amounts may beadjusted upward or downward by any amount determined to be needed including 10 fold, 100 fold, and 1000 fold.

5.61 Administration by Transfection

The term "transfection" generally refers to the introduction of a nucleic acid into a eukaryotic cell. The present invention also contemplates the transfer or "transfection" of polypeptide/protein forms of p20 into mammalian cells. In many theinstances, the methods used for nucleic acid transfection are easily adopted for the transfer of proteins and are known in the art (see, e.g., Gene Transfer and Expression Protocols (Methods in Molecular Biology, VOL 7) (1991) E. J. Murray (ed.) HumanaPress; M. Kriegler, Gene Transfer and Expression: A Laboratory Manual (1991) Oxford University Press, each reference incorporated herein by reference). In addition, there are numerous commercially available transfection kits (e.g., Stratagene,InVitrogen, Roche, and the like). Transfection techniques being utilized in vivo and ex vivo, are disclosed in U.S. Pat. No. 5,858,784 to R. J. Debs et al., incorporated herein by reference. Transfection techniques are particularly useful for thetransfer of nucleic acid compositions of the present invention into cells wherein transduction by viral-based expression vectors is not employed. Although, these techniques may be used in combination with viral-based vector transduction.

5.62 Lipid Mediated Transfer

Liposome mediated transfection is an exemplary method of introducing p20 polypeptide or polynucleotide compositions into a cell for treatment. Liposome and lipid based methods are readily known to those of skill in the art and numerous kits areavailable commercially (see e.g., Liposome Technology: Liposome Preparation and Related Techniques (1992) G. Gregoriadis (ed.) CRC Press, incorporated herein by reference; U.S. Pat. No. 5,279,833 to Rose, incorporated herein by reference; U.S. Pat. No. 5,567,433 to Collins, incorporated herein by reference; U.S. Pat. No. 4,515,736 to Deamer, incorporated herein by reference; Felgner et al., (1987) Proc. Nat. Acad. Sci., USA 84:471 477, incorporated herein by reference; and Gao et al (1991)Biochem. Biophys. Res. Comm. 179:280 285, incorporated herein by reference).

Currently, gene delivery with cationic lipids is currently the most clinically developed approach to gene therapy (Gene Therapy of Cancer (1999) Lattime et al., (eds.) Academic Press, Chapter 20, incorporated herein by reference). In general,cationic lipids are synthetically manufactured and can be readily mixed with any polynucleotide or polypeptide desired and form linkages based on non-covalent charge-charge interactions; although, covalent linkage is possible also. Numerous cationiclipids are available commercially and can be used in conjunction with the present invention for gene delivery (including in vivo, in vitro, and ex vivo). One of the biggest advantages to using cationic or liposome mediated gene transfer is that thenon-infectious expression vectors described herein are not immunogenic when administered to a mammal including a human. This is especially true when compared to adenoviral-based expression systems which may be the most immunogenic (although useable)embodiment described herein.

Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids aresuspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers. One such commercially available liposomaltransfection reagent is Lipofectamin.TM. (DOTMA:DOPE by Gibco-BRL).

In certain embodiments of the present invention, the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA. In otherembodiments, the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1). In yet further embodiments, the liposome may be complexed or employed in conjunction with both HVJ and HMG-1. In otherembodiments, the delivery vehicle may comprise a ligand and a liposome to target the liposome to particular cell types or tissues.

U.S. Pat. No. 5,059,421 to Loughrey et al., incorporated herein by reference; describes a general method of attaching protein molecules to liposomes to achieve well-characterized and sized protein-liposome conjugate systems for inter-changeabletargeting applications. This pharmaceutical liposomal composition can be targeted to essentially any cell type or tissue, if desired. U.S. Pat. No. 4,885,172 to Bally et al., incorporated herein by reference; describes compositions and methods forstoring liposomes including targeted liposomes and the loading of the such liposomes on an "as needed" basis. U.S. Pat. No. 5,851,818 to Huang et al., incorporated herein by reference; discloses improved methods for preparing nucleic acid/liposomecomplexes including selection of the working medium and liposome lipid to nucleic acid ratios. U.S. Pat. No. 5,279,883 to Rose, incorporated herein by reference; describes liposomal transfection of nucleic acids into animal cells. U.S. Pat. No.5,225,212 to Martin, incorporated herein by reference; describes a liposome composition for extended release of a therapeutic compound into the bloodstream and methods for use thereof.

5.63 Membrane Transport Sequence (MTS) Mediated Transfer

In certain embodiments, a membrane transport sequence (MTS) can function as an agent for the administration of a composition of the present invention, including p20, to a cell. It is demonstrated that when a cell is contacted with a compositionlinked to an MTS, the entire MTS linked composition translocates through the cytoplasmic membrane of a cell (U.S. Pat. No. 5,807,746 to Lin et al., incorporated herein by reference and U.S. Pat. No. 5,877,282 to Nadler et al., incorporated herein byreference). Two functional MTS sequences are provided in the Sequence Listings (SEQ ID NO:12 and SEQ ID NO:13). Additional functional MTS sequences are described in U.S. Pat. No. 5,962,415 to Nadler, incorporated herein by reference.

The MTS can be combined with p20 chemically utilizing the carboxy and amino groups on the proteins or by molecular cloning of an MTS encoding DNA sequence into the p20 expression vector to form a fusion gene with subsequent expression of a fusionprotein. The fusion protein may subsequently be expressed in vitro or in vivo. A fusion gene or fusion protein is one in which two or more sequences which are not combined in nature are combined by the hand of man. A similar term is "chimeric". TheMTS-p20 chimera may include a linker sequence if desired.

5.65 Electroporation, Calcium Phosphate, and Particle Bombardment

In certain embodiments a composition of the present invention is introduced into a cell via electroporation. Electroporation involves the exposure of a suspension of cells and the composition to a high-voltage electric discharge (see U.S. Pat. No. 4,956,288 to Barsoum, incorporated herein by reference). Transfection of nucleic acids and proteins into eukaryotic cells using electroporation is quite successful and known in the art.

In certain embodiments a composition of the present invention is introduced into a cell using calcium phosphate precipitation. Transfection with calcium phosphate is described in U.S. Pat. No. 5,633,156 to Wurm et al., incorporated herein byreference. Human KB cells have been transfected with adenovirus 5 DNA using this technique (Graham et al., (1973) Virology 52:456 467, incorporated herein by reference).

In an alternative embodiment, a composition of the present invention is introduced into a cell by methods that include particle bombardment. This method depends on the ability to accelerate nucleic acid-coated microprojectiles to a high velocityallowing them to pierce cell membranes and enter cells without killing them. Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turnprovides the motive force. The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by theinventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can bemade in the specific embodiments which are disclosed. and still obtain a like or similar result without departing from the spirit and scope of the present invention.

EXAMPLE 1

Materials and Methods

Human Macrophage Cell Line

This line is obtained from ATCC and is designated U-937. This is a human histiocytic lymphoma cell line and is one of the few human cell lines still expressing many of the monocyte-like characteristics exhibited by cells of histiocytic origin. The cells are readily cultured in RPMI.

Normal Primary Human Bronchial Epithelial Cells

The inventors purchase primary human bronchial cells obtained from a normal human subject from Clonetics (San Diego, Calif.). The cells are maintained in LHC8 medium.

Primary Human Lung Fibroblasts (Normal and IPF)

The inventors have collected, cultured and frozen away lung fibroblasts obtained from 7 patients with IPF and 12 normal lungs. The inventors have early passage specimens available from all of these lines.

Transformed Normal and CF Human Bronchial Epithelial Cells

The inventors will use transformed human bronchial epithelial cells which express wild-type cystic fibrosis transmembrane conductance regulator, CFTR, (BEAS cells, obtained from Dr. Curtis Harris at the National Cancer Institute, Laboratory ofHuman Carcinogenesis, Bethesda, Md.) or transformed human bronchial epithelial cells expressing mutant CFTR (IB3, obtained from Dr. Pamela Zeitlin at Johns Hopkins University, Baltimore, Md.), The BEAS cell lines were transformed using an adenovirus-12SV 40 hybrid. The 2CF cells were obtained from human tracheobronchial epithelium and a cell isolation technique was used which enhances recovery of epithelial cells from tracheobronchial submucosal glands. These cells were transformed using an SV 40plasmid. BEAS cells are grown in LHC-8 media (Biofluids, Rockville, Md., USA) supplemented with penicillin/streptomycin and the cystic fibrosis cell lines are grown in DMEM/F12 (Gibco BRL, Grand Island, N.Y.) supplemented with 10% fetal calf serum,glutamine and penicillin/streptomycin.

