Register or Login To Download This Patent As A PDF
| United States Patent Application |
20090119793
|
| Kind Code
|
A1
|
|
Ryan; Clarence A.
;   et al.
|
May 7, 2009
|
Plant Defense Signal Peptides
Abstract
A 23 amino acid peptide, AtPtpl, plays an important role as a signaling
component of the innate immune system of Arabidopsis. The peptide
precursor gene is transcribed in response to elicitors generated by
pathogens, and AtPep1 is produced to amplify the signaling pathways.
Seven paralogs of the AtproPep1 gene have been identified in the
Arabidopsis genome, and orthologs have been identified in species of
several agriculturally important families. AtPcpl and its paralogs and
orthologs play important roles as endogenous signals to amplify innate
immunity. The sequence of two AtPep1 receptors from Arabidopsis are also
provided.
| Inventors: |
Ryan; Clarence A.; (Pullman, WA)
; Ryan; Patricia Louise; (Pullman, WA)
; Pearce; Gregory L.; (Palouse, WA)
; Huffaker; Alisa; (Pullman, WA)
; Yamaguchi; Yube; (Pullman, WA)
|
| Correspondence Address:
|
Biotechnology Law Group;c/o Portfolioip
P.O. Box 52050
Minneapolis
MN
55402
US
|
| Assignee: |
Washington State University Research Foundation
Pullman
WA
|
| Serial No.:
|
795733 |
| Series Code:
|
11
|
| Filed:
|
January 24, 2006 |
| PCT Filed:
|
January 24, 2006 |
| PCT NO:
|
PCT/US06/02661 |
| 371 Date:
|
June 4, 2008 |
| Current U.S. Class: |
800/265; 435/419; 435/6; 436/86; 506/7; 514/1.1; 514/44R; 530/324; 530/325; 530/326; 530/327; 530/328; 536/23.6; 800/298; 800/301; 800/305 |
| Class at Publication: |
800/265; 530/328; 530/326; 530/327; 530/325; 530/324; 514/15; 514/14; 514/13; 514/12; 800/298; 536/23.6; 435/419; 800/305; 800/301; 514/44; 435/6; 506/7; 436/86 |
| International Class: |
A01H 1/00 20060101 A01H001/00; C07K 14/00 20060101 C07K014/00; C07K 7/08 20060101 C07K007/08; C07K 7/06 20060101 C07K007/06; A61K 38/16 20060101 A61K038/16; A61K 38/08 20060101 A61K038/08; C12Q 1/68 20060101 C12Q001/68; G01N 33/68 20060101 G01N033/68; C40B 30/00 20060101 C40B030/00; A61K 38/10 20060101 A61K038/10; A01H 5/00 20060101 A01H005/00; C07H 21/00 20060101 C07H021/00; C12N 5/10 20060101 C12N005/10; A01N 57/16 20060101 A01N057/16 |
Goverment Interests
STATEMENT OF GOVERNMENT RIGHTS
[0002]The invention was supported, at least in part, by a grant from the
Government of the United States of America (grant no. IBN 0090766 from
the National Science Foundation). The Government may have certain rights
to the invention.
Claims
1. A composition comprising an isolated defense signal peptide 10 or more
amino acid residues in length that has substantial defense signal peptide
activity.
2. The composition of claim 1 wherein the defense signal peptide is 15 or
more amino acid residues in length.
3. The composition of claim 1 wherein the defense signal peptide is 20 or
more amino acid residues in length.
4. The composition of claim 1 wherein the defense signal peptide is 23 or
more amino acid residues in length.
5. The composition of claim 1 wherein the defense signal peptide is
between about 10 and about 50 amino acid residues in length.
6. The composition of claim 1 wherein the defense signal peptide is
between about 15 and about 50 amino acid residues in length.
7. The composition of claim 1 comprising a polypeptide that is processed
in a plant cell to produce the defense signal peptide.
8. The composition of claim 1 wherein the defense signal peptide comprises
a sequence having at least 75 percent homology with a polypeptide
selected from the group consisting of AtPep1, AtPep2, AtPep3, AtPep4,
AtPep5, AtPep6, AtPep7, BnPep1, StPep1, PbPep1, GmPep1, MsPep1, VvPep1,
OsPep1, OsPep2, TaPep1, TaPep2, ZmPep1, and HvPep2.
9. The composition of claim 1 wherein the defense signal peptide comprises
a sequence having at least 80 percent homology with a polypeptide
selected from the group consisting of AtPep1, AtPep2, AtPep3, AtPep4,
AtPep5, AtPep6, AtPep7, BnPep1, StPep1, PbPep1, GmPep1, MsPep1, VvPep1,
OsPep1, OsPep2, TaPep1, TaPep2, ZmPep1, and HvPep2.
10. The composition of claim 1 wherein the defense signal peptide
comprises a sequence having at least 85 percent homology with a
polypeptide selected from the group consisting of AtPep1, AtPep2, AtPep3,
AtPep4, AtPep5, AtPep6, AtPep7, BnPep1, StPep1, PbPep1, GmPep1, MsPep1,
VvPep1, OsPep1, OsPep2, TaPep1, TaPep2, ZmPep1, and HvPep2.
11. The composition of claim 1 wherein the defense signal peptide
comprises a sequence having at least 90 percent homology with a
polypeptide selected from the group consisting of AtPep1, AtPep2, AtPep3,
AtPep4, AtPep5, AtPep6, AtPep7, BnPep1, StPep1, PbPep1, GmPep1, MsPep1,
VvPep1, OsPep1, OsPep2, TaPep1, TaPep2, ZmPep1, and HvPep2.
12. The composition of claim 1 wherein the defense signal peptide
comprises a sequence having complete homology with a member of the group
consisting of AtPep1, AtPep2, AtPep3, AtPep4, AtPep5, AtPep6, AtPep7,
BnPep1, StPep1, PbPep1, GmPep1, MsPep1, VvPep1, OsPep1, OsPep2, TaPep1,
TaPep2, ZmPep1, and HvPep2.
13. The composition of claim 1 wherein the defense signal peptide
comprises a sequence having at least 90 percent homology with a dicot
defense signal peptide consensus sequence.
14. The composition of claim 1 wherein the defense signal peptide
comprises a sequence having complete homology with a dicot defense signal
peptide consensus sequence.
15. The composition of claim 1 wherein the defense signal peptide
comprises a sequence having at least 90 percent homology with a monocot
defense signal peptide consensus sequence.
16. The composition of claim 1 wherein the defense signal peptide
comprises a sequence having complete homology with a dicot defense signal
peptide consensus sequence.
17. The composition of claim 1 comprising a biologically acceptable
carrier.
18. A plant comprising the composition of claim 17 applied to a surface of
said plant.
19. A seed comprising the composition of claim 17 applied to a surface of
the seed.
20. An isolated polynucleotide comprising a sequence that encodes a
defense signal peptide operably linked to a plant promoter, wherein
expression of the polynucleotide in a cell of a plant causes the plant to
exhibit an improvement compared to a control plant lacking the
polynucleotide that is selected from the group consisting of improved
yield of plant product, reduced disease symptoms, and enhanced resistance
to disease infestation.
21. The isolated polynucleotide of claim 20 wherein the defense signal
peptide is 10 or more amino acid residues in length.
22. The isolated polynucleotide of claim 20 wherein the defense signal
peptide is 15 or more amino acid residues in length.
23. The isolated polynucleotide of claim 20 wherein the defense signal
peptide is 20 or more amino acid residues in length.
24. The isolated polynucleotide of claim 20 wherein the defense signal
peptide is 23 or more amino acid residues in length.
25. The isolated polynucleotide of claim 20 that comprises a sequence that
encodes a polypeptide that is processed in a plant cell to produce the
defense signal peptide.
26. The isolated polynucleotide of claim 20 wherein the defense signal
peptide is between about 10 and about 50 amino acid residues in length.
27. The isolated polynucleotide of claim 20 wherein the defense signal
peptide is between about 15 and about 50 amino acid residues in length.
28. The isolated polynucleotide of claim 20 that encodes a polypeptide
that is processed in a plant cell to produce the defense signal peptide.
29. The isolated polynucleotide of claim 20 wherein the defense signal
peptide comprises a sequence having at least 75 percent homology with a
polypeptide selected from the group consisting of AtPep1, AtPep2, AtPep3,
AtPep4, AtPep5, AtPep6, AtPep7, BnPep1, StPep1, PbPep1, GmPep1, MsPep1,
VvPep1, OsPep1, OsPep2, TaPep1, TaPep2, ZmPep1, and HvPep2.
30. The isolated polynucleotide of claim 20 wherein the defense signal
peptide comprises a sequence having at least 80 percent homology with a
polypeptide selected from the group consisting of AtPep1, AtPep2, AtPep3,
AtPep4, AtPep5, AtPep6, AtPep7, BnPep1, StPep1, PbPep1, GmPep1, MsPep1,
VvPep1, OsPep1, OsPep2, TaPep1, TaPep2, ZmPep1, and HvPep2.
31. The isolated polynucleotide of claim 20 wherein the defense signal
peptide comprises a sequence having at least 85 percent homology with a
polypeptide selected from the group consisting of AtPep1, AtPep2, AtPep3,
AtPep4, AtPep5, AtPep6, AtPep7, BnPep1, StPep1, PbPep1, GmPep1, MsPep1,
VvPep1, OsPep1, OsPep2, TaPep1, TaPep2, ZmPep1, and HvPep2.
32. The isolated polynucleotide of claim 20 wherein the defense signal
peptide comprises a sequence having at least 90 percent homology with a
polypeptide selected from the group consisting of AtPep1, AtPep2, AtPep3,
AtPep4, AtPep5, AtPep6, AtPep7, BnPep1, StPep1, PbPep1, GmPep1, MsPep1,
VvPep1, OsPep1, OsPep2, TaPep1, TaPep2, ZmPep1, and HvPep2.
33. The isolated polynucleotide of claim 20 wherein the defense signal
peptide comprises a sequence having complete homology with a member of
the group consisting of AtPep1, AtPep2, AtPep3, AtPep4, AtPep5, AtPep6,
AtPep7, BnPep1, StPep1, PbPep1, GmPep1, MsPep1, VvPep1, OsPep1, OsPep2,
TaPep1, TaPep2, ZmPep1, and HvPep2.
34. The isolated polynucleotide of claim 20 wherein the defense signal
peptide comprises a sequence having at least 90 percent homology with a
dicot defense signal peptide consensus sequence.
35. The isolated polynucleotide of claim 20 wherein the defense signal
peptide comprises a sequence having complete homology with a dicot
defense signal peptide consensus sequence.
36. The isolated polynucleotide of claim 20 wherein the defense signal
peptide comprises a sequence having at least 90 percent homology with a
monocot defense signal peptide consensus sequence.
37. The isolated polynucleotide of claim 20 wherein the defense signal
peptide comprises a sequence having complete homology with a dicot
defense signal peptide consensus sequence.
38. The polynucleotide of claim 20 wherein the sequence that encodes a
defense signal peptide has at least 80 percent sequence similarity to a
polynucleotide sequence selected from the group consisting of AtproPep1,
AtproPep2, AtproPep3, AtproPep4, AtproPep5, AtproPep6, AtproPep7,
BnproPep1, StproPep1, PbproPep1, GmproPep1, MsproPep1, VvproPep1,
OsproPep1, OsproPep2, TaproPep1, TaproPep2, ZmproPep1, and HvproPep2.
39. The polynucleotide of claim 20 wherein the sequence that encodes a
defense signal peptide has at least 90 percent sequence similarity to a
polynucleotide sequence selected from the group consisting of AtproPep1,
AtproPep2, AtproPep3, AtproPep4, AtproPep5, AtproPep6, AtproPep7,
BnproPep1, StproPep1, PbproPep1, GmproPep1, MsproPep1, VvproPep1,
OsproPep1, OsproPep2, TaproPep1, TaproPep2, ZmproPep1, and HvproPe.
40. The polynucleotide of claim 20 wherein the sequence that encodes a
defense signal peptide has at least 95 percent sequence similarity to a
polynucleotide sequence selected from the group consisting of AtproPep1,
AtproPep2, AtproPep3, AtproPep4, AtproPep5, AtproPep6, AtproPep7,
BnproPep1, StproPep1, PbproPep1, GmproPep1, MsproPep1, VvproPep1,
OsproPep1, OsproPep2, TaproPep1, TaproPep2, ZmproPep1, and HvproPe.
41. The polynucleotide of claim 20 wherein the sequence that encodes a
defense signal peptide has complete sequence similarity to a
polynucleotide sequence selected from the group consisting of AtproPep1,
AtproPep2, AtproPep3, AtproPep4, AtproPep5, AtproPep6, AtproPep7,
BnproPep1, StproPep1, PbproPep1, GmproPep1, MsproPep1, VvproPep1,
OsproPep1, OsproPep2, TaproPep1, TaproPep2, ZmproPep1, and HvproPe.
42. An isolated polynucleotide comprising a sequence that encodes a
defense signal peptide operably linked to a heterologous promoter.
43. The isolated polynucleotide of claim 42 wherein expression of the
polynucleotide in a cell of a plant causes the plant to exhibit an
improvement compared to a control plant lacking the polynucleotide that
is selected from the group consisting of improved yield of plant product,
reduced disease symptoms, and enhanced resistance to disease infestation.
44. The isolated polynucleotide of claim 42 wherein the promoter is a
constitutive promoter.
45. The polynucleotide of claim 42 wherein the promoter is a
non-constitutive promoter.
46. The polynucleotide of claim 42 wherein the promoter is an organ- or
tissue-specific promoter.
47. The polynucleotide of claim 42 wherein the promoter is an inducible
promoter.
48. A cell comprising the isolated polynucleotide of claim 42.
49. The cell of claim 48 selected from the group consisting of a plant
cell, a bacterial cell, a fungal cell and an insect cell.
50. A plant cell of claim 48.
51. A plant comprising the plant cell of claim 50.
52. A plant of claim 51 selected from the group consisting of Acacia,
alfalfa, aneth, apple, apricot, artichoke, arugula, asparagus, avocado,
banana, barley, beans, beet, blackberry, blueberry, broccoli, brussels
sprouts, cabbage, cantaloupe, carrot, cassaya, castorbean, cauliflower,
celery, cherry, chicory, cilantro, citrus, clementines, clover, coconut,
coffee, corn, cotton, cucumber, Douglas fir, eggplant, endive, escarole,
eucalyptus, fennel, figs, garlic, gourd, grape, grapefruit, honey dew,
jicama, kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine, linseed,
mango, melon, mushroom, nectarine, nut, oat, oil palm, oil seed rape,
okra, olive, onion, orange, an ornamental plant, palm, papaya, parsley,
parsnip, pea, peach, peanut, pear, pepper, persimmon, pine, pineapple,
plantain, plum, pomegranate, poplar, potato, pumpkin, quince, radiata
pine, radicchio, radish, rapeseed, raspberry, rice, rye, sorghum,
Southern pine, soybean, spinach, squash, strawberry, sugarbeet,
sugarcane, sunflower, sweet potato, sweetgum, tangerine, tea, tobacco,
tomato, triticale, turf grass, turnip, a vine, watermelon, wheat, yams,
and zucchini.
53. The plant of claim 51 that exhibits reduced symptoms from, or enhanced
resistance to, a disease caused by an organism of a genus selected from
the group consisting of Alternaria, Ascochyta, Aspergillus, Botrytis,
Cercospora, Colletotrichum, Diplodia, Erwinia, Erysiphe, Fusarium,
Gaeumanomyces, Helminthosporium, Macrophomina, Magnaporthe,
Mycosphaerella, Nectria, Peronospora, Phoma, Phymatotrichum,
Phytophthora, Plasmopara, Podosphaera, Pseudomonas, Puccinia, Puthium,
Pyrenophora, Pyricularia, Pythium, Rhizoctonia, Scerotium, Sclerotinia,
Septoria, Thielaviopsis, Uncinula, Venturia, Verticillium, and
Xanthomonas.
54. A part of the plant of claim 51 selected from the group consisting of
seeds, seed pods, flowers, fruit, tubers, stems, cuttings, and pollen.
55. A product resulting from processing a plant of claim 51 or a part
thereof.
56. A composition comprising the polynucleotide of claim 42 and a
biologically acceptable carrier.
57. A method of making a defense signal peptide comprising expressing in a
cell a polynucleotide of claim 42.
58. The method of claim 57 wherein the cell is a bacterial cell, a fungal
cell, or an insect cell.
59. The method of claim 57 further comprising purifying the defense signal
peptide.
60. A method of making a transgenic plant comprising introducing into a
cell of a plant a polynucleotide of claim 42, thereby producing a
transformed cell, and regenerating a transgenic plant from the
transformed cell, wherein, compared to a control plant lacking the
polynucleotide, the transgenic plant exhibits a characteristic selected
from the group consisting of substantially improved yield of plant
product, substantially reduced disease symptoms, and substantially
enhanced resistance to disease infestation.
61. A method of making a plant that comprises a transgene comprising a
sequence that encodes a defense signal peptide operably linked to a plant
promoter, the method comprising sexually crossing a plant that comprises
the transgene with a plant that lacks the transgene, thereby producing a
plurality of progeny plants, and selecting a progeny plant comprising the
transgene.
62. A method of making a plant that comprises a transgene comprising a
sequence that encodes a defense signal peptide operably linked to a plant
promoter, the method comprising asexually reproducing a plant that
comprises the transgene, thereby producing a plurality of progeny plants,
and selecting a progeny plant comprising the transgene.
63. A method of growing a plant comprising planting a seed that comprises
a polynucleotide sequence of claim 42, and growing the seed to produce a
plant, wherein, compared to a control plant lacking said polynucleotide
sequence, the plant grown from the seed exhibits a characteristic
selected from the group consisting of substantially improved yield of
plant product, substantially reduced disease symptoms, and substantially
enhanced resistance to disease infestation.
64. A method for detecting a plant cell comprising a polynucleotide of
claim 42 in a biological sample, the method comprising contacting the
biological sample with a probe that binds specifically to the
polynucleotide, and detecting said binding.
65. The method of claim 64 wherein the probe is a PCR primer, the method
comprising performing PCR on the sample and detecting said binding by
detecting an amplification product diagnostic of the presence of the
polynucleotide in the sample.
66. A kit for detecting a plant cell comprising a polynucleotide of claim
42 in a biological sample, the kit comprising one or more probes that
bind specifically to the polynucleotide, and instructions for use.
67. A method for detecting a plant cell comprising a polynucleotide of
claim 42 in a biological sample, the method comprising contacting the
biological sample with a probe that binds specifically to the defense
signal peptide, and detecting said binding.
68. The method of claim 67 wherein the probe is an antibody.
69. A kit for detecting a plant cell comprising a polynucleotide of claim
42 in a biological sample, the kit comprising one or more probes that
bind specifically to the defense signal peptide, and instructions for
use.
70. A plant cell comprising an insertion of a foreign promoter upstream of
a coding sequence for a defense signal protein, wherein the foreign
promoter is operably linked to the coding sequence for the defense signal
protein and the plant is characterized by a substantially enhanced
resistance to a disease compared to a control plant lacking the insertion
of the foreign promoter.
71. A method of making a transgenic plant comprising (a) introducing into
cells of a plant a polynucleotide that comprises a heterologous promoter,
thereby producing a cell comprising an insertion of the heterologous
promoter upstream of a coding sequence for a defense signal protein,
wherein expression of the defense signal protein is controlled by the
foreign promoter, and (b) regenerating a transgenic plant from said cell
comprising the insertion.
72. A method of identifying a defense signal peptide comprising: (a)
providing a plurality of candidate peptides having a length of at least
10 amino acids; (b) assaying said plurality of candidate peptides for
defense signal peptide activity in an alkalinization assay; and (c)
selecting a candidate peptide that has substantial defense signal peptide
activity.
73. The method of claim 72 comprising providing the candidate peptides by
chemically synthesizing said plurality of candidate peptides.
74. The method of claim 72 comprising administering the candidate peptide
to a plant by applying a composition comprising the candidate peptide to
the plant.
75. The method of claim 72 comprising administering the candidate peptide
to a plant by expressing within a cell of the plant a polynucleotide that
comprises a sequence that encodes the candidate peptide, thereby
producing the candidate peptide within the cell of the plant.
76. A method of identifying a substance that enhances defense of a plant
against a disease comprising (a) contacting an isolated AtPep1 receptor
with a plurality of candidate substances; (b) selecting a candidate
substance that has a detectable interaction with the isolated AtPep1
receptor; and (c) applying the selected candidate substance to a plant to
determine whether the selected candidate substance enhances defense of
the plant against a disease.
77. The method of claim 76 wherein the candidate substances are peptides.
78. The method of claim 76 wherein the candidate substances are
non-peptide chemical compounds.
Description
CROSS-REFERENCE TO RELATED CASES
[0001]This application claims priority from U.S. provisional patent
application Ser. No. 06/647,708, filed Jan. 26, 2005, which is
incorporated herein by reference.
BACKGROUND
[0003]1. Technical Field
[0004]The present invention relates to materials and methods for enhancing
plant disease resistance.
[0005]2. Background Information
[0006]Plants are exposed to numerous denizens of their environment,
including bacteria, viruses, fungi, and nematodes. Although many of the
interactions between these organisms and plants, particularly via the
roots of the plants, are beneficial, many of the interactions are harmful
to the plants. The decimation of agricultural crops, ornamental plants,
and other plants by diseases caused by plant pathogens is a worldwide
problem that has enormous economic impact.
[0007]Damage to plants is caused by pathogens of multiple genera. These
genera include Alternaria, Ascochyta, Aspergillus, Botrytis, Cercospora,
Colletotrichum, Diplodia, Erwinia, Erysiphe, Fusarium, Gaeumanomyces,
Helminthosporium, Macrophomina, Magnaporthe, Mycosphaerella, Nectria,
Peronospora, Phoma, Phymatotrichum, Phytophthora, Plasmopara,
Podosphaera, Pseudomonas, Puccinia, Puthium, Pyrenophora, Pyricularia,
Pythium, Rhizoctonia, Scerotium, Sclerotinia, Septoria, Thielaviopsis,
Uncinula, Venturia, Verticillium, and Xanthomonas.
[0008]Many chemical compounds have been developed to combat these various
pathogens. The activity of these compounds is typically limited to
several species. As a consequence of the large number and diversity of
plant pathogens, these compounds have not provided an effective solution
to limiting infections in plants.
[0009]An alternative approach to controlling pathogenic infections in
plants involves exploiting the natural defense mechanisms of plants to
confer resistance. Many plants have developed natural resistance to some
pathogens. However, resistance may be limited to certain genera of
pathogens, or crops of agronomic interest may not exhibit sufficient
resistance. Thus, natural plant defenses often do not provide sufficient
protection against pathogens. By broadening the spectrum of pathogen
defense or strengthening the defense response, it may be possible to
enhance existing resistance mechanisms and promote pathogen defense in
otherwise susceptible plants.
[0010]When present and active, the natural defense mechanisms of plants
can be highly effective in preventing pathogen colonization and disease.
Resistance is multi-tiered, with passive and active, constitutive and
inducible elements.
[0011]Following the invasion of a plant by a potential pathogen, the
pathogen either successfully proliferates in the host, causing associated
disease symptoms, or its growth is halted by the defenses of the host
plant. One such defense is the hypersensitive response (HR), rapid
apoptotic cell death near the site of the infection that correlates with
the generation of activated oxygen species, production of antimicrobial
compounds, and reinforcement of host cell walls (Dixon and Lamb, Annu.
Rev. Plant Physiol. Plant Mol. Biol. 41:339-367, 1990). Other defenses
include systemic acquired resistance, which effectively protects the
plant against subsequent attack by a broad range of pathogens (Ryals et
al., Proc. Natl. Acad. Sci. USA 92:4202-4205, 1995).
[0012]Pathogens that elicit an HR on a given host are "avirulent" on that
host, the host is "resistant," and the plant-pathogen interaction is
"incompatible." If a pathogen proliferates and causes disease on the
host, the pathogen is "virulent," the host is "susceptible," and the
plant-pathogen interaction is "compatible."
[0013]In many cases in which a strains ("races") of a particular fungal or
bacterial pathogen differ regarding virulence on a various cultivars (or
wild accessions) of a particular host species, avirulent strains of the
pathogen, but not virulent strains, possess one or more avirulence (avr)
genes corresponding to "resistance" genes in the host. This observation
is the basis for the "gene-for-gene" model of plant disease resistance
(Crute et al., pp. 197-309 in Mechanisms of Resistance to Plant Disease,
Fraser, ed., 1985; Ellingboe, Annu. Rev. Phytopathol. 19:125-143, 1981;
Flor, Annu. Rev. Phytopathol. 9:275-296, 1971; and Keen et al., in
Application of Biotechnology to Plant Pathogen Control, Chet, ed., John
Wiley & Sons, 1993, pp. 65-88).
[0014]Normally avirulence and resistance genes are organized in functional
pairs. A given resistance gene is generally effective only against
pathogen strains that express a specific cognate avirulence gene (Flor,
Annu. Rev. Phytopathol. 9:275-296, 1971; Keen, Annu. Rev. Genet.
24:447-463, 1990). However, exceptions to this rule exist. For example
the Arabidopsis RPM1 gene product (Grant et al., Science 269:843-846,
1995) is involved in the recognition of elicitors produced by P. syringae
expressing the avirulence genes avrRpm1 or avrB (Bisgrove et al., Plant
Cell 6:927-933, 1994), suggesting that resistance gene products may
function as common points in transduction of distinct pathogen signals.
[0015]Resistance gene products are activated in response to pathogen
signal molecules termed elicitors, production of which is controlled by
pathogen avirulence genes.
[0016]A number of avirulence genes have been cloned. Many cloned
avirulence genes have been shown to correspond to individual resistance
genes in the cognate host plants and confer an avirulent phenotype when
transferred to an otherwise virulent strain. A number of plant disease
resistance genes have also been cloned. Similar features have been
discovered among many of these resistance genes, in spite of the
diversity of pathogens against which they act. These features include a
leucine-rich-repeat (LRR), a motif found in a multitude of eukaryotic
proteins with roles in signal transduction (Kobe and Deisenhofer, Trends
Biochem. Sci. 19:415-421, 1994). The LRR motif is thought to be involved
in protein-protein interactions and may allow interaction with other
proteins that are involved in plant disease resistance. In addition,
sequences predicted to encode nucleotide binding sites and leucine
zippers are shared among many resistance genes (Dangl, Cell 80:383-386,
1995; Staskawicz et al., Science 268:661-667, 1995). These motifs are
present and similarly organized among resistance gene products from
plants as diverse as tobacco, tomato, rice, flax, and Arabidopsis,
suggesting a common mechanism underlying disease resistance signal
transduction throughout the plant kingdom.
[0017]The local perception of pathogen attack is conveyed to distant
tissues via a transmissible signal that involves salicylic acid (SA),
further activating gene expression and conditioning a state known as
systemic acquired resistance (SAR). It has subsequently been found that
resistance can be expressed near the region of pathogen attack, as local
acquired resistance, or can be induced systemically, depending on
triggering signal and plant species. Thus the systemic and local
responses collectively are referred to as acquired resistance (AR).