ELISA Measurements of IL-6 and IL-8

IL-6 or IL-8 protein in cell culture supernatant is determined using sensitive ELISA kits obtained from R+D systems (Quantikine kit) according to manufacturer's instructions. Basically, samples are dispensed into microtiter wells precoated withmurine monoclonal antibody specific for the desired cytokine. The plates are incubated with anti-human IL-6 or IL-8-horseradish peroxidase conjugate, then tetramethylbenzidine and hydrogen peroxide as substrate. The reaction is terminated with a stopbuffer and absorbance read at 450 nm. Values of IL-6 or IL-8 are determined by reference to a standard curve

Preparation of Cytoplasmic and Nuclear Proteins for Western Blot

Cells are removed from culture dishes in solution containing protease and phosphatase inhibitors. After washing, the cells are resuspended in buffer containing the above inhibitors and 0.5% triton to lyse the cells. The suspension iscentrifuged at 1000 g.times.10 min. The supernatant is the cytoplasmic fraction. The nuclear pellet is then lysed with Triton buffer, vortexed, diluted in SDS buffer, boiled.times.5min. This is the nuclear fraction. Total protein in each fraction isdetermined by the Bradford method (Bradford, 1976).

Western Blots

Aliquots of nuclear (50 g) or cytoplasmic proteins (100 g) are mixed with an equal volume of 2.times. sample buffer (containing 0.1% SDS and 2-ME) and boiled for 5 minutes. Denatured proteins are separated by electrophoresis on 5 20% or 10%SDS-polyacrylamide gel along with molecular weight markers and standards. Proteins are transferred to an Immobilon-P membrane in 25 mM Tris base, 192 mM glycine, 5% v/v, methanol pH 8.2, overnight at 40 V. Nonspecific binding is blocked by soaking themembrane in PBS/5% non-fat dried milk with 0.5% Tween 20 for 1 h at room temperature. Immunoreactive proteins are detected by incubating the filter with specific antibodies (anti-C/EBP peptide antibody directed against the 19 amino acid C-terminalpeptide--Santa Cruz Biotechnology) for 1 h at room temperature with constant agitation. Nonspecific binding is washed away by rinsing the filter in PBS containing 0.5% Tween 20. The filters are incubated with horseradish peroxidase (HRP) conjugatedgoat anti-rabbit IgG and detected with Supersignal CL-HRP (for C/EBP) Western Blot luminescent reagent.

Detection of p20 by Immunofluorescence

Cells are grown in special plates containing a central well with glass bottom (Mat-Tek) to confluence and all processing done in the plate. Cells are washed, formalin fixed for 10 min, rewashed .times.3 and permeabilized with triton (0.1% tritonX 20 min), washed .times.3 and blacked with 5% BSA. Fluorescent primary anti-His antibody is then added and the cells incubated for 1 hour, washed .times.4 with 0.1% triton buffer, rinsed and Aquamount added. Slides are kept in the dark to dry untilready to view on fluorescent microscope.

EXAMPLE 2

This example demonstrates attenuation of TNF.alpha. or IL-1.beta. stimulated production of IL-6 and IL-8 in cell lines relevant to human lung diseases by transfection of a plasmid expression vector containing the gene encoding p20 driven by aCMV promoter (pCMVp20). Cell lines studied include: a human macrophage line, primary and transformed normal human bronchial epithelial cells, transformed human bronchial epithelial cells expressing the cystic fibrosis defect, primary normal human lungfibroblasts, and primary lung fibroblasts from humans with idiopathic pulmonary fibrosis. These cell lines are transfected with pCMV-p20-His (which contains a histidine epitope tag for characterization of expression, see FIG. 11A and Example YYY),pRSV-luc (a control plasmid which expresses the luciferase gene), or no vector. The transfections are carried out in this example using cationic liposome mediated DNA delivery. The expression of p20 by Western blots and immunofluorescence (with afluorescent antibody to the histidine epitope tag) and the expression of IL-6 and IL-8 in response to stimulation with the proximal cytokines IL-1.beta. and TNF.alpha. are determined.

In each study, simultaneous untransfected, control transfected and p20 transfected cells are studied under identical conditions and using identical protocols. Initial studies are done to determine the time course of p20 expression followingtransfection as well as to estimate the fraction of cells expressing the transgene. Sister wells of cells are transfected with either control or pCMV-p20 vectors and immunofluorescence performed at daily intervals with the fraction of cells showingspecific staining counted. At the time of peak p20 expression determined in this way, the inventors harvest cells and isolate cytoplasmic and nuclear protein fractions for Western blotting as an additional determination of transgene expression and tolocalize the transgene product.

The next series of studies is the determination of IL-6 and IL-8 responses in each of the cell types. In these studies, the inventors measure the effects of a range of concentrations of either TNF.alpha. or IL-1 on the production of IL-6 andIL-8 over various time periods as measured by ELISA performed on the medium. Such time periods include 30 minute, 2 hours, 4 hours, 8 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, and 72 hours. For each cell type, the inventors transfectwith either the control plasmid, the pCMVp20 vector or nothing and at the time of peak p20 expression determined above, will add a range of concentrations of TNF or IL-1 to the culture medium, incubate the cells for 24 hours (or another time period) andcollect the medium for IL-6 and IL-8 analysis. The concentration range of the proximal cytokines (IL-1.beta. and TNF.alpha. is from about 1 pg/ml to about 100 ng/ml).

The inventors find that expression of the p20 gene results in nuclear localization of increased amounts of the p20 protein and that these cells produce less IL-6 or IL-8 when stimulated with proximal cytokines because the p20 inhibits activity ofC/EBP.beta.. The range of IL-6 or IL-8 production in the p20 treated cells is from about 15% less to about 1000 times less IL-6 or IL-8 produced than in the non-p20 treated cells. It is anticipated that pro-inflammatory markers will be suppressed andinflammation will be inhibited in cells derived from other diseases characterized by dysregulated inflammation, in addition to CF and IPF, including ARDS and asthma.

EXAMPLE 3

This example describes methods for delivering the p20 protein intra-cellularly using a liposome delivery system. Delivery of the p20 protein by this method results in the attenuation of TNF.alpha. or IL-1.beta. stimulated production of IL-6and IL-8 in the following cells: a human macrophage line, primary and transformed normal human bronchial epithelial cells, transformed human bronchial epithelial cells expressing the cystic fibrosis defect, primary normal human lung fibroblasts, andprimary lung fibroblasts from humans with idiopathic pulmonary fibrosis.

Without being bound to this mechanism, the inventors believe that delivery of the p20 protein into the cytoplasmic compartment of a cell (transfer across the cytoplasmic membrane) results in the subsequent transfer of the p20 protein into thenuclear compartment of the cell because p20 contains nuclear localization signals and normally exists predominantly in the nucleus. Also without being bound to mechanism, the inventors believe that once in the nucleus the transferred p20 binds toC/EBP.beta. DNA binding sites and inhibits C/EBP.beta. transcriptional activation. Alternatively, and possibly in combination with the previous mechanism, the p20 may interrupt protein to protein interactions that are involved in the transactivationof pro-inflammatory cytokines or other factors which in turn drive the inflammatory response.

For these studies, the inventors are using a recombinant p20 protein containing a histidine tag so that it can be readily detected by immunofluorescence using an antibody to the histidine tag. There are numerous formulation strategies whichmight prove effective for delivering p20 as a lipid-protein complex. These could include encapsulation in anionic liposomes, addition of a poly-lysine tail to the p20 protein and creation of a cationic liposome-polylysine-p20 complex by charge-chargeinteraction, and chemically linking p20 to an appropriate lipid.