Establishment of AR is a powerful line of plant defense because it can
provide broad-spectrum resistance against viral, bacterial, and fungal
challenges that would otherwise cause disease. The AR response triggers
the transcriptional activation of a suite of genes encoding
pathogenesis-related (PR) proteins. Included among these are hydrolases,
cell-wall strengthening proteins, proteins involved in oxidative burst,
the combination of which are believed to promote heightened resistance.
Biochemical and genetic analyses have identified genes and molecular
signals associated with acquired resistance. The Npr1/Nim1 gene plays a
key regulatory role in the AR defense in Arabidopsis against a broad
spectrum of fungal and bacterial pathogens (WO 98/06748; WO 94/16077; WO
98/26082). The central importance of Npr1 in dicots was further
substantiated by transgenic overexpression of the cloned gene, which led
to heightened disease resistance in Arabidopsis against both fungal and
bacterial pathogens (WO 98/06748).
[0018]Although the bulk of AR research has defined the pathway in
dicotyledonous plants, monocotyledonous plants, such as wheat, rice, and
barley, have an inducible pathway that protects against pathogen attack.
Acquired resistance can be conditioned by different external stimuli,
including avirulent pathogen challenge, pathogen elicitor exposure, and
chemical treatments, including application of SA or SA analogs, such as
2,6-dichloroisonicotinic acid (INA) or benzo(1,2,3)
thiadiazole-7-carbothioic acid S-methyl ester (BTH). Given the
inducibility of the AR pathway by the same classes of activating
compounds in monocot and dicot plants, there is likely to be partial
conservation of signaling pathways, as subsets of PR genes appear to be
induced in both groups. In monocots, induced acquired resistance is
broad-spectrum, extending to fungal and bacterial pests, irrespective of
pathogen race, with activated resistance persisting for weeks to months.
Thus, manipulation of the AR pathway in plants may promote resistance to
pathogens for which there exists no genetic source of resistance.
[0019]Thus, there is a need to identify genes that may play key roles in
disease defense. Expression of these genes in transgenic plants may
enhance the level of disease resistance against certain pathogens.
[0020]Within the past decade, the mechanisms by which plants activate
innate immunity have been found to share a number of similarities with
the innate immune responses of animals (Nimchuk et al., Annu. Rev. Gen.
37:579-609, 2003; Jones and Takemoto, Curr. Opin. Immun. 16:48-62, 2004;
Nurnberger and Scheel, Trends Plant Sci. 8:372-379, 2001; Numberger et
al., Immun. Rev. 198:249-266, 2004; Guttman, Biotech. Adv. 22:363-382,
2004; Staskawicz et al., Science 292:2285-2289, 2001; Nurnberger and
Brunner, Curr. Opin. Plant Biol. 5:1-7, 2002). Innate immunity is
initiated in animals and plants through the recognition of a variety of
pathogen associated molecules that in animals are called
"pathogen-associated molecular patterns," or PAMPS, and in plants are
called elicitors. Peptides derived from pathogens can be powerful
elicitors of plant defense responses (Hahlbrock et al., Proc. Natl. Acad.
Sci. USA 92:4150-4157, 1995; van den Askerveken et al., Plant Physiol.
103:91-96, 1993; Kammpren, Curr. Opin. Plant Biol. 4:295-300, 2001; Kunze
et al., Plant Cell, 16:3496-3507, 2004; Navarro et al., Plant Physiol.
135:1113-1128, 2004; Fellbrich et al., Plant J. 32:375-390, 2002); He et
al., Cell 73:1255-1266, 1993).
[0021]However, there remains a need to enhance plant resistance against
various biotic or abiotic stresses, including, but not limited to,
disease resistance. The present invention meets these and other needs.
SUMMARY OF THE INVENTION
[0022]We have identified a novel defense signal peptide from Arabidopsis
and a variety of other plants, including many crop plants of commercial
importance. In addition, we have identified genes encoding polypeptides
that are processed in plant cells to produce the shorter peptides, as
well as receptors for the peptides. Transgenic plants in which these
defense signal peptides are expressed under the control of a heterologous
promoter, such as a constitutive promoter, exhibit improved yield of
plant product, reduced disease symptoms, and/or enhanced resistance to
disease infestation. Peptides that comprise as few as ten amino acid
residues from the carboxy-terminus of AtPep1, a 23 amino acid defense
signal peptide from Arabidopsis thaliana, retain significant activity. In
addition, individual amino acid residues that are important for activity
have been defined by amino acid substitutions. Peptides and other
substances that have defense signal peptide activity can be readily
screened using an alkalinization assay that is described herein, and
their identity can be confirmed by exogenous application to plants or
transgenic expression in plants.
[0023]According to one aspect of the present invention compositions are
provided that comprise one or more isolated defense signal peptides that
are 10 or more amino acid residues in length and that have substantial
defense signal peptide activity. Such defense signal peptides may be
longer, e.g., 15, 20, 23 or more amino acid residues in length. For
example, they are more easily synthesized. Accordingly, according to
various embodiments of the invention, the defense signal peptide is
between about 10 and about 50 amino acid residues in length, or between
about 15 and about 50 amino acid residues in length. However, longer
defense signal peptides may be made and used in the practice of the
invention.
[0024]According to another embodiment of the invention, compositions are
provided that comprise one or more polypeptides that are processed in a
plant cell to produce defense signal peptides, for example, a defense
signal peptide that comprises a sequence having at least 75 percent
homology, or 80 percent homology, or 85 percent homology, or 90 percent
homology, or complete homology with a polypeptide selected from the group
consisting of AtPep1, AtPep2, AtPep3, AtPep4, AtPep5, AtPep6, AtPep7,
BnPep1, StPep1, PbPep1, GmPep1, MsPep1, VvPep1, OsPep1, OsPep2, TaPep1,
TaPep2, ZmPep1, and HvPep2. Alternatively, the defense signal peptide
comprises a sequence having at least 90 percent homology, or complete
homology, with a dicot or monocot defense signal peptide consensus
sequence, as discussed herein.
[0025]Such compositions comprising peptide or polypeptide compositions may
further comprise biologically acceptable carriers and/or other substances
used in formulating peptides and polypeptides. For example, such
compositions may be agricultural formulations that are suitable for
application to plants. Accordingly, in another embodiment of the
invention, plants or seeds of plants are provided that comprise such a
composition applied to a plant or seed surface, respectively. When
applied to plants under suitable conditions, such compositions induce the
plants' innate immunity and enhancing their defense against attack by
pathogens.
[0026]According to another aspect of the invention, polynucleotides that
express defense signal peptides (or polypeptides, including, for example,
pro-forms of defense signal peptides that are processed in plant cells to
produce defense signal peptides) in plants are provided. Transgenic
expression of such defense signal peptides induces the plants' innate
immunity. Accordingly, one embodiment of the present invention is an
isolated polynucleotide comprising a sequence that encodes a defense
signal peptide (as described above) operably linked to a plant promoter.
Expression of the polynucleotide in a cell of a plant causes the plant to
exhibit an improvement compared to a control plant lacking the
polynucleotide that is selected from the group consisting of improved
yield of plant product, reduced disease symptoms, and enhanced resistance
to disease infestation. The encoded defense signal peptide is 10 or more,
or 15 or more, or 20 or more, 23 or more amino acid residues in length.
Alternatively, such a polynucleotide comprises a sequence that encodes a
polypeptide that is processed in a plant cell to produce the defense
signal peptide.
[0027]According to one embodiment of the invention, such polynucleotides
encoding defense signal peptides have at least 80 percent, or at least 90
percent, or at least 95 percent, or complete sequence similarity to a
polynucleotide sequence selected from the group consisting of AtproPep1,
AtproPep2, AtproPep3, AtproPep4, AtproPep5, AtproPep6, AtproPep7,
BnproPep1, StproPep1, PbproPep1, GmproPep1, MsproPep1, VvproPep1,
OsproPep1, OsproPep2, TaproPep1, TaproPep2, ZmproPep1, and HvproPep2.
[0028]According to another embodiment of the invention, an isolated
polynucleotide is provided that comprises a sequence that encodes a
defense signal peptide operably linked to a heterologous promoter.
Polynucleotides for expression in plant, bacterial, fungal (including
yeast), insect, and other types of cells are contemplated. In one
embodiment, expression of the polynucleotide in a cell of a plant causes
the plant to exhibit an improvement compared to a control plant lacking
the polynucleotide that is selected from the group consisting of improved
yield of plant product, reduced disease symptoms, and enhanced resistance
to disease infestation. The heterologous promoter may, for example, be a
constitutive promoter or a non-constitutive promoter, including, but not
limited to, an organ- or tissue-specific promoter or an inducible
promoter.
[0029]According to another embodiment of the invention, cells are provided
that comprise one or more of the above-mentioned polynucleotides,
including, but not limited to, plant, bacterial, fungal (including
yeast), and insect cells. According to another embodiment, plants that
comprise such cells are provided, including, but not limited to, plants
such as: Acacia, alfalfa, aneth, apple, apricot, artichoke, arugula,
asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry,
broccoli, brussels sprouts, cabbage, cantaloupe, carrot, cassaya,
castorbean, cauliflower, celery, cherry, chicory, cilantro, citrus,
clementines, clover, coconut, coffee, corn, cotton, cucumber, Douglas
fir, eggplant, endive, escarole, eucalyptus, fennel, figs, garlic, gourd,
grape, grapefruit, honey dew, jicama, kiwifruit, lettuce, leeks, lemon,
lime, Loblolly pine, linseed, mango, melon, mushroom, nectarine, nut,
oat, oil palm, oil seed rape, okra, olive, onion, orange, an ornamental
plant, palm, papaya, parsley, parsnip, pea, peach, peanut, pear, pepper,
persimmon, pine, pineapple, plantain, plum, pomegranate, poplar, potato,
pumpkin, quince, radiata pine, radicchio, radish, rapeseed, raspberry,
rice, rye, sorghum, Southern pine, soybean, spinach, squash, strawberry,
sugarbeet, sugarcane, sunflower, sweet potato, sweetgum, tangerine, tea,
tobacco, tomato, triticale, turf grass, turnip, a vine, watermelon,
wheat, yams, and zucchini. According to another embodiment, such a plant
exhibits reduced symptoms from, or enhanced resistance to, a disease
caused by an organism of a genus selected from the group consisting of
Alternaria, Ascochyta, Aspergillus, Botrytis, Cercospora, Colletotrichum,
Diplodia, Erwinia, Erysiphe, Fusarium, Gaeumanomyces, Helminthosporium,
Macrophomina, Magnaporthe, Mycosphaerella, Nectria, Peronospora, Phoma,
Phymatotrichum, Phytophthora, Plasmopara, Podosphaera, Pseudomonas,
Puccinia, Puthium, Pyrenophora, Pyricularia, Pythium, Rhizoctonia,
Scerotium, Sclerotinia, Septoria, Thielaviopsis, Uncinula, Venturia,
Verticillium, and Xanthomonas. The invention further encompasses parts of
such plants, including, but not limited to, seeds, seed pods, flowers,
fruit, tubers, stems, cuttings, and pollen. The invention also
encompasses products resulting from processing of such plants or parts
thereof.
[0030]Formulations of such polynucleotides are also provided. Therefore,
according to another aspect of the invention, a composition is provided
that comprises one or more of the above-described polynucleotides and a
biologically acceptable carrier.
[0031]According to another embodiment of the invention, methods are
provided for making a defense signal peptide comprising expressing in a
cell a polynucleotide as described above. Included are, for example,
plant cells, bacterial cells, fungal cells, and insect cells. Such
methods may further comprise purifying the defense signal peptide.
[0032]According to another embodiment of the invention, methods are
provided for making a transgenic plant, comprising introducing into a
cell of a plant one or more of the above-described polynucleotides of the
invention, thereby producing a transformed cell, and regenerating a
transgenic plant from the transformed cell, wherein, compared to a
control plant lacking the polynucleotide, the transgenic plant exhibits a
characteristic selected from the group consisting of substantially
improved yield of plant product, substantially reduced disease symptoms,
and substantially enhanced resistance to disease infestation.
[0033]According to another embodiment of the invention, methods are
provided for making a plant that comprises a transgene comprising a
sequence that encodes a defense signal peptide operably linked to a plant
promoter, such methods comprising sexually crossing a plant that
comprises the transgene with a plant that lacks the transgene, thereby
producing a plurality of progeny plants, and selecting a progeny plant
comprising the transgene.
[0034]According to another embodiment of the invention, methods are
provided for making a plant that comprises a transgene comprising a
sequence that encodes a defense signal peptide operably linked to a plant
promoter, the method comprising asexually reproducing a plant that
comprises the transgene, thereby producing a plurality of progeny plants,
and selecting a progeny plant comprising the transgene.
[0035]According to another embodiment of the invention, methods are
provided for growing a plant comprising planting a seed that comprises
one or more of the above-mentioned polynucleotides of the invention, and
growing the seed to produce a plant, wherein, compared to a control plant
lacking said polynucleotide sequence, the plant grown from the seed
exhibits a characteristic selected from the group consisting of
substantially improved yield of plant product, substantially reduced
disease symptoms, and substantially enhanced resistance to disease
infestation.
[0036]According to another embodiment of the invention, methods are
provided for detecting a plant cell comprising one or more of the
above-mentioned polynucleotides of the invention in a biological sample,
the method comprising contacting the biological sample with a probe that
binds specifically to the polynucleotide, and detecting said binding. One
such probe is a PCR primer, in which case the method comprises performing
PCR on the sample and detecting said binding by detecting an
amplification product diagnostic of the presence of the polynucleotide in
the sample.