Initially two lipid based methods are tested: cationic liposome-p20 mixtures and an anionic liposome containing a surface transferrin as a targeting molecule complexed with p20 by charge-charge interaction. In some circumstances, addition ofmixtures of cationic liposomes and cationic protein to cells results in uptake of the protein. Transferrin has been shown to be an active targeting molecule for a number of cell types. In the cell types listed above, the inventors add either anionicliposome-p20 complexes or mixtures of cationic liposomes and p20 in a range of lipid:DNA ratios and measure the delivery of the p20 by performing immunofluorescence on the cultures and counting the percent of positively staining cells. In addition, theinventors harvest cells and determine p20 by Western blot of separated cytoplasmic and nuclear protein fractions. This fluorescent antibody staining technique is used to determine a time course for the nuclear p20 signal and subsequent Western analysesand comparisons of various delivery strategies are then be done at a time of maximum signal.

Exogenous p20 protein, irrelevant protein, and no protein are delivered to each cell type listed above. In certain cases, either IL-1.beta. or TNF.alpha. are added at a time that p20 in the nucleus is shown to be at its maximum. Theconcentrations of IL-6 or IL-8 are measured in the medium of the cells in each experiment at various time points (as above). The inventors find that cells containing exogenous p20 show diminished production of IL-6 or IL-8 when stimulated with proximalcytokines including cells from patients with CF, IPF, ARDS, and asthma. It is anticipated that pro-inflammatory marker will be suppressed and inflammation will be inhibited in cells derived from other diseases characterized by dysregulated inflammationincluding ARDS and asthma.

In alternative experiments the inventors encapsulate the p20 into anionic liposomes and creation of cationic liposome-polylysine-p20 complexes. Also different lipid-protein ratios and different liposome targeting strategies are tested. Incertain experiments, different p20 delivery formulations are used for different cell types. Plus, the experiments are repeated with a recombinant p20 protein that lacks the histidine tag and a recombinant p20 protein made by mammalian cells whichprovide a p20 protein with full mammalian post-translational processing. Also, non-recombinant p20 is isolated from a natural source such as cultured mammalian cells for certain embodiments in this invention.

EXAMPLE 4

This example describes methods wherein the intracellular delivery and inhibitory activity of p20 are achieved by creating a recombinant fusion protein consisting of p20 and a "membrane translocating sequence" (MTS). An MTS has been described inU.S. Pat. No. 5,807,746 to Lin et al., incorporated herein by reference, to be capable of escorting a protein through the cytoplasmic membrane. The inventors find that a MTS-p20 fusion protein delivers functioning p20 to the nucleus and inhibitsTNF.alpha. or IL-1.beta. stimulated production of IL-6 and IL-8 in the same cell lines as in Examples 2 and 3.

EXAMPLE 5

In this example, the inventors administer the p20 protein to lung cells in vivo using a MTS-p20 fusion protein strategy. The MTS-p20 fusion protein is made using standard recombinant DNA cloning techniques in which the 3' end of a MTSpolynucleotide (for example encoding the polypeptide set forth in SEQ ID NO:12) is ligated to the 5' end of a p20 polynucleotide sequence (SEQ ID NO:4) forming a MTS-p20 recombinant polynucleotide. The MTS-p20 recombinant polynucleotide is cloned intoan expression vector by recombinant cloning methods and expressed. The resulting recombinant polypeptide is isolated by standard methods of protein isolation known to one with skill in the art (preferably by Ni-affinity chromatography of an incorporatedpolyhistidine tag). The recombinant MTS-p20 fusion protein is comprised of a 12-residue MTS (described in U.S. Pat. No. 5,807,746, supra, AAVLLPVLLAAP, SEQ ID NO:12) combined by its C-terminal end to the N-terminal end of the p20 polypeptide (SEQ IDNO:7) forming a MTS-p20 fusion polypeptide. Other combinations of an MTS-p20 fusion protein are also contemplated; such as, p20 being N-terminal to the MTS, or possibly, an MTS being inserted into a p20 polypeptide (or an in-frame insertion into anencoding nucleic acid).

The inventors will produce the recombinant fusion protein as follows. A synthetic oligonucleotide encoding the MTS sequence given above will be inserted into the inventors' expression vector containing the p20 gene at the N-terminal of thecoding sequence (pcDNA3.1HisC/EBP.beta.-3, FIG. 11A). This vector will be used to produce the recombinant fusion protein in E. coli. The protein will be purified from bacterial cell lysates by Ni-affinity chromatography.

In the cell types listed above, the inventors will add a range of concentrations of the p20-MTS fusion protein and determine that protein is delivered to the cells by performing immunofluorescence and counting the percent of positively stainingcells. In addition, the inventors will harvest cells and determine p20 by Western blot of separated cytoplasmic and nuclear protein fractions. In preliminary studies, the inventors will use the fluorescent antibody staining technique to determine atime course for the nuclear p20 signal and subsequent Western analyses will then be done at a time of maximum signal.

Having established that the p20-MTS fusion protein is targeted to the nucleus, the inventors will determine whether cells containing this exogenous p20 show diminished production of IL-6 and IL-8 when stimulated with proximal cytokines. Thecontrol studies will include untreated cells and cells which have been exposed to the same concentrations of p20 protein which does not contain the membrane translocation signal. In all cases, either IL-1.beta. or TNF.alpha. will be added at a timethat p20 in the nucleus was shown to be at its maximum and medium concentrations of IL-6 and IL-8 measured after 24 hours incubation.

The inventors anticipate that the p20-MTS fusion protein will effectively deliver p20 to the cells, that it will localize in the nucleus, inhibit transactivation activity of C/EBP.beta. and thus attenuate TNF or IL-1 stimulated production ofIL-8 and IL-6. Although the MTS has been shown capable of delivering even larger proteins to cells, it is possible that that will not be the case for the inventors' cell preparations and p20. It is also possible that addition of MTS sequences to thep20 protein will mask nuclear localization signals and thus that the fusion protein will enter the cell but remain in the cytoplasm and thus not function to inhibit C/EBP.beta.. The inventors should know this from the immunofluorescence localizationstudies. This is not expected, though, as the inventors have predicted the location of two bipartite NLSs in p20 (FIG. 5) and these should not be affected by a terminal fusion protein. It is also possible that the fusion protein will enter the nucleusbut not bind appropriately to DNA and therefore not serve as an inhibitor of C/EBP.beta.. In either of these cases, the inventors would place the MTS sequences on the end of the p20 gene encoding the C terminal sequence and repeat the experiments. Inany event, the present invention is not bound by mechanism and it is determined herein that expression of p20 in cells stimulated by an inflammatory agent, inhibits the inflammatory response.

EXAMPLE 6

In this example, the inventors describe the construction of a hybrid retrovirus/Epstein Barr virus (hybrid retro/EBV) expression vector with a p20 insert. The vector with insert is referred to as pLZRSHis-C/EBP.beta.-3 or pLZRSHis-p20 (see FIGS.11A C). To obtain LZRS vector encoding epitope-tagged C/EBP.beta.-3, prsetALip plasmid (including the p20 sequence) is digested with Bam HI and Eco RI restriction endonucleases followed by gel electrophoresis and isolation of a 575 basepair p20fragment. The p20 fragment is ligated into a similarly digested (Bam HI and Eco RI) pcDNA3.1HisC vector to generate pcDNA3.1His-p20 plasmid (FIG. 11A). This vector is then digested with Hin DIII/Not I restriction endonucleases followed by gelelectrophoresis and isolation of a 711 basepair His-tagged p20 fragment. The pLZRSpBMN-Z plasmid is digested with Hin DIII/Not I also. A 11,452 basepair fragment is isolated and ligated to the 711 basepair His-tagged C/EBP.beta.-3 fragment to generatepLZRS-His-C/EBP.beta.-3 (FIG. 11B). Again the control vector contains the .beta.-galactosidase gene. A diagram of the pLZRS-His-p20 vector is shown in FIG. 11C.

Helper-free retrovirus is obtained by transfecting the pLZRShis-p20 vector, or control LZRSpBMN-Z vector encoding .beta.-galactosidase, into a 293T-based amphotropic packaging cell line termed .phi.nx-ampho (provided by Gary Nolan, StanfordUniversity, California, USA). These methods are known to those of skill in the art. Briefly, 1 .mu.g of pLZRShis-p20 vector or 1 .mu.g of LZRSpBMN-Z vector is transfected into the .phi.nx-ampho cells using GenePorter liposome reagent according to themanufacture's directions. Transfected cells were maintained in puromycin to select for episomal maintenance of the transfected vector.