[0037]According to another embodiment of the invention, kits are provided
for detecting a plant cell comprising a polynucleotide according to the
present invention in a biological sample, the kit comprising one or more
probes that bind specifically to the polynucleotide, or to the defense
signal peptide encoded by the polynucleotide, and instructions for use.
[0038]According to another embodiment of the invention, methods are
provided for detecting a plant cell comprising a polynucleotide according
to the invention in a biological sample, the method comprising contacting
the biological sample with a probe that binds specifically to the
polynucleotide, or with a probe that binds to the defense signal peptide
encoded by the polypeptide (such as, for example, an antibody probe), and
detecting said binding.
[0039]According to another embodiment of the invention, plant cells are
provided that comprise an insertion of a foreign promoter upstream of a
coding sequence for a defense signal protein, wherein the foreign
promoter is operably linked to the coding sequence for the defense signal
protein and the plant is characterized by a substantially enhanced
resistance to a disease compared to a control plant lacking the insertion
of the foreign promoter.
[0040]According to another embodiment of the invention, methods of making
a transgenic plant are provided that comprise (a) introducing into cells
of a plant a polynucleotide that comprises a heterologous promoter,
thereby producing a cell comprising an insertion of the heterologous
promoter upstream of a coding sequence for a defense signal protein,
wherein expression of the defense signal protein is controlled by the
foreign promoter, and (b) regenerating a transgenic plant from said cell
comprising the insertion.
[0041]According to another embodiment of the invention, methods of
identifying a defense signal peptide are provided, such methods
comprising: (a) providing a plurality of candidate peptides having a
length of at least 10 amino acids; (b) assaying said plurality of
candidate peptides for defense signal peptide activity in an
alkalinization assay; and (c) selecting a candidate peptide that has
substantial defense signal peptide activity. The candidate peptides may
be provided for such methods by, for example, chemically synthesizing the
candidate peptides. Such methods may further comprise administering the
candidate peptide to a plant by applying a composition comprising the
candidate peptide to the plant. Alternatively, such methods may comprise
administering the candidate peptide to a plant by expressing within a
cell of the plant a polynucleotide that comprises a sequence that encodes
the candidate peptide, thereby producing the candidate peptide within the
cell of the plant.
[0042]According to another embodiment of the invention, methods are
provided for identifying a substance that enhances defense of a plant
against a disease comprising (a) contacting an isolated AtPep1 receptor
with a plurality of candidate substances (e.g., peptides or non-peptide
compounds); (b) selecting a candidate substance that has a detectable
interaction with the isolated AtPep1 receptor; and (c) applying the
selected candidate substance to a plant to determine whether the selected
candidate substance enhances defense of the plant against a disease.
[0043]The foregoing and other aspects of the invention will become more
apparent from the following detailed description, accompanying drawings,
and the claims.
[0044]Unless otherwise defined, all technical and scientific terms used
herein have the same meaning as commonly understood by one of ordinary
skill in the art to which this invention pertains. Although methods and
materials similar or equivalent to those described herein can be used in
the practice or testing of the present invention, suitable methods and
materials are described below. All publications, patent applications,
patents, and other references mentioned herein are incorporated by
reference in their entirety. In case of conflict, the present
specification, including definitions, will control. In addition, the
materials, methods, and examples are illustrative only and not intended
to be limiting.
BRIEF DESCRIPTION OF THE FIGURES
[0045]FIG. 1 provides the nucleotide and deduced amino acid sequences for
the precursor protein for AtPep1, AtproPep1 and a number of paralogs and
orthologs. Sequences that correspond to AtPep1 are underlined.
[0046](a) AtproPep1 (Locus tag At5g64900; Gene: GenBank GeneID: 836613,
Arabidopsis thaliana Chromosome V [GenBank ID#AB019236], region
25954396-25955302; mRNA: NCBI RefSeq ID#NM.sub.--125888-499 bp; Protein:
NCBI RefSeq ID#NP.sub.--569001-92 aa)
[0047]Paralogs (Arabidopsis thaliana):
[0048](b) AtproPep3 (Locus tag At5g64890; Gene: GenBank GeneID: 836612,
Arabidopsis thaliana Chromosome V [GenBank ID#AB019236], region
25951798-25952735; mRNA: NCBI RefSeq ID#NM.sub.--125887-568 bp; Protein:
NCBI RefSeq ID#NP.sub.--569000-109 aa)
[0049](c) AtproPep4 (Locus tag At5g64905; Gene: GenBank GeneID: 836614,
Arabidopsis thaliana Chromosome V [GenBank ID#AB019236], region
25956800-25957285; mRNA: NCBI RefSeq ID#NM.sub.--125889-486 bp; Protein:
NCBI RefSeq ID#NP.sub.--569002-96 aa)
[0050](d) AtproPep5 (Locus tag At5g09980; Gene: GenBank GeneID: 830859,
Arabidopsis thaliana Chromosome V [GenBank ID#AB019236], region
3122757-3123909; mRNA: NCBI RefSeq ID#NM.sub.--121035-460 bp; Protein:
NCBI RefSeq ID#NP.sub.--568223-81 aa)
[0051](e) AtproPep2 (Locus tag At5g09990; Gene: GenBank GeneID: 830860,
Arabidopsis thaliana Chromosome V [GenBank ID#AB019236], region
3124569-3125073; mRNA: NCBI RefSeq ID#NM.sub.--121036-412 bp; Protein:
NCBI RefSeq ID#NP.sub.--568224-86 aa)
[0052](f) AtproPep6 (Locus tag At2g22000; Gene: GenBank GeneID: 816736,
Arabidopsis thaliana Chromosome II [GenBank ID#AC007019], region
9369406-9370082; mRNA: NCBI RefSeq ID#NM.sub.--127769-397 bp; Protein:
NCBI RefSeq ID#NP.sub.--179791-104 aa)
[0053](g) AtproPep7 (Unannotated AtproPep; Gene: No GenBank GeneID,
located on Arabidopsis thaliana Chromosome V [GenBank ID#AB019236],
region 3121350-3121577; mRNA: No mRNA predicted, therefore no ID#; a 228
bp open reading frame (ORF) is encoded in genomic DNA as shown; Protein:
Not predicted, therefore no ID #, Translation of ORF encoded on
chromosome V yields the 75 aa sequence shown.)
[0054]Orthologs:
[0055](h) BnproPep1 from canola (Brassica napus) (GenBank ID#CD816645,
Protein: 95 aa)
[0056](i) StproPep1 from potato (Solanum tuberosum) (GenBank ID#CV505388,
Protein: 116 aa)
[0057](j) PbproPep1 from poplar (Populus balsamifera) (GenBank
ID#CV230975, Protein: 121 aa)
[0058](k) BeproPep1 from birch (GenBank ID#CD276952, Protein: 110 aa)
[0059](l) GmproPep1 from soybean (Glycine max) (GenBank ID#CD401281,
Protein: 115 aa)
[0060](m) MsproPep1 from alfalfa (Medicago sativa) (GenBank ID#BI311441,
Protein: 127 aa)
[0061](n) VvproPep1 from grape (Vitis vinifera) (GenBank ID#CF604664,
Protein: 83 aa)
[0062](o) OsproPep1 from rice (Oryza sativa) (GenBank ID#CF333408; Locus
tag:Os04g54590, Protein 154 aa)
[0063](p) OsproPep2 from rice (Oryza sativa) (GenBank ID#AK111113; Locus
tag:Os08g07600, Protein: 93 aa)
[0064](q) TaproPep1 from wheat (Triticum aestivum) (GenBank ID#AL809059,
Protein: 82 aa)
[0065](r) TaproPep2 from wheat (Triticum aestivum) (GenBank ID#BF201609,
Protein: 75 aa)
[0066](s) ZmproPep1 from maize (Zea mays) (GenBank ID#DN214793, Protein:
142 aa)
[0067](t) HvproPep1 from barley (Hordeum vulgare) (GenBank ID#BQ763246,
Protein: 93 aa)
[0068]FIG. 2 shows the sequence of an AtPep1 receptor gene (At1g73080) and
its deduced amino acid sequence. Also noted are several features of the
receptor polypeptide: a signal sequence (residues 1-24); cysteine pairs
(residues 64 and 71; and residues 836 and 854); leucine-rich repeats
(residues 76-827); transmembrane domain (residues 870-892); kinase domain
(residues 927-1208); and an intron (between residues 1099 and 1100).
[0069]FIG. 3 shows the structure of a second AtPep1 receptor gene
(At1g17750) and its deduced amino acid sequence. Also noted are several
features of the receptor polypeptide: a signal sequence (residues 1-26);
cysteine pairs (residues 62 and 71; and residues 709 and 727);
leucine-rich repeats (residues 99-697); transmembrane domain (residues
738-760); kinase domain (residues 793-1079); and an intron (between
residues 966 and 967).
[0070]FIG. 4 shows the concentration dependence of synthetic AtPep
peptides deduced from the seven members of the AtproPep1 gene family in
the alkalinization assay. Peptide concentrations (left to right for each
peptide): 0.25 nM, 2.5 nM, 25 nM, 250 nM.
[0071]FIG. 5 shows activity of synthetic AtPep1 peptides from the
C-terminus of AtPep1 in the alkalinization assay, from a 9-mer
(SSGRPGQHN) to a full-length 23-mer. Ten microliter aliquots of each
peptide solution were tested for activity at 0.25 nM (gray), 2.5 nM
(dotted), and 25 nM (black).
[0072]FIG. 6 shows the activity of single alanine amino acid substitutions
at every position in the 15-mer peptide at the carboxy terminus of AtPep1
(RGKEKVSSGRPGQHN) in the alkalinization assay. The set of substituted
15-mer peptides was assayed using four-day-old Arabidopsis cells. Ten ml
of each peptide (2.5 pmoles) was added to 1 ml of cells to make a final
concentration of 2.5 nM. After 20 min, the pH of the media was recorded.
The data is the average of three separate experiments.
[0073]The invention will be further described in the following example,
which does not limit the scope of the invention described in the claims.
DETAILED DESCRIPTION OF THE INVENTION
[0074]We have isolated novel defense peptides AtPep1 and AtPep2 from
Arabidopsis and identified similar defense signal peptides in a variety
of other plants, including many crop plants of commercial importance.
This the first demonstration of the involvement of a plant-derived
peptide signal in defense against pathogens. The proAtPep1 and 2
precursor genes have been identified and belong to a seven-member gene
family. The DNA sequence of the gene from Arabidopsis thaliana that
encodes AtproPep1 and the deduced amino acid sequence of AtproPep1 are
provided in FIG. 1. Orthologs have been identified in such dicots as
canola, potato, poplar, alfalfa, soybean, grape and tomato, and in such
monocots as rice, wheat, maize and barley, and are likely commonly found
across the plant kingdom. The sequences or several paralogs and orthologs
of AtPep1 are also provided in FIG. 1.
[0075]The rapid, sensitive alkalinization assay (described below) that was
used to identify and purify the AtPep1 and 2 peptides is useful for
identifying defense signal peptides from any plant whose signaling
pathways result from peptide-receptor interactions that initiate
intracellular signaling through MAP kinases and proton pumps in the
plasma membrane. Within minutes after adding systemin to cells, an
ATP-driven proton pump is inhibited, causing the extracellular medium of
the cells to become alkaline. When aliquots (e.g., 1-10 .mu.L) from
fractions from plant tissues that eluted from HPLC columns were added to
1 mL of suspension cultured plant cells grown at low pH (e.g., pH 5),
some fractions caused the cell medium to increase in pH. The
identification of a peptide as a defense signal peptide is confirmed by
application of the peptide (e.g., as a plant fraction or isolated
peptide) to plants or by expression of a transgene encoding the peptide,
including, but not limited to, the gene encoding a pro-form of the
peptide (such as, for example, AtproPep1, the pro-form of AtPep1), in
plants and observation of detectable defense signal peptide activity,
such as, for example, enhanced disease resistance.
[0076]We established a suspension cultured Arabidopsis cell line to be
used in the alkalinization assay to seek novel peptides in Arabidopsis
leaf extracts. Cells are grown unbuffered near pH 5 or less in order to
record an alkalinization of about 1 pH unit in response to peptide
signals. In order to establish an Arabidopsis suspension cell culture for
use in the alkalinization assay, Arabidopsis cells were regularly
transferred and maintained in the growth chamber room for several months,
when they equilibrate at a pH of about 5.0 during exponential growth.
Cell cultures that grow at low pH from several other plant species,
including tomato (Lycopersicon esculentum), tobacco (Nicotiana tabacum),
alfalfa (Medicago sativa), maize (Zea mays), petunia (Petunia hybrida),
nightshade (Solanum nigrum), and sweet potato (Ipomoea batatus) have been
developed for use in the alkalinization assay, and developing similar
cultures from other plants is readily accomplished.
[0077]For the work described in Example 1, we used a typical purified
peptide fraction from Arabidopsis leaves. Kilogram quantities of leaf
material were extracted and peptides were separated on an HPLC column. A
10 microliter (.mu.L) aliquot from each fraction eluting from the column
was assayed with the alkalinization assay using suspension cultured
Arabidopsis cells. Two novel peaks were identified that were called
AtPep1 and AtPep2. The peptides were purified through several additional
column separations until homogeneous, as verified by MALDI-MS and
amino-terminal sequencing. The peptides were each 23 amino acids in
length and the amino acids sequences of the two were identical at 10
residues. Neither peptide was post-translationally modified. The two
peptides were chemically synthesized and, in alkalinization assays
exhibited identical activities as the native peptides, in the
sub-nanomolar concentration range. Searches of protein data bases
revealed that the peptides were derived from the C-terminus of two
members of a seven-member gene family. The deduced precursors were from
92 to just over 100 amino acids in length and did not have leader
sequences at their N-termini.