High titre virus is collected as follows. Three weeks prior to performing transfections, (.phi.)nx-ampho cells are reselected in the presence of diphtheria toxin and hygromycin B to increase envelope and gag-pol expression. Packaging cells arethen transfected by standard calcium phosphate procedures, and viral supernatants (in culture medium) are harvested at 48 hours post-transfection, clarified, and stored frozen at 800 C. Cells are then trypsinized and replated in medium containingpuromycin (to select for episomal maintenance of the LZRS-based construct). Upon reaching 70% confluence, cells are placed in puromycin free medium for 24 hrs prior to harvesting virus as before. This procedure is carried out for production andcollection of viral stocks for up to 3 weeks post-transfection. For general reference, see, Nolan et al. (1998) Expression vectors and delivery systems. Curr. Opin. Biotechnol. 9, 447 450 and Grignani et al. (1998) High efficiency gene transfer andselection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein Cancer Res. 58, 14 19; each reference incorporated herein by reference. High titer, helper free C/EBP.beta.-3 retrovirus canbe collected for about the first week after transfection.

All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms ofpreferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept,spirit and scope of the invention. It will be apparent, also, that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All suchsimilar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined in the claims.

EXAMPLE 7

In this example, the inventors describe the construction of an epitope tagged C/EBP.beta.-1 retroviral vector with a mutation in the C/EBP.beta.-2 translation initiation site (the second in-frame ATG described in FIG. 3A). A hybrid Epstein-Barrvirus (EBV)/retroviral vector construct, LZRSpBMN-Z, is provided by Gary P. Nolan (Stanford University, California, USA). The LZRSpBMN-Z is described in U.S. Pat. No. 5,830,725 to Nolan et al., incorporated herein by reference. The LZRSpBMN-Z vectorfeatures episomal replication which enables production of high titer virus and high efficiency gene transfer. In addition to a murine retroviral backbone with a polylinker region to facilitate insertion of cDNAs, the LZRSpBMN-Z vector contains theEpstein-Barr virus Nuclear Antigen (EBNA) gene, EBV origin of replication and nuclear retention sequences (oriP), and a puromycin resistance gene. The nuclear replication and retention function of this vector allow for rapid establishment of recombinantretroviral producer DNA as stable episomes within human retroviral packaging cell lines. Episomes are maintained at approximately 5 20 copies per cell for up to 2 3 months, given selection for puromycin resistance, resulting in high viral titers. Theretroviral backbone in this vector consists of full-length Moloney murine leukemia virus (MoMLV) long terminal repeat (LTR) and extended .psi. packaging sequences derived from the MFG series of retroviral vectors developed by Mulligan and colleagues.

To obtain LZRS vector encoding epitope-tagged C/EBP.beta.-1, the .beta.-galactosidase gene encoded by the prototype LZRSpBMN-Z vector is excised and replaced with his-tagged C/EBP.beta.-1 fragments to generate a pLZRShisC/EBP.beta.-1 vector. Theconstruction of the pLZRShisC/EBP.beta.-1 vector is completed in several steps (FIGS. 11D G). First a CMV-NFIL6 vector is digested with Sal I, incubated at 4 C with DNA Polymerase I to generate blunt ends, and digested with Eco RI to release a 1,045basepair fragment containing C/EBP.beta.-1 from CMV-NFIL6. In this case the CMV-NFIL6 vector was obtained from S. Akira. However, a clone of C/EBP.beta.-1 can be obtained using standard methods known to one with skill in the art from a cDNA library orgenomic DNA. Next, the 1,045 basepair fragment is inserted into the pRSETC vector (available from InVitrogen, San Diego, Calif., USA) for mutagenesis and to acquire the polyhistidine epitope tag which is included in the pRSETC vector (FIG. 11D). ThepRSETC vector is digested with Hind III, incubated at 4 C with DNA Polymerase I, and digested by Eco RI, and the 1,045 basepair C/EBP.beta.-1 fragment is ligated into place forming the pRSETC-C/EBP.beta. (which is also called pRSETC-NFIL6) (FIG. 11D). Mutagenesis is conducted by replacing a 106 basepair Bgl II to Msc I fragment of the pRSETC-C/EBP.beta.-1 vector with synthetic oligos (commercially available) shown in FIG 11E. The top strand oligo is listed in SEQ ID NO:21. The bottom strand oligo islisted in SEQ ID NO:22. Several mutations in the top strand oligonucleotide create a Kozak sequence and are underlined in FIG. 11E and run from about position 293 to 302. The mutant residues eliminating the ATG for C/EBP.beta.-2 expression areunderlined, also, in FIG. 11E at approximately positions 368 and 369. The mutations can be compared to the wild-type C/EBP.beta. sequence for this region as shown in FIG. 11E, also. FIG. 11F shows that cloning of the epitope tagged C/EBP.beta.-1 withKozak and C/EBP.beta.-2 elimination mutations from pcDNA3.1HisAC/EBP.beta.-1 into pLZRSpBMN-Z forming the pLZRS-His-C/EBP.beta.-1 vector. FIG. 11G shows a diagram of the LZRS vector with an epitope-tagged C/EBP.beta.-1 insert (pLZRShisC/EBP.beta.-1). Control vector would remain unchanged and contain a .beta.-galactosidase encoding sequence. Similar methods can be used to ensure selective expression of p20 by mutating the C/EBP.beta.-2 and/or C/EBP.beta.-1 translation start site and creating a Kozaksequence at the C/EBP.beta.-3 translation initiation site.

EXAMPLE 8

In this example, the inventors describe the effects of in vivo lipopolysaccharide (endotoxin) administration to piglets on p20 and p42 expression, wherein the lung and liver are placed in a perfusion circuit (optionally, the lung or the liver canbe placed in a perfusion circuit independently). As seen in FIG. 9A, p20 expression in piglet lung tissue is increased in the control which is perfused, but not stimulated with LPS. This increase in p20 expression is believed to be the normalphysiological response to an inflammatory stimulus, in this case, mechanical stress. The administration of LPS to the perfusion, however, shows a rapid decline in p20 expression over to essentially no expression within 15 minutes. These data suggestthat endotoxin has a physiological mechanism for overcoming a normal response to inflammation and may explain some of the pathological activity of endotoxin (a prevention to the down regulation of the inflammatory response).

The data in FIG. 9B show the relative ration of p20 to p42 expression in piglet lung tissue following (+/-) treatment with LPS (as above). (The data in each case are reported in relative densitometric units from scans of Western blots.) Anincrease in the p20 to p42 ratio is observed for the normal case following a pro-inflammatory stimulus (mechanical stress from the perfusion). A decrease in p20 to p42 ratio is observed in piglet lung tissue if LPS is administered (FIG. 9B). Inconclusion, an increase in p20 expression and possibly an increase in the p20 to p42 ratio is a normal physiological response to an inflammatory stimulus. Certain inflammatory stimuli, such as endotoxin, which are associated with a hyper-reactiveinflammatory response; are able to overcome the normal cellular safeguards which defuse the response. Therefore, in certain embodiments of the present invention, p20 (protein or encoded in a nucleic acid for expression) is used to inhibit or prevent aninflammation associated with an agent that overwhelms the cellular defenses to hyper-reactive inflammation.

EXAMPLE 9

In this example, the inventors describe one method for generation of a membrane permeable fusion protein, specifically a glutathione S-transferase (marker/reporter) plus p20 plus membrane transport sequence fusion polypeptide (GST-p20-MTS).

Using the sequence of C/EBP.beta. protein, described by Akira et al (GeneBank record:NM005194) the primers p20-1 and p20-2 were designed. The sequences are:

TABLE-US-00001 p20-1 (CCGGATCCCCATGGCGGGCTTCCCGTACGCGCTGCGC, SEQ ID NO:23) and P20-2 (CCGGATCCCGCAGTGGCCGGAGGAGGCGAGCAGGGGCTC, SEQ ID NO:24).

Using cDNA of C/EBP.beta. protein provided by GeneRx+, Nashville, Tenn.; cDNA corresponding to the p20 protein was amplified by PCR (amino acids 596 1035 of the supplied C/EBP.beta. cDNA vector).