[0078]These properties are similar to tomato systemin (Pearce et al.,
Science 253:895-897, 1991). Other similarities between proAtPep1
prosystemin were the absence of a leader sequence in the precursors, the
low nMolar concentrations needed to activate the alkalinization response,
the processing of the peptides from the C-termini of their precursor
proteins, and the presence of KEK motifs in the precursors that are
commonly found in proteins that are involved in protein-protein
interactions. The expression of the proAtPep1 gene in excised Arabidopsis
leaves was induced by AtPep1, similar to the expression of the
prosystemin gene in tomato plants being induced by systemin.
[0079]The tissue-specific expression of the proAtPep1 gene was analyzed
using RT-PCR analyses. All tissues of the plant expressed the gene at low
levels, which did not reveal a clue as to its function. To assess whether
stresses to Arabidposis plants might affect AtPep1 gene expression, the
plants were subjected to cold and drought stresses and treatments with
abscissic acid (ABA), methyl jasmonate (MeJA), methyl salicylate (MeSA),
UV-B, and wounding. Only MeJA and wounding induced a strong expression of
the gene. These results indicated that the gene was behaving in
Arabidopsis in a similar manner as systemin in tomato plants (Ryan et
al., Plant Cell. 14:251-264, 2002) and suggested that the peptide may be
a defense signaling peptide.
[0080]Pathogen defense is well characterized in Arabidopsis, where two
defense pathways have been identified in which jasmonate is a signaling
component (Lorenzo and Solano, Curr. Opin. Plant Biol 8:532-540, 2005;
Lorenzo et al., Plant Cell 16:1938-1950, 2004). In one pathway, wounding
and jasmonate activate defensive genes through the octadecanoid pathway,
with COI1 and AMYC2 playing major roles in transcription of defensive
genes that includes LOX2 and VSP2 (Lorenzo et al., Plant Cell
16:1938-1950, 2004). In the second pathway jasmonate, in concert with
ethylene, activates PDF1.2, and several PR proteins, with active oxygen
playing a key signaling role (Lorenzo et al., Plant Cell 15:165-178,
2003; Penninckx et al., Plant Cell 10:2103-2113, 1998; Penninckx et al.,
Plant Cell 8:2309-2323, 1996; Coego et al., Plant Cell 17:2123-2137,
2005; Mackerness et al., Plant Cell Environ. 22:1413-1423, 1999). To
assess the possible involvement of AtPep1 with the known pathways,
Arabidopsis plants were excised and supplied with the AtPep1 peptide at
10 nM concentrations, and several known wound-inducible genes and
pathogen defense genes were assayed for expression levels two hours
later. Only the pathogen defense genes were induced, with PDF2.2 and PR-1
being most strongly expressed, with PR-3, PR-4 and TAT expressed at lower
levels. LOX2 and VSP2 genes were not induced by the peptide.
[0081]Arabidopsis plants were transformed with a 35S-AtPep1 fused gene,
and many stable transformants that strongly expressed the gene were
recovered. The overexpression of the gene did not visibly affect the
growth of the transgenic plants compared to wild type plants. The progeny
of a stable transformant that strongly expressed the gene was analyzed to
determine if the overexpression of the gene would affect the expression
of defense genes. Plants constitutively overexpressing the proAtPep1 gene
also constitutively overexpressed the AtPep1-inducible genes.
[0082]To determine if the transgenic plants were more resistant to a
pathogen, the
soil of plants in which the transgenic line was grown was
inoculated with the root pathogen Pythium irregulare and the plants were
monitored with time to assess pathogenicity. The aerial parts of the
transgenic plants infected with Pythium were visibly more robust than
infected wild type plants. However, the roots of the infected transgenic
plants were much denser and healthier that roots of infected wild type
plants. The transgenic plants were growing almost as well as uninfected
wild type plants. These experiments indicated that overexpression of the
gene was enhancing resistance to the root pathogen
[0083]Using photoaffinity labeling of AtPep1, a high affinity binding
protein for the peptide was identified on the surface of Arabidopsis
suspension cultured cells by photoaffinity labeling. The protein was
purified to homogeneity. The binding of the photoaffinity label to the
receptor is strongly competed by unlabeled AtPep1, but not by tomato
systemin. The binding of AtPep1 is powerfully competed by suramin, a
potent inhibitor of many ligand-receptor interactions, including the
binding of systemin with its receptor. Amino acid sequence analysis has
shown the protein to be a leucine-rich repeat (LRR) receptor kinase. The
gene (At1G73080) contains 27 LRR motifs, a 23 amino acid
membrane-spanning region, and an intracellular protein kinase domain. The
protein is glycosylated, as evidenced by the loss of about 20% of its
mass by enzymatic deglycosylation. An ortholog (At1G17750) is present in
Arabidopsis, and LRR receptor kinase orthologs from rice and morning
glory have been reported in GenBank that that share a high percentage of
amino acid identity with the AtPep1 receptor. The paralog in Arabidopsis
shares over 90% amino acid identity with AtPep1, but it has only 24 LRRs
and does not have either a transmembrane domain or a kinase domain. The
DNA and deduced amino acid sequences for the AtPep1 receptors are
provided in FIG. 2 (Ag1g73080) and FIG. 3 (At1g17750).
[0084]The AtPep1 peptide, like systemin, is apparently a cytosol-derived
peptide that involves the jasmonate/ethylene signaling pathway. How the
peptide is processed from a precursor and arrives at the cell surface to
activate a signaling pathway is unknown, but, like systemin, transport of
either the precursor or the processed peptide to the cell surface may
occur in order for the peptide to react with its receptor.
[0085]AtPep1 is a component of the defense signaling of Arabidopsis plants
and is therefore the first plant peptide hormone to be associated with a
known pathogen defense pathway in any plant.
[0086]Table 1 shows examples of the C-terminal sequences of paralogs and
orthologs of AtproPep1 that we have identified in a wide variety of
plants. In addition to the examples listed in Table 1, for example, two
orthologs of the AtPep1 precursor gene (called preproLePep1) have been
identified in tomato plants. The tomato cDNA has been isolated and shown
to code for an AtPep1-like defense peptide. Other paralogs and orthologs
of AtprpPep1 in these and other plant species may be found by amino acid
sequence homology. Additional defense signal peptides may be identified
by screening plants for peptides having defense peptide activity, as
described herein.
TABLE-US-00001
TABLE 1
AtPep1, Paralogs, Orthologs and
Dicot and Monocot Consensus Sequences
Peptide Source Alignment of C-terminal Sequences
AtPep1 Arabidopsis thaliana ##STR00001##
Paralogs
AtPep2 Arabidopsis -SLNVM RKGIR KQPVS SGKRG GVN
thaliana
AtPep3 Arabidopsis -DNKAK SKKRD KEKPS SGRPG QTN
thaliana
AtPep4 Arabidopsis -EIKAR GKNKT KPTPS SGKGG KHN
thaliana
AtPep5 Arabidopsis -GLPGK KNVLK KSRES SGKPG GTN
thaliana
AtPep6 Arabidopsis -ITAVL RRRPR PPPYS SGRPG QNN
thaliana
AtPep7 Arabidopsis -VSGNV AARKG KQQTS SGKGG GTN
thaliana
Orthologs
BnPep1 Canola -VARLT RRRPR PP-YS SGQPG QIN
(Brassica
napus)
StPep1 Potato -PTERR GRPPS RPKVG SGPPP QNN
(Solanum
tuberosum)
PbPep1 Poplar -DAAVS ALARR TPPVS RGGGG QTN
(Populus
balsamfera)
BePep1 Birch (Betula -DLVMA VNAPP RPSLT PGSGA QIN
spp.)
GmPep1 Soybean -ASLMA TRGSR GSKTS DGSGP QHN
(Glycine
max)
MsPep1 Alfalfa -LSSMG RGGPR RTPLT QGPPP QHN
(Medicago
sativa)
VvPep1 Grape (Vitis -EKVRE KQKKG EDGES VGRPG KKN
vinifera)
Dicot consensus sequence ##STR00002##
OsPep1 Rice (Oryza -ARLRP KPPGN PREGS GGNGG HHH
sativa)
OsPep2 Rice (Oryza -DDSKP TRPGA PAEGS GGNGG AIH
sativa)
TaPep1 Wheat -AVRRP RPPTT PREGR GGGGG SHN
(Triticum
aestivum)
TaPep2 Wheat -AAPAP QRPGA PAEGA GGQGG IIH
(Triticum
aestivum)
ZmPep1 Maize (Zea -VRRRP TTPGR PREGS GGNGG NHH
mays)
HvPepl Barley -QLARP RPPGP PRQGH GGDGG AIH
(Hordeum
vulgare)
Monocot consensus sequence ##STR00003##
Among the native defense signal peptides identified so far, the shortest
deduced peptide sequence is 23 amino acids in length (for example,
AtPep1) and the longest is 36 amino acids (AtPep3).
[0087]The dicot and monocot disease signal peptides in particular have a
substantial degree of homology in the C-terminal region of the peptides,
allowing us to define consensus sequences as shown in Table 1, which
shows C-terminal alignments for AtPep paralogs and orthologs that
correspond to the sequence of AtPep1 and dicot and monocot consensus
sequences for defense signal peptides.
[0088]According to one aspect of the invention, defense signal peptides
are provided that comprise a dicot or monocot consensus sequence or have
a high degree of amino acid sequence homology to such a consensus
sequence, e.g., 75 percent homology, or 80 percent homology, or 90
percent homology. In one embodiment, such defense signal peptides are 10
amino acid residues in length or longer and have defense signal peptide
activity.
[0089]Analogs of AtPep1 were synthesized and assayed in the alkalinization
assay. An analog of AtPep1 missing the carboxy-terminal amino acid was
completely inactive, whereas deletions from the amino-terminus of the
peptide resulted in a sequential reduction in activity, until peptides
with 9 carboxy-terminal amino acids remaining (SSGRPGQHN) were inactive.
A peptide consisting of only the 15 C-terminal amino acids was nearly as
active as the native peptide (at approximately 2.5 nM), but analogs of 14
amino acids and smaller were progressively less active.
[0090]AtPep1 is 23 amino acid residues in length. However, truncated forms
of AtPep1 of 10 amino acid residues from the C-terminus of AtPep1 retain
activity, and peptides having 15 residues retain substantially full
defense signal peptide activity (Example 3). As a result of the foregoing
studies of shorter defense signal peptides, according to another
embodiment of the invention, defense signal peptides comprising at least
10 amino acid residues, particularly those including sequences from the
C-terminus of native defense signal peptides or including consensus dicot
or monocot sequences are provided. Such shorter peptides may be 11 or
more, 12 or more, or 15 or more amino acid residues in length, provided
that they retain substantial defense signal peptide activity.
[0091]The 15-mer was substituted with alanine in each position to assess
which amino acids were necessary for the alkalinating activity. A Ser to
Ala substitution at position 7, counting from the amino-terminus of the
15-mer, and a Gly to Ala substitution at position 9 exhibited little
activity. Computer modeling predicted that these two amino acids would be
involved in a hairpin-turn within the peptide region of --SSGR-- (compare
with residues 15-18 of the sequence of AtPep1 shown in Table 1).
Substituting Ala for Ser (-ASGR--) abolished the predicted turn and
severely reduced activity (half-maximal activity at approximately 25 nM),
while substituting Ala for Gly was even less active (half-maximal
activity of >250 nM). However, neither of these analogs were able to
compete with the non-substituted 15-mer for receptor binding, indicating
that the structural changes in this region may have severely modified the
conformation without competing for the receptor binding site. Other Ala
substitutions had no effect on activity. These results will guide the
skilled artisan in making desired substitutions in other defense signal
peptides.
Definitions and Methods
[0092]The following definitions and methods are provided to better define
the present invention and to guide those of ordinary skill in the art in
the practice of the present invention. Unless otherwise noted, terms are
to be understood according to conventional usage by those of ordinary
skill in the relevant art. Definitions of common terms in molecular
biology may also be found in Rieger et al., Glossary of Genetics:
Classical and Molecular, 5th edition, Springer-Verlag: New York, 1991;
and Lewin, Genes V, Oxford University Press: New York, 1994. The
nomenclature for DNA bases as set forth at 37 CFR 1.822 is used. The
standard one- and three-letter nomenclature for amino acid residues is
used.
[0093]Polynucleotides
[0094]"Polynucleotide." The term "polynucleotide" refers to a polymer of
nucleotide monomers, including but not limited to ribonucleotides or
deoxyribonucleotides or nucleotide analogues. Polynucleotides include,
for example, DNA and RNA molecules, including cDNA, genomic DNA, primers,
probes, vectors, and so on, and include single- and double-stranded forms
thereof. Polynucleotides according to the invention may be chemically
modified by well known methods by labeling, coupling to solid supports,
etc.
[0095]"Defense signal peptide (or polypeptide) polynucleotide". The term
"defense signal peptide polynucleotide" refers to a polynucleotide that
encodes a defense signal peptide, and a "defense signal polypeptide
polynucleotide" refers to a polynucleotide that encodes a defense signal
polypeptide (i.e., a polypeptide that, when processed in a plant cell,
produces a defense signal peptide), whether a cDNA or genomic sequence or
synthetic form thereof. Such polynucleotides may comprise wild-type
polynucleotides sequences encoding defense signal polypeptides, such as
those listed in Table 1, operably linked to a heterologous promoter,
i.e., a promoter not associated in nature with such native, or wild-type,
polynucleotide sequences. Alternatively, such polynucleotides may
comprise non-naturally occurring recombinant polynucleotides that
comprise a sequence that encodes a defense signal peptide operably linked
to a suitable promoter. For expression of defense signal peptides for
exogenous application to plants, a defense signal peptide polynucleotide
may be operably linked to a promoter suitable for expression in a
bacterial, fungal, insect, or other suitable cell. For transformation of
plants or plant cells or tissues, a defense signal peptide may be
operably linked to a promoter suitable for expression in a plant cell,
i.e., a plant promoter. According to another embodiment, a heterologous
promoter may be introduced into a plant or a plant cell or tissue for
insertion into the genome, thereby producing an insertion of the promoter
upstream of a sequence that encodes a defense signal peptide, operably
linking the sequence encoding the defense signal peptide to the
heterologous promoter. Such an expression unit, including the
heterologous promoter and the sequence encoding the defense control
peptide, is another embodiment of a defense signal peptide (or
polypeptide) polynucleotide.