TABLE-US-00002 PCR protocol: Reaction: 10 .times. Taq buffer 5 ul MgCl.sub.2 25 mM 2 ul p20-1 primer (10 uM) 2.5 ul p20-2 primer (10 uM) 2.5 ul cDNA (1 ng/ml) 10 ul dNTP (2.5 mM each) 8 ul Taq polymerase 1 ul Program: 95.degree. C. .times. 5min 65.degree. C. .times. 2 min 1 cycle 72.degree. C. .times. 2 min 95.degree. C. .times. 1 min 65.degree. C. .times. 2 min 35 cycles 72.degree. C. .times. 2 min 4.degree. C. .times. 8 hours 1 cycle.

Purification of PCR Product:

A 1% agarose gel, band corresponding to the PCR product was cut and cDNA purified using a Qiagen agarose extraction Kit.

Cloning PCR Fragment into pGEM-T Easy Vector:

TABLE-US-00003 Ligation: 2 .times. rapid ligation buffer 5 ul Vector pGEM-T easy 1 ul PCR product 4 ul T4 DNA ligase 3 ul

Overnight reaction at 4 C

Plasmid Transformed into DH5.alpha. Bacteria:

Mini-preps and digestion with Bam-H1 from transformation were performed using techniques standard in the art, one clone (identified as #7) was positive for the insert. The plasmid pGEMT-p20 Midi-prep total yield was 300 ug/ml (in 1 ml).

The cDNA was digested with BamH1 restriction endonuclease and gel purified yielding a BamH1-BamH1 p20 cDNA.

Ligation of the Bam H1 Digested p20 Fragment into MTS-2 Vector (Provided by GeneRx+, Inc.:

TABLE-US-00004 MTS-2 vector (BamH1/BamH1) CIP treated 2 ul P20 insert (BamH1/BamH1) 2 ul T4 DNA ligase Buffer 1 ul T4 DNA ligase 1 ul Water 4 ul

Reaction was incubated overnight at 18 C

Transformation into BL-21 Bacteria:

Mini-preps and digestion (Bstw-1/EcoR1) to identify colonies that are positive for the fusion insert and which have the insert in the right orientation were performed. A protein expression assay was carried out in four different clones that werepositive by the restriction assay above, including non-permeable GST-p20. All were positive. Coomassie stain and Western blot analysis using and anti-C/EBP.beta. antibody (against COO terminal) confirmed this.

Protein Purification Using Glutathione Agarose Gel:

Bacteria strain BL-21(DE-3)RP was transformed with MTS-2-p20 plasmids for fusion polypeptide expression. Mini-preps and digestion (Bstw-1/EcoR1) were carried out to identify colonies that have the insert and which have the insert in the rightorientation. Protein expression assays in four different clones, including non-permeable GST-p20 were all positive.

Import Assay:

An import assay (see Example 9) was performed to identify and/or quantify importation of MTS-linked polypeptide into mammalian cells. The protein was visualized by in-direct immunofluorescence in NIH3T3 cells (see FIG. 14).

EXAMPLE 9

Import Assay

NIH 3T3 cells were incubated with MTS-p20 fusion polypeptide and p20 polypeptide without an MTS at protein concentrations of approximately 50 .mu.g protein/ml of culture medium. The MTS-p20 and the p20 both included a his tag for purification(see Example 8). After 1 hour, cells were stained with either nucleic acid stain or with antibody against p20 protein (C-terminal). Only cells incubated with MTS-p20 showed abundant presence of the p20 protein in the nucleus of the cell (see FIG. 14,p20 includes a strong nuclear transport signal).