[0096]"Native". The term "native" refers to a naturally-occurring
("wild-type") polynucleotide, polypeptide or peptide.
[0097]"Isolated". An "isolated" polynucleotide is one that has been
substantially separated or purified away from other polynucleotide
sequences in the cell of the organism in which the polynucleotide
naturally occurs, i.e., other chromosomal and extrachromosomal DNA and
RNA, by conventional purification methods. The term also embraces
recombinant polynucleotides (including promoter insertions operably
linked to a defense signal peptide gene) and chemically synthesized
polynucleotides.
[0098]Fragments, Probes, and Primers. A fragment of a polynucleotide is a
portion of a polynucleotide that is less than full-length and comprises
at least a minimum length capable of hybridizing specifically with a
native polynucleotide sequence under stringent hybridization conditions.
The length of such a fragment is preferably at least 15 nucleotides, more
preferably at least 20 nucleotides, and most preferably at least 30
nucleotides of a native polynucleotide sequence.
[0099]A "probe" is an isolated polynucleotide to which is attached a
conventional detectable label or reporter molecule, e.g., a radioactive
isotope, ligand, chemiluminescent agent, or enzyme. "Primers" are
isolated polynucleotides that are annealed to a complementary target DNA
strand by nucleic acid hybridization to form a hybrid between the primer
and the target DNA strand, then extended along the target DNA strand by a
polymerase, e.g., a DNA polymerase. Primer pairs can be used for
amplification of a polynucleotide sequence, e.g., by the polymerase chain
reaction (PCR) or other conventional nucleic-acid amplification methods.
[0100]Probes and primers are generally 15 nucleotides or more in length,
preferably 20 nucleotides or more, more preferably 25 nucleotides, and
most preferably 30 nucleotides or more. Such probes and primers hybridize
specifically to the target polynucleotide sequence under high stringency
hybridization conditions under at least moderately stringent conditions.
[0101]Methods for preparing and using probes and primers are described,
for example, in Molecular Cloning: A Laboratory Manual, 2nd ed., vol.
1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y., 1989 (hereinafter, "Sambrook et al., 1989"); Current
Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and
Wiley-Interscience, New York, 1992 (with periodic updates) (hereinafter,
"Ausubel et al., 1992); and Innis et al., PCR Protocols: A Guide to
Methods and Applications, Academic Press: San Diego, 1990. PCR-primer
pairs can be derived from a known sequence, for example, by using
computer programs intended for that purpose such-as Primer (Version 0.5,
1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).
[0102]Primers and probes based on the native defense signal polypeptide
polynucleotide sequences that are disclosed herein can be used to confirm
(and, if necessary, to correct) the disclosed polynucleotide sequences by
conventional methods, e.g., by re-cloning and re-sequencing.
[0103]"Substantial similarity". A first polynucleotide is "substantially
similar" to a second polynucleotide if, when optimally aligned (with
appropriate nucleotide insertions or deletions) with the other
polynucleotide (or its complementary strand), there is at least about 75%
nucleotide sequence identity, preferably at least about 80% identity,
more preferably at least about 85% identity, and most preferably at least
about 90% identity. Sequence similarity can be determined by comparing
the nucleotide sequences of two polynucleotides using sequence analysis
software such as the Sequence Analysis Software Package of the Genetics
Computer Group, University of Wisconsin Biotechnology Center, Madison,
Wis.
[0104]Alternatively, two polynucleotides are substantially similar if they
hybridize under stringent conditions.
[0105]"Operably Linked". A first nucleic-acid sequence is "operably
linked" with a second nucleic-acid sequence when the first nucleic-acid
sequence is placed in a functional relationship with the second
nucleic-acid sequence. For instance, a promoter is operably linked to a
coding sequence if the promoter affects the transcription or expression
of the coding sequence. Generally, operably linked DNA sequences are
contiguous and, where necessary to join two protein coding regions, in
reading frame.
[0106]"Recombinant". A "recombinant" polynucleotide is made by an
artificial combination of two otherwise separated segments of sequence,
e.g., by chemical synthesis or by the manipulation of isolated segments
of polynucleotides by genetic engineering techniques. Techniques for
nucleic-acid manipulation are well-known (see, e.g., Sambrook et al.,
1989, and Ausubel et al., 1992). Methods for chemical synthesis of
polynucleotides are discussed, for example, in Beaucage and Carruthers,
Tetra. Letts. 22:1859-1862, 1981, and Matteucci et al., J. Am. Chem. Soc.
103:3185, 1981. Chemical synthesis of polynucleotides can be performed,
for example, on commercial automated oligonucleotide synthesizers.
[0107]Preparation of Recombinant or Chemically Synthesized
Polynucleotides, Vectors, Transformation, Host cells. Natural or
synthetic polynucleotides according to the present invention can be
incorporated into recombinant nucleic-acid constructs, typically DNA
constructs, capable of introduction into and replication in a host cell.
Such a construct preferably is a vector that includes a replication
system and sequences that are capable of transcription and translation of
a polypeptide-Oncoding sequence in a given host cell.
[0108]For the practice of the present invention, conventional compositions
and methods for preparing and using vectors and host cells are employed,
as discussed, inter alia, in Sambrook et al., 1989, or Ausubel et al.,
1992.
[0109]A cell, tissue, organ, or organism into which has been introduced a
foreign polynucleotide, such as a recombinant vector, is considered
"transformed", "transfected", or "transgenic." A "transgenic" or
"transformed" cell or organism also includes progeny of the cell or
organism and progeny produced from a breeding program employing such a
"transgenic" plant as a parent in a cross and exhibiting an altered
phenotype resulting from the presence of a recombinant polynucleotide
construct.
[0110]A number of vectors suitable for stable transfection of plant cells
or for the establishment of transgenic plants have been described in,
e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp.
1987); Weissbach and Weissbach, Methods for Plant Molecular Biology,
Academic Press, 1989; and Gelvin et al., Plant Molecular Biology Manual,
Kluwer Academic Publishers, 1990. Typically, plant expression vectors
include, for example, one or more cloned plant genes under the
transcriptional control of 5' and 3' regulatory sequences and a dominant
selectable marker. Such plant expression vectors also can contain a
promoter regulatory region (e.g., a regulatory region controlling
inducible or constitutive, environmentally- or developmentally-regulated,
or cell- or tissue-specific expression), a transcription initiation start
site, a ribosome binding site, an RNA processing signal, a transcription
termination site, and/or a polyadenylation signal.
[0111]Examples of constitutive plant promoters include, but are not
limited to, the cauliflower mosaic virus (CaMV) 35S promoter, which
confers constitutive, high-level expression in most plant tissues (see,
e.g., Odel et al., Nature 313:810, 1985), including monocots (see, e.g.,
Dekeyser et al., Plant Cell 2:591, 1990; Terada and Shimamoto, Mol. Gen.
Genet. 220:389, 1990); the nopaline synthase promoter (An et al., Plant
Physiol. 88:547, 1988) and the octopine synthase promoter (Fromm et al.,
Plant Cell 1:977, 1989).
[0112]A variety of plant gene promoters that are regulated in response to
environmental, hormonal, chemical, and/or developmental signals, also can
be used for expression of defense signal peptides in plant cells,
including promoters regulated by (1) heat (Callis et al., Plant Physiol.
88:965, 1988), (2) light (e.g., pea rbcS-3A promoter, Kuhlemeier et al.,
Plant Cell 1:471, 1989; maize rbcS promoter, Schaffner and Sheen, Plant
Cell 3:997, 1991; or chlorophyll a/b-binding protein promoter, Simpson et
al., EMBO J. 4:2723, 1985), (3) hormones, such as abscisic acid (Marcotte
et al., Plant Cell 1:969, 1989), (4) wounding (e.g., wunl, Siebertz et
al., Plant Cell 1:961, 1989); or (5) chemicals such as methyl jasminate,
salicylic acid, or Safener. It may also be advantageous to employ (6)
organ-specific promoters (e.g., Roshal et al., EMBO J. 6:1155, 1987;
Schemthaner et al., EMBO J. 7:1249, 1988; Bustos et al., Plant Cell
1:839, 1989), including promoters that express specifically in the root,
leaf, seed, etc.
[0113]Plant expression vectors optionally include RNA processing signals,
e.g., introns, which may be positioned upstream or downstream of a
polypeptide-encoding sequence in the transgene. In addition, the
expression vectors may also include additional regulatory sequences from
the 3'-untranslated region of plant genes (Thornburg et al., Proc. Natl.
Acad. Sci. USA 84:744 (1987); An et al., Plant Cell 1:115 (1989), e.g., a
3' terminator region to increase mRNA stability of the mRNA, such as the
PI-II terminator region of potato or the octopine or nopaline synthase 3'
terminator regions.
[0114]Useful dominant selectable marker genes include genes encoding
antibiotic resistance genes (e.g., resistance to hygromycin, kanamycin,
bleomycin, G418, streptomycin or spectinomycin); and herbicide resistance
genes (e.g., phosphinothricin acetyltransferase). A useful strategy for
selection of transformants for herbicide resistance is described, e.g.,
in Vasil, Cell Culture and Somatic Cell Genetics of Plants, Vols. I-III,
Laboratory Procedures and Their Applications Academic Press, New York,
1984.
[0115]An expression vector for expression of a defense signal peptide or
polypeptide in a plant may also comprise a gene encoding another
polypeptide, including a herbicide-tolerance gene (e.g., tolerance to
glyphosate, glufosinate, etc.); a polypeptide conferring insect
resistance (e.g., a Bacillus thuringensis insecticidal protein or a
Xenorhabdus insecticidal protein); a pathogen protein (e.g., virus coat
protein); a trait for improving yield, drought resistance, cold
tolerance, etc.; a trait for modifying the oil, protein or starch
composition of seeds; or another gene that has a desirable activity when
expressed in a plant. For example, U.S. Pat. No. 5,571,706 describes the
introduction of the N gene into tobacco to confer resistance to tobacco
mosaic virus; WO 95/28423 describes the expression of the Rps2 gene from
Arabidopsis thaliana in plants as a means of creating resistance to
bacterial pathogens including Pseudomonas syringae; WO 98/02545 describes
the introduction of the Prf gene into plants to obtain broad-spectrum
pathogen resistance; and U.S. Pat. No. 6,762,285 describes the expression
of the Bs2 resistance proteins in plants to confer resistance to
Xanthomonas campestris. Such plant defense genes may also be co-expressed
on the same or a different expression vector with a defense signal
polypeptide or peptide.
[0116]Nucleic-Acid Hybridization: "Stringent Conditions"; "Specific". The
term "stringent conditions" is functionally defined with regard to the
hybridization of a nucleic-acid probe to a target polynucleotide (i.e.,
to a particular nucleic-acid sequence of interest) by the specific
hybridization procedure discussed in Sambrook et al., 1989, at 9.52-9.55.
See also, Sambrook et al., 1989 at 9.47-9.52, 9.56-9.58; Kanehisa, Nucl.
Acids Res. 12:203-213, 1984; and Wetmur and Davidson, J. Mol. Biol.
31:349-370, 1968.
[0117]Regarding the amplification of a target nucleic-acid sequence (e.g.,
by PCR) using a particular amplification primer pair, "stringent
conditions" are conditions that permit the primer pair to hybridize only
to the target nucleic-acid sequence to which a primer having the
corresponding wild-type sequence (or its complement) would bind and
preferably to produce a unique amplification product.
[0118]The term "specific for (a target sequence)" indicates that a probe
or primer hybridizes under given hybridization conditions only to the
target sequence in a sample comprising the target sequence.
[0119]Nucleic-Acid Amplification. As used herein, "amplified DNA" refers
to the product of nucleic-acid amplification of a target nucleic-acid
sequence. Nucleic-acid amplification can be accomplished by any of the
various nucleic-acid amplification methods known in the art, including
the polymerase chain reaction (PCR). A variety of amplification methods
are known in the art and are described, inter alia, in U.S. Pat. Nos.
4,683,195 and 4,683,202 and in PCR Protocols: A Guide to Methods and
Applications, ed. Innis et al., Academic Press, San Diego, 1990.
[0120]See also the Examples below regarding RT-PCR, for example.
[0121]Nucleotide-Sequence Variants of Native Defense Signal Polypeptide
Polynucleotides and Amino Acid Sequence Variants of Native Defense Signal
Proteins and Peptides. Using the nucleotide and the amino-acid sequences
disclosed herein, those skilled in the art can create DNA molecules,
polypeptides and peptides that have minor variations in their nucleotide
or amino acid sequence, respectively.
[0122]"Variant" DNA molecules are DNA molecules containing minor changes
in a native sequence, i.e., changes in which one or more nucleotides of a
native sequence is deleted, added, and/or substituted, preferably while
substantially maintaining a desired biological activity. Variant DNA
molecules can be produced, for example, by standard DNA mutagenesis
techniques or by chemically synthesizing the variant DNA molecule or a
portion thereof. Such variants preferably do not change the reading frame
of the protein-coding region of the polynucleotide and preferably encode
a protein having no change, only a minor reduction, or an increase in a
desired biological activity.