>

SEQUENCE LISTING < NUMBER OF SEQ ID NOS: 33 <2SEQ ID NO LENGTH: t;2TYPE: DNA <2ORGANISM: Homo sapiens <22EATURE: <22AME/KEY: modified_base <222> LOCATION: (;223> OTHER INFORMATION: "n" represents a, t, c or g <4SEQUENCE: tcgcg tcccggcggc gcggcggagg ggccggcgtg acgcagcggt tgctacgggc 6ttata aataaccgggctcaggagaa actttagcga gtcagagccg cgcacgggac gaagggg acccacccga gggtccagcc accagccccc tcactaatag cggccacccc agcggcg gcagcagcag cagcgacgca gcggcgacag ctcagagcag ggaggccgcg 24gcggg ccggccggag cgggcagccc caggccccct ccccgggcac ccgcgttcat3cgcctg gtggcctggg acccagcatg tctccccctg ccgccgccgc cgcctgcctt 36ccatg gaagtggcca acttctacta cgaggcggac tgcttggctg ctgcgtacgg 42aggcg gcccccgcgg cgccccccgc ggccagaccc gggccgcgcc cccccgccgg 48tgggc agcatcggcg accacgagcgcgccatcgac ttcagcccgt acctggagcc 54gcgcg ccgcaggccc cggcgcccgc cacggccacg gacaccttcg aggcggctcc 6gcgccc gcccccgcgc ccgcctcctc cgggcagcac cacgacttcc tctccgacct 66ccgac gactacgggg gcaagaactg caagaagccg gccgagtacg gctacgtgag 72ggcgc ctgggggctg ccaagggcgc gctgcacccc ggctgcttcg cgcccctgca 78cgccc ccgccgccgc cgccgcccgc cgagctcaag gcggagccgg gcttcgagcc 84actgc aagcggaagg aggaggccgg ggcgccgggc ggcggcgcag gcatggcggc 9ttcccg tacgcgctgc gcgcttacct cggctaccaggcggtgccga gcggcagcag 96gcctc tccacgtcct cctcgtccag cccgcccggc acgccgagcc ccgctgacgc aggccccc ccgaccgcct gctacgcggg ggccgggccg gcgccctcgc aggtcaagag aggccaag aagaccgtgg acaagcacag cgacgagtac aagatccggc gcgagcgcaa acatcgccgtgcgcaaga gccgcgacaa ggccaagatg cgcaacctgg agacgcagca aggtcctg gagctcacgg ccgagaacga gcggctgcag aagaaggtgg agcagctgtc gcgagctc agcaccctgc ggaacttgtt caagcagctg cccgagcccc tgctcgcctc ccggccac tgctagcgcg gcccccgcgg cgtccccctggggccggccg gggctgagac cggggagc gcccgcgccc gcgccctcgc ccccnccccc nnnnccgcaa aactttggca ggggcact tggcagcngg ggagcccgtc ggtaatttta atattttatt atatatatat ctatattt tgccaaccaa ccgtacatgc agatggctcc cgcccgtggt gtataaagaa aatgtctatgtgtacaga tgaatgataa actctctgct ctccctctgc ccctctccag ccggcggg cggggccggt ttcgaagttg atgcaatcgg tttaaacatg gctgaacgcg tgtacacg ggactgacgc aacccacgtg taactgtcag ccgggccctg agtaatcgct aagatgtt ctagggcttg ttgctgttga tgttttgttttgttttgttt tttggtcttt ttgtatta taaaaaataa tctatttcta tgagaaaaga ggcgtctgta tattttggga cttttccg tttcaagcaa ttaagaacac ttttaataaa cttttttttg t;2SEQ ID NO 2 <2LENGTH: t;2TYPE: DNA <2ORGANISM:Homo sapiens <4SEQUENCE: 2 atgcaacgcc tggtggcctg ggacccagca tgtctccccc tgccgccgcc gccgcctgcc 6atcca tggaagtggc caacttctac tacgaggcgg actgcttggc tgctgcgtac ggcaagg cggcccccgc ggcgcccccc gcggccagac ccgggccgcg cccccccgcc gagctgg gcagcatcgg cgaccacgag cgcgccatcg acttcagccc gtacctggag 24gggcg cgccgcaggc cccggcgccc gccacggcca cggacacctt cgaggcggct 3ccgcgc ccgcccccgc gcccgcctcc tccgggcagc accacgactt cctctccgac 36ctccg acgactacgg gggcaagaac tgcaagaagccggccgagta cggctacgtg 42ggggc gcctgggggc tgccaagggc gcgctgcacc ccggctgctt cgcgcccctg 48accgc ccccgccgcc gccgccgccc gccgagctca aggcggagcc gggcttcgag 54ggact gcaagcggaa ggaggaggcc ggggcgccgg gcggcggcgc aggcatggcg 6gcttcccgtacgcgct gcgcgcttac ctcggctacc aggcggtgcc gagcggcagc 66gagcc tctccacgtc ctcctcgtcc agcccgcccg gcacgccgag ccccgctgac 72ggccc ccccgaccgc ctgctacgcg ggggccgggc cggcgccctc gcaggtcaag 78ggcca agaagaccgt ggacaagcac agcgacgagt acaagatccggcgcgagcgc 84catcg ccgtgcgcaa gagccgcgac aaggccaaga tgcgcaacct ggagacgcag 9aggtcc tggagctcac ggccgagaac gagcggctgc agaagaaggt ggagcagctg 96cgagc tcagcaccct gcggaacttg ttcaagcagc tgcccgagcc cctgctcgcc ctccggcc actgctag t;2SEQ ID NO 3 <2LENGTH: 969 <2TYPE: DNA <2ORGANISM: Homo sapiens <4SEQUENCE: 3 atggaagtgg ccaacttcta ctacgaggcg gactgcttgg ctgctgcgta cggcggcaag 6ccccg cggcgccccc cgcggccaga cccgggccgc gcccccccgccggcgagctg agcatcg gcgaccacga gcgcgccatc gacttcagcc cgtacctgga gccgctgggc ccgcagg ccccggcgcc cgccacggcc acggacacct tcgaggcggc tccgcccgcg 24ccccg cgcccgcctc ctccgggcag caccacgact tcctctccga cctcttctcc 3actacg ggggcaagaactgcaagaag ccggccgagt acggctacgt gagcctgggg 36ggggg ctgccaaggg cgcgctgcac cccggctgct tcgcgcccct gcacccaccg 42gccgc cgccgccgcc cgccgagctc aaggcggagc cgggcttcga gcccgcggac 48gcgga aggaggaggc cggggcgccg ggcggcggcg caggcatggc ggcgggcttc54cgcgc tgcgcgctta cctcggctac caggcggtgc cgagcggcag cagcgggagc 6ccacgt cctcctcgtc cagcccgccc ggcacgccga gccccgctga cgccaaggcc 66gaccg cctgctacgc gggggccggg ccggcgccct cgcaggtcaa gagcaaggcc 72gaccg tggacaagca cagcgacgagtacaagatcc ggcgcgagcg caacaacatc 78gcgca agagccgcga caaggccaag atgcgcaacc tggagacgca gcacaaggtc 84gctca cggccgagaa cgagcggctg cagaagaagg tggagcagct gtcgcgcgag 9gcaccc tgcggaactt gttcaagcag ctgcccgagc ccctgctcgc ctcctccggc 96ctag 969 <2SEQ ID NO 4 <2LENGTH: 444 <2TYPE: DNA <2ORGANISM: Homo sapiens <4SEQUENCE: 4 atggcggcgg gcttcccgta cgcgctgcgc gcttacctcg gctaccaggc ggtgccgagc 6cagcg ggagcctctc cacgtcctcctcgtccagcc cgcccggcac gccgagcccc gacgcca aggccccccc gaccgcctgc tacgcggggg ccgggccggc gccctcgcag aagagca aggccaagaa gaccgtggac aagcacagcg acgagtacaa gatccggcgc 24caaca acatcgccgt gcgcaagagc cgcgacaagg ccaagatgcg caacctggag 3agcaca aggtcctgga gctcacggcc gagaacgagc ggctgcagaa gaaggtggag 36gtcgc gcgagctcag caccctgcgg aacttgttca agcagctgcc cgagcccctg 42ctcct ccggccactg ctag 444 <2SEQ ID NO 5 <2LENGTH: 345 <2TYPE: PRT <2ORGANISM: Homo sapiens <4SEQUENCE: 5 Met Gln Arg Leu Val Ala Trp Asp Pro Ala Cys Leu Pro Leu Pro Pro Pro Pro Ala Phe Lys Ser Met Glu Val Ala Asn Phe Tyr Tyr Glu 2 Ala Asp Cys Leu Ala Ala Ala Tyr Gly Gly Lys Ala Ala Pro AlaAla 35 4o Pro Ala Ala Arg Pro Gly Pro Arg Pro Pro Ala Gly Glu Leu Gly 5 Ser Ile Gly Asp His Glu Arg Ala Ile Asp Phe Ser Pro Tyr Leu Glu 65 7 Pro Leu Gly Ala Pro Gln Ala Pro Ala Pro Ala Thr Ala Thr Asp Thr 85 9e Glu Ala Ala ProPro Ala Pro Ala Pro Ala Pro Ala Ser Ser Gly His His Asp Phe Leu Ser Asp Leu Phe Ser Asp Asp Tyr Gly Gly Asn Cys Lys Lys Pro Ala Glu Tyr Gly Tyr Val Ser Leu Gly Arg Gly Ala Ala Lys Gly Ala Leu His Pro GlyCys Phe Ala Pro Leu His Pro Pro Pro Pro Pro Pro Pro Pro Pro Ala Glu Leu Lys Ala Glu Gly Phe Glu Pro Ala Asp Cys Lys Arg Lys Glu Glu Ala Gly Ala Gly Gly Gly Ala Gly Met Ala Ala Gly Phe Pro Tyr Ala Leu Arg 2Tyr Leu Gly Tyr Gln Ala Val Pro Ser Gly Ser Ser Gly Ser Leu 222hr Ser Ser Ser Ser Ser Pro Pro Gly Thr Pro Ser Pro Ala Asp 225 234ys Ala Pro Pro Thr Ala Cys Tyr Ala Gly Ala Gly Pro Ala Pro 245 25er GlnVal Lys Ser Lys Ala Lys Lys Thr Val Asp Lys His Ser Asp 267yr Lys Ile Arg Arg Glu Arg Asn Asn Ile Ala Val Arg Lys Ser 275 28BR>