[0123]Amino-acid substitutions are preferably substitutions of single
amino-acid residues. DNA insertions are preferably of about 1 to 10
contiguous nucleotides and deletions are preferably of about 1 to 30
contiguous nucleotides. Insertions and deletions are preferably
insertions or deletions from an end of the protein-coding or non-coding
sequence and are preferably made in adjacent base pairs. Substitutions,
deletions, insertions or any combination thereof can be combined to
arrive at a final construct.
[0124]Preferably, variant polynucleotides according to the present
invention are "silent" or "conservative" variants. "Silent" variants are
variants of a native sequence or a homolog thereof in which there has
been a substitution of one or more base pairs but no change in the
amino-acid sequence of the polypeptide or peptide encoded by the
sequence. "Conservative" variants are variants of a native (or consensus)
sequence in which at least one codon in the protein-coding region of the
gene has been changed, resulting in a conservative change in one or more
amino acid residues of the encoded polypeptide encoded, i.e., an amino
acid substitution. A number of conservative amino acid substitutions are
listed below. In addition, one or more codons encoding cysteine residues
can be substituted for, resulting in a loss of a cysteine residue and
affecting disulfide linkages in the polypeptide.
TABLE-US-00002
TABLE 2
Conservative Amino-Acid Substitutions
Original Residue Conservative Substitutions
Ala Ser
Arg Lys
Asn Gln, His
Asp Glu
Cys Ser
Gln Asn
Glu Asp
Gly Pro
His Asn; Gln
Ile Leu; Val
Leu Ile; Val
Lys Arg; Gln; Glu
Met Leu; Ile
Phe Met; Leu; Tyr
Ser Thr
Thr Ser
Trp Tyr
Tyr Trp; Phe
Val Ile; Leu
Substantial changes in function are made by selecting substitutions that
are less conservative than those listed above, e.g., causing changes in:
(a) the structure of the polypeptide backbone in the area of the
substitution; (b) the charge or hydrophobicity of the polypeptide at the
target site; or (c) the bulk of an amino acid side chain. Substitutions
generally expected to produce the greatest changes in protein properties
are those in which: (a) a hydrophilic residue, e.g., seryl or threonyl,
is substituted for (or by) a hydrophobic residue, e.g., leucyl,
isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is
substituted for (or by) any other residue; (c) a residue having an
electropositive side chain, e.g., lysyl, arginyl, or histadyl, is
substituted for (or by) an electronegative residue, e.g., glutamyl or
aspartyl; or (d) a residue having a bulky side chain, e.g.,
phenylalanine, is substituted for (or by) one not having a side chain,
e.g., glycine.
Polypeptides and Peptides
[0125]Three and one-letter code for amino acids. For the polypeptide and
peptide sequences presented herein, either the three-letter code or the
one-letter code may be used for representing amino acid residues, as
provided in Table 3 below.
TABLE-US-00003
TABLE 3
Three-letter Code and One-letter Code for Amino Acids
Amino Acid Three-Letter Code One-Letter Code
Alanine Ala A
Cysteine Cys C
Aspartic acid Asp D
Glutamic acid Glu E
Phenylalanine Phe F
Glycine Gly G
Histidine His H
Isoleucine Ile I
Lysine Lys K
Leucine Leu L
Methionine Met M
Asparagine Asn N
Proline Pro P
Glutamine Gln Q
Arginine Arg R
Serine Ser S
Threonine Thr T
Valine Val V
Tryptophan Trp W
Tyrosine Tyr Y
Unknown or Xaa X
Unspecified
[0126]"Defense Signal Polypeptide"; "Defense Signal Peptide". In general,
a peptide is considered a short polypeptide. The term "defense signal
polypeptide" (or protein) refers to a polypeptide encoded by a defense
signal protein polynucleotide, including, but not limited to, the
polynucleotides listed in Table 1, and other polynucleotides that encode
orthologs, paralogs, homologs, and variants of a native defense signal
polypeptide. Defense signal peptides result from the processing of a
native defense signal polypeptide, such as AtproPep1, in a plant cell. As
a result, a native defense signal polypeptide includes sequences in
addition to defense signal peptide sequences. Recombinant polypeptides
that are not processed intracellularly, but that have defense signal
peptide activity, are also considered defense signal polypeptides or
peptides.
[0127]Recombinant fusion polypeptides may be made that, when processed in
a plant cell, result in the production of more than one defense signal
peptide, or in the production of a defense signal peptide and another
biologically active polypeptide or peptide.
[0128]The term "defense signal peptide" refers to a peptide about ten or
more amino acids in length that has substantial defense signal peptide
activity. Such defense signal peptides may have a length be 11, 12, 13,
14, 15, or more amino acids. AtPep1 is a native defense signal peptide
from Arabidopsis that is 23 amino acids in length, although sequences
from the C-terminal end of AtPep1 as short as 10 amino acids retain
substantial defense signal peptide activity, and such truncated peptides
increase in activity with increasing length. Defense signal peptides
longer than 23 amino acids retain defense signal peptide activity. The
native defense signal polypeptides that we have identified range encodes
propeptides of 75 to 154 amino acids that are processed intracellularly
to produce the shorter defense signal peptides. Defense signal peptides
up to about 160 amino acid residues, or 100, or 90, or 80, or 70, or 60,
or 50, or 40, or 30, or 23, or 20 amino acid residues are included among
the defense signal peptides of the invention.
[0129]Defense signal peptides may be produced by expression of a
polynucleotide that encodes such a peptide intracellularly, e.g., in a
plant cell, or in a non-plant cell, e.g., a bacterial, fungal, insect, or
other cell used in recombinant production of polypeptides. Alternatively,
defense signal peptides may be produced by chemical synthesis. Techniques
for chemical synthesis of polypeptides are described, for example, in
Merrifield, J. Amer. Chem. Soc. 85:2149-2156, 1963, and peptide
synthesizers are commercially available. For chemical synthesis, shorter
forms of the defense signal peptides are preferable to longer forms,
including but not limited to, defense signal peptides between about 10
and about 30 amino acids in length.
[0130]Polypeptide Sequence Homology. Ordinarily, defense signal peptides
encompassed by the present invention are at least about 75 percent
homologous to a native defense signal peptide, including but not limited
to any of the defense signal peptides listed in Table 1 or a dicot or
monocot consensus defense signal peptide sequence, or at least about 80
percent, 85 percent, 90 percent, or 100 percent (complete) homology, and
that has substantial defense signal peptide activity. Such homology is
considered to be "substantial homology," although more important than
shared amino-acid sequence homology is the possession of characteristic
structural features and highly conserved amino acid residues from the
C-terminal region of native defense signal peptides or consensus
sequences.
[0131]Polypeptide homology is typically analyzed using sequence analysis
software such as the Sequence Analysis Software Package of the Genetics
Computer Group, University of Wisconsin Biotechnology Center, Madison,
Wis.). Polypeptide sequence analysis software matches homologous
sequences using measures of homology assigned to various substitutions,
deletions, substitutions, and other modifications.
[0132]"Isolated," "Purified," "Homogeneous" Polypeptides and Peptides. An
"isolated" polypeptide or peptide has been separated from the cellular
components (polynucleotides, lipids, carbohydrates, and other
polypeptides) that naturally accompany it. Such a polypeptide or peptide
can also be referred to as "pure" or "homogeneous" or "substantially"
pure or homogeneous. Thus, a polypeptide which is chemically synthesized
is isolated. A defense signal peptide or polypeptide is also considered
"isolated" if it is the product of the expression of a recombinant
polynucleotide (even if expressed in a homologous cell type). Thus, if
AtPep1, for example, is recombinantly expressed in an Arabidopsis plant,
it is considered "isolated" if the polynucleotide that encodes it is
under the control of a promoter that is different from the native
AtproPep1 promoter, or if the polynucleotide encodes a polypeptide other
than the wild-type, or native, AtproPep1 polypeptide but, when processed
in a plant cell produces a native AtPep1 peptide, or the AtPep1 peptide
produced by expression of the polynucleotide and processing of the
encoded polypeptide differs from that of the native AtPep1 peptide in any
way, for example in length or sequence.
[0133]A monomeric polypeptide or peptide is isolated when at least 60% by
weight of a sample is composed of the polypeptide or peptide, or 90% or
more, or 95% or more, or more than 99%. Protein purity or homogeneity is
indicated, for example, by polyacrylamide gel electrophoresis of a
protein sample, followed by visualization of a single polypeptide band
upon staining the polyacrylamide gel; high pressure liquid
chromatography; or other conventional methods.
[0134]Protein Purification. The polypeptides and peptides of the present
invention can be purified by any of the means known in the art. Various
methods of protein purification are described, e.g., in Guide to Protein
Purification, ed. Deutscher, Meth. Enzymol. 185, Academic Press, San
Diego, 1990; and Scopes, Protein Purification: Principles and Practice,
Springer Verlag, New York, 1982.
[0135]Variant and Modified Forms of Defense Signal Peptides and
Polypeptides. Encompassed by the defense signal peptides and polypeptides
of the present invention are variant peptides and polypeptides in which
there have been substitutions, deletions, insertions or other
modifications of a native (i.e., wild-type) peptide or polypeptide. The
variants substantially retain structural characteristics and biological
activities of a corresponding native peptide or polypeptide and are
preferably silent or conservative substitutions of one or a small number
of contiguous amino acid residues.
[0136]Regarding the terms "paralog" and "ortholog", homologous
polynucleotide sequences and homologous polypeptide sequences may be
paralogs or orthologs of the claimed polynucleotide or polypeptide
sequence. Orthologs and paralogs are evolutionarily related genes that
have similar sequence and similar functions. Orthologs are structurally
related genes in different species that are derived by a speciation
event. Paralogs are structurally related genes within a single species
that are derived by a duplication event. Sequences that are sufficiently
similar to one another will be appreciated by those of skill in the art
and may be based upon percentage identity of the complete sequences,
percentage identity of a conserved domain or sequence within the complete
sequence, percentage similarity to the complete sequence, percentage
similarity to a conserved domain or sequence within the complete
sequence, and/or an arrangement of contiguous nucleotides or peptides
particular to a conserved domain or complete sequence. Sequences that are
sufficiently similar to one another will also bind in a similar manner to
the same DNA binding sites of transcriptional regulatory elements using
methods well known to those of skill in the art.
[0137]The term "equivalog" describes members of a set of homologous
proteins that are conserved with respect to function since their last
common ancestor. Related proteins are grouped into equivalog families,
and otherwise into protein families with other hierarchically defined
homology types. This definition is provided at the Institute for Genomic
Research (TIGR) world wide web (www) website, "tigr.org" under the
heading "Terms associated with TIGRFAMs".
[0138]"Allelic variant" or "polynucleotide allelic variant" refers to any
of two or more alternative forms of a gene occupying the same chromosomal
locus. Allelic variation arises naturally through mutation, and may
result in phenotypic polymorphism within populations. Gene mutations may
be "silent" or may encode polypeptides having altered amino acid
sequence. "Allelic variant" and "polypeptide allelic variant" may also be
used with respect to polypeptides, and in this case the terms refer to a
polypeptide encoded by an allelic variant of a gene.
[0139]"Splice variant" or "polynucleotide splice variant" as used herein
refers to alternative forms of RNA transcribed from a gene. Splice
variation naturally occurs as a result of alternative sites being spliced
within a single transcribed RNA molecule or between separately
transcribed RNA molecules, and may result in several different forms of
mRNA transcribed from the same gene. This, splice variants may encode
polypeptides having different amino acid sequences, which may or may not
have similar functions in the organism. "Splice variant" or "polypeptide
splice variant" may also refer to a polypeptide encoded by a splice
variant of a transcribed mRNA.
[0140]As used herein, "polynucleotide variants" may also refer to
polynucleotide sequences that encode paralogs and orthologs of the
presently disclosed polypeptide sequences. "Polypeptide variants" may
refer to polypeptide sequences that are paralogs and orthologs of the
presently disclosed polypeptide sequences.
[0141]A native defense signal peptide or polypeptide sequence can be
modified by conventional methods, e.g., by acetylation, carboxylation,
phosphorylation, glycosylation, ubiquitination, and labeling, whether
accomplished by in vivo or in vitro enzymatic treatment or by the
synthesis of a defense signal peptide or polypeptide using modified amino
acids.
[0142]Labeling. There are a variety of conventional methods and reagents
for labeling polypeptides and fragments thereof. Typical labels include
radioactive isotopes, ligands or ligand receptors, fluorophores,
chemiluminescent agents, and enzymes. Methods for labeling and guidance
in the choice of labels appropriate for various purposes are discussed,
e.g., in Sambrook et al., 1989 and Ausubel et al., 1992.
[0143]Peptide Fragments. The present invention also encompasses fragments
of a defense signal peptide that lacks at least one residue of a native
full-length defense signal peptide. Preferably, such a fragment retains
substantial defense signal peptide activity, including but not limited to
substantial activity in an alkalinization assay and/or the ability to
enhance disease resistance in a plant.
[0144]"Defense Signal Peptide Activity", Biological activity of
Polypeptides or Peptides. The terms "biological activity", "biologically
active", "activity" and "active" refer primarily to the characteristic
biological activity or activities of a native defense signal peptide or
polypeptide. Defense signal peptide activity includes activity in an
alkalinization assay, as described herein. Substantial defense signal
peptide activity in an alkalinization assay includes a change of at least
0.2 pH units when a ten microliter aliquot of a solution having a
concentration of 25 nM of the peptide is added to one mL of plant cells
in the assay. More substantial defense signal peptide activity in the
assay is the observation of a change in pH of at least 0.2 pH units using
a solution having concentrations of 2.5 nM or 0.25 nM of the peptide, or
when a change of at least 0.5 pH units are observed at a given peptide
concentration, or when the activity is at least 25 percent, or 50
percent, or 75 percent that of a native defense signal polypeptide.