Arg Asp Lys Ala Lys Met Arg Asn Leu Glu Thr Gln His Lys Val Leu 29Leu Thr Ala Glu Asn Glu Arg Leu Gln Lys Lys Val Glu Gln Leu 33Ser Arg Glu Leu Ser Thr Leu Arg Asn Leu Phe Lys Gln Leu Pro Glu 325 33ro Leu LeuAla Ser Ser Gly His Cys 34lt;2SEQ ID NO 6 <2LENGTH: 322 <2TYPE: PRT <2ORGANISM: Homo sapiens <4SEQUENCE: 6 Met Glu Val Ala Asn Phe Tyr Tyr Glu Ala Asp Cys Leu Ala Ala Ala Gly Gly Lys AlaAla Pro Ala Ala Pro Pro Ala Ala Arg Pro Gly 2 Pro Arg Pro Pro Ala Gly Glu Leu Gly Ser Ile Gly Asp His Glu Arg 35 4a Ile Asp Phe Ser Pro Tyr Leu Glu Pro Leu Gly Ala Pro Gln Ala 5 Pro Ala Pro Ala Thr Ala Thr Asp Thr Phe Glu Ala Ala ProPro Ala 65 7 Pro Ala Pro Ala Pro Ala Ser Ser Gly Gln His His Asp Phe Leu Ser 85 9p Leu Phe Ser Asp Asp Tyr Gly Gly Lys Asn Cys Lys Lys Pro Ala Tyr Gly Tyr Val Ser Leu Gly Arg Leu Gly Ala Ala Lys Gly Ala HisPro Gly Cys Phe Ala Pro Leu His Pro Pro Pro Pro Pro Pro Pro Pro Ala Glu Leu Lys Ala Glu Pro Gly Phe Glu Pro Ala Asp Cys Lys Arg Lys Glu Glu Ala Gly Ala Pro Gly Gly Gly Ala Gly Met Ala Gly Phe Pro Tyr AlaLeu Arg Ala Tyr Leu Gly Tyr Gln Ala Pro Ser Gly Ser Ser Gly Ser Leu Ser Thr Ser Ser Ser Ser Ser 2Pro Gly Thr Pro Ser Pro Ala Asp Ala Lys Ala Pro Pro Thr Ala 222yr Ala Gly Ala Gly Pro Ala Pro Ser Gln Val LysSer Lys Ala 225 234ys Thr Val Asp Lys His Ser Asp Glu Tyr Lys Ile Arg Arg Glu 245 25rg Asn Asn Ile Ala Val Arg Lys Ser Arg Asp Lys Ala Lys Met Arg 267eu Glu Thr Gln His Lys Val Leu Glu Leu Thr Ala Glu Asn Glu 275 28rg Leu Gln Lys Lys Val Glu Gln Leu Ser Arg Glu Leu Ser Thr Leu 29Asn Leu Phe Lys Gln Leu Pro Glu Pro Leu Leu Ala Ser Ser Gly 33His Cys <2SEQ ID NO 7 <2LENGTH: ;2TYPE: PRT <2ORGANISM: Homo sapiens <4SEQUENCE: 7 Met Ala Ala Gly Phe Pro Tyr Ala Leu Arg Ala Tyr Leu Gly Tyr Gln Val Pro Ser Gly Ser Ser Gly Ser Leu Ser Thr Ser Ser Ser Ser 2 Ser Pro Pro Gly Thr Pro Ser Pro Ala Asp Ala Lys Ala Pro ProThr 35 4a Cys Tyr Ala Gly Ala Gly Pro Ala Pro Ser Gln Val Lys Ser Lys 5 Ala Lys Lys Thr Val Asp Lys His Ser Asp Glu Tyr Lys Ile Arg Arg 65 7 Glu Arg Asn Asn Ile Ala Val Arg Lys Ser Arg Asp Lys Ala Lys Met 85 9g Asn Leu Glu ThrGln His Lys Val Leu Glu Leu Thr Ala Glu Asn Arg Leu Gln Lys Lys Val Glu Gln Leu Ser Arg Glu Leu Ser Thr Arg Asn Leu Phe Lys Gln Leu Pro Glu Pro Leu Leu Ala Ser Ser His Cys ;2SEQ ID NO 8<2LENGTH: t;2TYPE: DNA <2ORGANISM: Mus sp. <4SEQUENCE: 8 gcccgttgcc aggcgccgcc ttataaacct cccgctcggc cgccgccgcg ccgagtccga 6gcacg ggaccgggac gcagcggagc ccgcgggccc cgcgttcatg caccgcctgc cctgggacgcagcatgc ctcccgccgc cgcccgccgc ctttagaccc atggaagtgg acttcta ctacgagccc gactgcctgg cctacggggc caaggcggcc cgcgccgcgc 24gcccc cgccgccgag ccggccattg gcgagcacga gcgcgccatc gacttcagcc 3cctgga gccgctcgcg cccgccgcgg acttcgccgc gcccgcgcccgcgcaccacg 36ctctc cgacctcttc gccgacgact acggcgccaa gccgagcaag aagccggccg 42ggtta cgtgagcctc ggccgcgcgg gcgccaaggc cgcgccgccc gcctgcttcc 48ccgcc tcccgcggcg ctcaaggcgg agccgggctt cgaacccgcg gactgcaagc 54gacga cgcgcccgccatggcggccg gtttcccgtt cgccctgcgc gcctacctgg 6ccaggc gacgccgagc ggcagcagcg gcagcctgtc cacgtcgtcg tcgtccagcc 66ggcac gccgagcccc gccgacgcca aggccgcgcc cgccgcctgc ttcgcggggc 72gccgc gcccgccaag gccaaggcca agaagacggt ggacaagctg agcgacgagt78atgcg gcgcgagcgc aacaacatcg cggtgcgcaa gagccgcgac aaggccaaga 84aacct ggagacgcag cacaaggtgc tggagctgac ggcggagaac gagcggctgc 9gaaggt ggagcagctg tcgcgagagc tcagcaccct gcggaacttg ttcaagcagc 96gagcc gctgctggcc tcggcgggccactgctagcg cggcgcggtg gcgtgggggg ccgcggcc accgtgcgcc ctgccccgcg cgctccggcc ccgcgcgcgc gcccggacca gtgcgtgc cctgcgcgca cctgcacctg caccgagggg acaccgcggg cacaccgcgg acgcgcgg cgcacgcacc tgcacagcgc accgggtttc gggacttgat gcaatccgga aaacgtgg ctgagcgcgt gtggacacgg gactacgcaa cacacgtgta actgtctagc ggccctga gtaatcacct taaagatgtt cctgcggggt tgttgatgtt tttggttttg tttgtttt ttgttttgtt ttgttttttt ttttggtctt attatttttt ttgtattata aaaaagtt ctatttctat gagaaaagaggcgtatgtat atttgagaac cttttccgtt gagcatta aagtgaagac attttaataa acttttttgg gagaatgttt aaaagccaaa t;2SEQ ID NO 9 <2LENGTH: 296 <2TYPE: PRT <2ORGANISM: Mus sp. <4SEQUENCE: 9 Met His Arg Leu LeuAla Trp Asp Ala Ala Cys Leu Pro Pro Pro Pro Ala Phe Arg Pro Met Glu Val Ala Asn Phe Tyr Tyr Glu Pro Asp 2 Cys Leu Ala Tyr Gly Ala Lys Ala Ala Arg Ala Ala Pro Arg Ala Pro 35 4a Ala Glu Pro Ala Ile Gly Glu His Glu Arg Ala IleAsp Phe Ser 5 Pro Tyr Leu Glu Pro Leu Ala Pro Ala Ala Asp Phe Ala Ala Pro Ala 65 7 Pro Ala His His Asp Phe Leu Ser Asp Leu Phe Ala Asp Asp Tyr Gly 85 9a Lys Pro Ser Lys Lys Pro Ala Asp Tyr Gly Tyr Val Ser Leu Gly AlaGly Ala Lys Ala Ala Pro Pro Ala Cys Phe Pro Pro Pro Pro Ala Ala Leu Lys Ala Glu Pro Gly Phe Glu Pro Ala Asp Cys Lys Ala Asp Asp Ala Pro Ala Met Ala Ala Gly Phe Pro Phe Ala Leu Arg Ala Tyr Leu Gly Tyr GlnAla Thr Pro Ser Gly Ser Ser Gly Ser Ser Thr Ser Ser Ser Ser Ser Pro Pro Gly Thr Pro Ser Pro Ala Ala Lys Ala Ala Pro Ala Ala Cys Phe Ala Gly Pro Pro Ala Ala 2Ala Lys Ala Lys Ala Lys Lys Thr Val Asp Lys LeuSer Asp Glu 222ys Met Arg Arg Glu Arg Asn Asn Ile Ala Val Arg Lys Ser Arg 225 234ys Ala Lys Met Arg Asn Leu Glu Thr Gln His Lys Val Leu Glu 245 25eu Thr Ala Glu Asn Glu Arg Leu Gln Lys Lys Val Glu Gln Leu Ser 267lu Leu Ser Thr Leu Arg Asn Leu Phe Lys Gln Leu Pro Glu Pro 275 28eu Leu Ala Ser Ala Gly His Cys 29lt;2SEQ ID NO 2LENGTH: t;2TYPE: DNA <2ORGANISM: Rattus sp. <4SEQUENCE: gccccg gcgtgacgca gcccgttgcc aggcgccgcc ttataaacct ccgctcggcc 6BR>gccgccgagc cgagtccgag ccgcgcacgg gaccgggacg cagcggagcc cgcgggcccc ttcatgc accgcctgct ggcctgggac gcagcatgcc tcccgccgcc gcccgccgcc agaccca tggaagtggc caacttctac tacgagcccg actgcctggc ctacggggcc 24ggccc gcgccgcgcc gcgcgcccccgccgccgagc cggccatcgg cgagcacgag 3ccatcg acttcagccc ctacctggag ccgctcgcgc ccgccgccgc ggacttcgcc 36cgcgc ccgcgcacca cgacttcctt tccgacctct tcgccgacga ctacggcgcc 42gagca agaagccgtc cgactacggt tacgtgagcc tcggccgcgc gggcgccaag 48accgc ccgcctgctt cccgccgccg cctcccgccg cactcaaggc cgagccgggc 54acccg cggactgcaa gcgcgcggac gacgcgcccg ccatggcggc cggcttcccg 6ccctgc gcgcctacct gggctaccag gcgacgccga gcggcagcag cggcagcctg 66gtcgt cgtcgtccag cccgcccggg acgccgagccccgccgacgc caaggccgcg 72cgcct gcttcgcggg gccgccggcc gcgcccgcca aggccaaggc caagaaggcg 78caagc tgagcgacga gtacaagatg cggcgcgagc gcaacaacat cgcggtgcgc 84ccgcg acaaggccaa gatgcgcaac ctggagacgc agcacaaggt gctggagctg 9cggagaacgagcggct gcagaagaag gtggagcagc tgtcgcgaga gctcagcacg 96gaact tgttcaagca gctgcccgag ccgctgctgg cctcggcggg tcactgctag cggcgggg gtggcgtggg ggcgccgcgg ccaccctggg caccgtgcgc cctgccccgc gctccgtc cccgcgcgcg cccgggcacc gtgcgtgcaccgcgcgcacc tgcacctgca gaggggac accgtgggca ccgcgcgcac gcacctgcac cgcgcaccgg gtttcgggac gatgcaat ccggatcaaa cgtggctgag cgcgtgtgga cacgggactg acgcaacaca tgtaactg tcagccgggc cctgagtaat cacttaaaga tgttcctgcg gggttgttgc ttgatgtttttctttttg ttttttgttt tttgtttttt ttttggtctt attatttttt tattatat aaaaaagttc tatttctatg agaaaagagg cgtatgtata ttttgagaac tttccgtt tcgagcatta aagtgaagac attttaataa acttttttgg agaatgttta aacctttt gggggcagta gttggctttt gaaaaaaaattttttttctt ccctcctgac tggattta tgcgagattt tgttttttgt gtttctggtg tgtagggggc tgcgggttat ttgggttg tgtgtggtgg tgggtggggg tgtcgcatct gggtttttct cctcccctgg gatgggat gccagcccct ccccccagga gagggggcag agtgccgggt caggaattc t;2SEQID NO 2LENGTH: 297 <2TYPE: PRT <2ORGANISM: Rattus sp. <4SEQUENCE: His Arg Leu Leu Ala Trp Asp Ala Ala Cys Leu Pro Pro Pro Pro Ala Phe Arg Pro Met Glu Val Ala Asn Phe Tyr Tyr Glu Pro Asp 2 Cys Leu Ala Tyr Gly Ala Lys Ala Gly Arg Ala Ala Pro Arg Ala Pro 35 4a Ala Glu Pro Ala Ile Gly Glu His Glu Arg Ala Ile Asp Phe Ser 5 Pro Tyr Leu Glu Pro Leu Ala Pro Ala Ala Ala Asp Phe Ala Ala Pro 65 7 Ala Pro Ala His His AspPhe Leu Ser Asp Leu Phe Ala Asp Asp Tyr 85 9y Ala Lys Pro Ser Lys Lys Pro Ser Asp Tyr Gly Tyr Val Ser Leu Arg Ala Gly Ala Lys Ala Ala Pro Pro Ala Cys Phe Pro Pro Pro Pro Ala Ala Leu Lys Ala Glu Pro Gly Phe Glu ProAla Asp Cys Arg Ala Asp Asp Ala Pro Ala Met Ala Ala Gly Phe Pro Phe Ala Leu Arg Ala Tyr Leu Gly Tyr Gln Ala Thr Pro Ser Gly Ser Ser Gly Leu Ser Thr Ser Ser Ser Ser Ser Pro Pro Gly Thr Pro Ser Pro Asp Ala Lys Ala Ala Pro Ala Ala Cys Phe Ala Gly Pro Pro Ala 2Pro Ala Lys Ala Lys Ala Lys Lys Ala Val Asp Lys Leu Ser Asp 222yr Lys Met Arg Arg Glu Arg Asn Asn Ile Ala Val Arg Lys Ser 225 234sp Lys AlaLys Met Arg Asn Leu Glu Thr Gln His Lys Val Leu 245 25lu Leu Thr Ala Glu Asn Glu Arg Leu Gln Lys Lys Val Glu Gln Leu 267rg Glu Leu Ser Thr Leu Arg Asn Leu Phe Lys Gln Leu Pro Glu 275 28ro Leu Leu Ala Ser Ala Gly His Cys 29lt;2SEQ ID NO 2LENGTH: 2TYPE: PRT <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic Peptide <4SEQUENCE: AlaVal Leu Leu Pro Val Leu Leu Ala Ala Pro <2SEQ ID NO 2LENGTH: 29 <2TYPE: PRT <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence:Synthetic Peptide <4SEQUENCE: Phe Ile Thr Lys Ala Leu Gly Ile Ser Tyr Gly Arg Lys Lys Arg Gln Arg Arg Arg Pro Pro Gln Gly Ser Gln Thr His 2t;2SEQ ID NO 2LENGTH: 2TYPE: PRT<2ORGANISM: Homo sapiens <4SEQUENCE: Gln Arg Leu Val Ala Trp Asp Pro Ala Cys Leu Pro Leu Pro Pro 2SEQ ID NO 2LENGTH: 2TYPE: PRT <2ORGANISM: Homo sapiens <4SEQUENCE: Lys Thr Val Asp Lys His Ser Asp Glu Tyr Lys Ile Arg Arg Glu <2SEQ ID NO 2LENGTH: 2TYPE: PRT <2ORGANISM: Homo sapiens <4SEQUENCE: Arg Glu Arg Asn Asn Ile AlaVal Arg Lys Ala Arg Asp Lys Ala <2SEQ ID NO 2LENGTH: 2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence:Oligonucleotide <4SEQUENCE: accgcc tgctggcct 2SEQ ID NO 2LENGTH: 2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of ArtificialSequence: Oligonucleotide <4SEQUENCE: cagtga cccgccga 2SEQ ID NO 2LENGTH: 3TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description ofArtificial Sequence: Oligonucleotide <4SEQUENCE: cgctgc ggaacttgtt caagcagctg 3t; SEQ ID NO 2LENGTH: 3TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHERINFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 2gcttg aacaagttcc gcagcgtgct 3SEQ ID NO 2LENGTH: ;2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 2BR> gatctgcagc tggtaccatg ggctaccatg gaacgcctgg tggcctggga cccagcatgc 6ctgcc gccgccgccg cctgccttta aatccggaga agtgg ;2SEQ ID NO 22 <2LENGTH: ;2TYPE: DNA <2ORGANISM: Artificial Sequence<22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 22 ccacttctcc ggatttaaag gcaggcggcg gcggcggcag ggggagacat gctgggtccc 6accag gcgttccatg gtagcccatg gtaccagctg ca ;2SEQ ID NO 23 <2LENGTH: 37 <2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 23 ccggatccccatggcgggct tcccgtacgc gctgcgc 37 <2SEQ ID NO 24 <2LENGTH: 39 <2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide<4SEQUENCE: 24 ccggatcccg cagtggccgg aggaggcgag caggggctc 39 <2SEQ ID NO 25 <2LENGTH: 44 <2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description ofArtificial Sequence: Oligonucleotide <4SEQUENCE: 25 gtgcagatcc gagctcgaga tctgcagctg gtaccatgga attc 44 <2SEQ ID NO 26 <2LENGTH: 44 <2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE:<223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 26 gtgcagatcc gagctcgaga tctgcagctg gtaccatgga attc 44 <2SEQ ID NO 27 <2LENGTH: 2TYPE: DNA <2ORGANISM:Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 27 gaattccatg ca 2SEQ ID NO 28 <2LENGTH: 2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 28 tagagtcgac 2SEQ ID NO 29 <2LENGTH: 34 <2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 29 agatctgcag ctggtaccat ggaattcgaa gctt 34 <2SEQ ID NO 3LENGTH: 33<2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 3tgcag ctggtaccat ggaattccat gca 33 <2SEQ ID NO3LENGTH: 2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 3agtgg cca 2SEQID NO 32 <2LENGTH: 2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 32 tagagtcgaa gctt 2SEQ ID NO 33 <2LENGTH: ;2TYPE: DNA <2ORGANISM: Artificial Sequence <22EATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Oligonucleotide <4SEQUENCE: 33 gatctgcagctggtaccatg gaattccatg caacgcctgg tggcctggga cccagcatgt 6cctgc cgccgccgcc gcctgccttt aaatccatgg aagtgg >

* * * * *

US Patent: 
7074399

Treatment of inflammation with p20

We are your best, most user-friendly source for searching patents and patent attorneys on the Internet.
 
<- Previous Patent (Retroviral vectors c...)   |   Next Patent (Regulatory construct...)->