[0145]Alternatively, a substantial defense signal peptide activity is the
ability to enhance plant disease resistance and substantially improve
yield of plant product, with enhancement of plant disease resistance
evidenced by reduced disease symptoms, enhanced resistance to disease
infestation, etc., when a defense signal peptide is applied to a plant
exogenously or recombinantly expressed within a plant. A defense signal
peptide substantially enhances disease resistance of a plant if it
increases the resistance of a plant to a pathogen of at least 10 percent
as compared to a control plant under similar conditions, or more
substantially, of at least 25, or 50, or 75, or 100 percent, as measured
by standard quantitative measures of plant disease resistance to a given
pathogen, e.g., the number or size of lesions, increased growth, survival
rate, rate of disease progression, higher root mass, better seed
viability, seed quantity and quality, etc. Alternatively, a substantial
defense signal peptide activity is present where the peptide, when
applied to a plant exogenously or recombinantly expressed within a plant,
confers a substantial change in any resistance to a biotic or abiotic
stress that involves the jasmonate/ethylene or salicylic acid pathways,
as measured by standard methods.
[0146]Fusion Polypeptides. The present invention also provides fusion
polypeptides including, for example, heterologous fusion polypeptides in
which a defense signal polypeptide coding sequence is joined to a
heterologous promoter (i.e., a promoter from gene other than the promoter
that is operably linked to that coding sequence in nature), or in which
the coding sequence for the defense signal peptide is joined to a fusion
partner, i.e., a protein-coding sequence other than sequences with which
the coding sequence for the defense signal peptide is joined in nature).
Such fusion polypeptides can exhibit biological properties (such as
substrate or ligand binding, enzymatic activity, antigenic determinants,
etc.) derived from each of the fused sequences.
[0147]Polypeptide Sequence Determination. The sequence of a polypeptide of
the present invention can be determined by any of the various methods
known in the art.
[0148]Polypeptide Coupling to a Solid-Phase Support. The polypeptides of
the present invention can be free in solution or coupled to a solid-phase
support, e.g., nitrocellulose, nylon, column packing materials (e.g.,
Sepharose beads), magnetic beads, or glass wool, by conventional methods.
Antibodies
[0149]The present invention also encompasses polyclonal and/or monoclonal
antibodies capable of specifically binding to a particular defense signal
peptide and/or fragments thereof. Such antibodies are raised against a
defense signal peptide or fragment thereof and are capable of
distinguishing a defense signal peptide from other polypeptides, i.e.,
are specific for the particular defense signal peptide.
[0150]For the preparation and use of antibodies according to the present
invention, including various immunoassay techniques and applications,
see, e.g., Goding, Monoclonal Antibodies: Principles and Practice, 2d ed,
Academic Press, New York, 1986; and Harlow and Lane, Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor,
N.Y., 1988. Defense signal peptide-specific antibodies are useful, for
example in: purifying a defense signal peptide polypeptide from a
biological sample, such as a host cell expressing a recombinant defense
signal peptide; in cloning a paralog, ortholog, or homolog from an
expression library; as antibody probes for protein blots and
immunoassays; etc.
[0151]Antibodies can be labeled by any of a variety of conventional
methods. Suitable labels include, but are not limited to, radionuclides,
enzymes, substrates, cofactors, inhibitors, fluorescent agents,
chemiluminescent agents, magnetic particles, etc.
Obtaining Paralogs, Orthologs, and Homologs of Defense Signal Peptides
[0152]As discussed in the Examples below, defense signal peptides
homologous to AtPep1 and other defense signal peptides exist in many
plant species. Based upon the availability of the defense signal peptide
and polypeptide sequences and their corresponding gene sequences
disclosed herein, paralogs and orthologs can be obtained by conventional
methods, e.g., by screening a cDNA or genomic library with a probe that
specifically hybridizes to a native defense signal peptide sequence under
at least moderately stringent conditions, by PCR or another amplification
method using a primer or primers that specifically hybridize to a native
defense signal peptide or polypeptide sequence under at least moderately
stringent conditions, or by screening an expression library using defense
signal peptide-specific antibodies.
Plant Transformation and Regeneration; Transformed Plant Cells, Plants,
and Parts and Products of Transformed Plants
[0153]Various polynucleotide constructs that include a sequence that
encodes a defense signal polypeptide or a defense signal peptide are
useful for producing plants having enhanced disease resistance or
enhanced resistance to another biotic and abiotic stress that involves
the jasmonate/ethylene or salicylic acid pathways.
[0154]Polynucleotides that comprise a sequence that encodes a defense
related polypeptide or a defense related peptide can be expressed in
plants or plant cells under the control of an operably linked promoter
that is capable of expression in the plant or plant cell. Any well-known
method can be employed for plant cell transformation, culture, and
regeneration in the practice of the present invention with regard to a
particular plant species. Conventional methods for introduction of
foreign DNA into plant cells include, but are not limited to: (1)
Agrobacterium-mediated transformation (Lichtenstein and Fuller In:
Genetic Engineering, Vol 6, Rigby, ed., London, Academic Press, 1987; and
Lichtenstein and Draper, in: DNA Cloning, Vol II, Glover, ed., Oxford,
IRI Press, 1985); (2) particle delivery (see, e.g., Gordon-Kamm et al.,
Plant Cell 2:603, 1990; or BioRad Technical Bulletin 1687), (3)
microinjection (see, e.g., Green et al., Plant Tissue and Cell Culture,
Academic Press, New York, 1987), (4) polyethylene glycol (PEG) procedures
(see, e.g., Draper et al., Plant Cell Physiol. 23:451, 1982); Zhang and
Wu, Theor. Appl. Genet. 76:835, 1988), (5) liposome-mediated DNA uptake
(see, e.g., Freeman et al., Plant Cell Physiol. 25:1353, 1984), (6)
electroporation (see, e.g., Fromm et al., Nature 319:791, 1986); and (7)
vortexing method (see, e.g., Kindle, Proc. Natl. Acad. Sci. USA 87:1228,
1990).
[0155]Once a transformed plant cell or tissue has been obtained, it is
possible to regenerate a full-grown plant from it. Means for regeneration
vary from species to species. In one approach a suspension of transformed
protoplasts or a petri plate containing transformed explants is first
provided. Callus tissue is formed and shoots may be induced from callus
and subsequently rooted. Alternatively, embryo formation can be induced
in the callus tissue. These embryos germinate as natural embryos to form
plants. The culture media will generally contain various amino acids and
hormones, such as auxin and cytokinins. Efficient regeneration will
depend on the medium, on the genotype, and on the history of the culture.
If these three variables are controlled, then regeneration is usually
reproducible and repeatable. Plant regeneration is described, for
example, in Evans, et al., Handbook of Plant Cell Cultures, Vol. 1:
(MacMillan Publishing Co., New York, 1983); and Vasil I. R. (ed.), Cell
Culture and Somatic Cell Genetics of Plants, Acad. Press, Orlando, Vol.
I, 1984, and Vol. III, 1986). Practically all plants can be regenerated
from cultured cells or tissues, including monocots, dicots, gymnosperms,
etc.
[0156]After the DNA construct is stably incorporated in transgenic plants,
it can be transferred to other plants by sexual crosses or by asexual
propagation. With respect to sexual crossing, any of a number of standard
breeding techniques can be used depending upon the species to be crossed.
Cultivars can be propagated in accord with common agricultural procedures
known to those in the field.
[0157]The term "plant" encompasses any higher plant and progeny thereof,
including monocots, dicots, gymnosperms, and other plants and includes
parts of plants, including reproductive units of a plant (e.g., seeds),
fruit, flowers, etc.
[0158]A "reproductive unit" of a plant is any totipotent part or tissue of
the plant from which one can obtain a progeny of the plant, including,
for example, seeds, cuttings, tubers, buds,
bulbs, somatic embryos,
cultured cells (e.g., callus or suspension cultures), etc.
[0159]According to one aspect of the invention, plant cells are provided
that comprise a polynucleotide sequence that comprises a sequence that
encodes a defense signal peptide or polypeptide operably linked to a
plant promoter. Another aspect of the invention is directed to plants
comprising such cells, i.e., transformed or transgenic plants. Another
aspect of the invention is a part or product of such plants.
[0160]Agronomically and commercially important products and/or
compositions of matter derived from transgenic plants according to the
invention include, but are not limited to, animal feed, commodities,
products and by-products that are intended for use as food for human
consumption or for use in compositions and commodities that are intended
for human consumption, including but not limited to plant parts,
including but not limited to seeds, seed pods, flowers (including flower
buds), fruit, tubers, stems, cuttings, pollen, and products derived from
processing such plant parts, including but not limited to flour, meal,
syrup, oil, starch, cakes, cereals, and the like. Such compositions may
be defined as containing detectable amounts of a polynucleotide sequence
of the invention as set forth herein, and thus are also diagnostic for
any transgenic event containing such nucleotide sequences. These products
are more likely to be derived from crops propagated with fewer pesticides
and organophosphates as a result of their incorporation of the
nucleotides of the present invention for controlling plant disease. For
example, such commodities and commodity products can be produced from
seed produced from a transgenic plant, wherein the transgenic plant
comprises cells that express a defense signal protein of the present
invention.
Identifying Transgenic Plants According to the Invention and Parts and
Products thereof
[0161]Transgenic plants according to the present invention, parts of such
plants, and products derived from the processing of such plants, can be
readily identified by using probes and primers to specifically identify
the presence of a transgene that encodes a defense signal peptide or the
presence of a specific defense signal peptide. In order to perform such
an identification, a biological sample thought to contain such a plant,
part or product is contacted with a probe that binds specifically to the
transgene containing a defense signal peptide- or polypeptide-encoding
polynucleotide (such as one or more PCR primers, cDNA probe, etc.), and
detecting such binding (e.g., by identifying the production of an
amplification product of a diagnostic size after gel electrophoresis, or
by autoradiography). Alternatively, one may use a probe that binds
specifically to the defense signal peptide or polypeptide itself, such as
an antibody probe, wherein binding can be detected by an enzyme-linked
immunosorbent assay (ELISA), etc.).
Conferring Resistance to Biotic and Abiotic Stresses to Plants and
Enhancing Plant Growth
[0162]As one aspect of the invention, resistance to disease resistance, or
to another biotic and abiotic stress that involves the jasmonate/ethylene
pathway or the salicylic acid pathway, is conferred on a plant, or
resistance may be enhanced in the plant, or growth of the plant is
enhanced, by expression of polynucleotides that encode one or more
defense peptides in cells of the plant.
[0163]As another aspect of the invention, methods are provided that
comprise growing a seed into a plant, wherein the plant comprises cells
comprising a polynucleotide sequence comprising a sequence that encodes a
defense signal protein or polypeptide, wherein the plant exhibits one or
more of the following: improved yield of plant product, reduced disease
symptoms, or enhanced resistance to disease infestation; compared to a
control plant lacking the recombinant polynucleotide.
[0164]According to another aspect of the invention, improved yield,
reduced disease symptoms, or enhanced resistance to disease infestation
is conferred or enhanced, by application of compositions comprising one
or more defense signal peptides to a plant.
[0165]Where absolute immunity against infection by a pathogen or
detrimental affects or other stresses is not be conferred, the severity
of the disease is reduced and symptom development is delayed. This method
of imparting resistance has the potential for enhancing plant resistance
to a variety of diseases for which other approaches were ineffective in
providing effective control.
[0166]The methods of the present invention are useful in imparting
resistance to a wide variety of pathogens including viruses, bacteria,
and fungi. With regard to the use of the compositions and methods of the
present invention to enhance plant growth, various forms of plant growth
enhancement or promotion can be achieved. This can occur as early as when
plant growth begins from seeds or later in the life of a plant. For
example, plant growth according to the present invention encompasses
greater yield, increased percentage of seeds germinated, increased plant
size, greater biomass, more and bigger fruit, earlier fruit coloration,
earlier flower opening, improved flower longevity (i.e., shelf-life), and
earlier fruit and plant maturation. As a result, the present invention
provides significant economic benefit to growers. For example, early
germination and early maturation permit crops to be grown in areas where
short growing seasons would otherwise preclude their growth in that
locale. Increased percentage of seed germination results in improved crop
stands and more efficient seed use. Greater yield, increased size, and
enhanced biomass production allow greater revenue generation from a given
plot of land.
[0167]To confer such enhanced resistance, one may express a single gene
copy, or in order to express a defense signal peptide at high levels,
e.g., expression of multiple copies of a transgene encoding such a
defense signal peptide and/or the use of strong promoters to drive
expression may be employed. Expression of a transgene encoding a defense
signal peptide in plant cells at a sufficiently high level may initiate
the plant defense response constitutively in the absence of signals from
the pathogen. A constitutive plant promoter can be used. Alternatively,
an inducible promoter, or an organ- or tissue-specific promoter, for
example, can be used.
[0168]If a plant cell is selected to be transformed, it may be of any type
capable of being transformed, preferably one with an agronomic,
horticultural, ornamental, economic, or commercial value. Examples of
such plant cells include, but are not limited to: Acacia, alfalfa, aneth,
apple, apricot, artichoke, arugula, asparagus, avocado, banana, barley,
beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage,
canola, cantaloupe, carrot, cassaya, castorbean, cauliflower, celery,
cherry, chicory, cilantro, citrus, clementines, clover, coconut, coffee,
corn, cotton, cucumber, Douglas fir, eggplant, endive, escarole,
eucalyptus, fennel, figs, garlic, gourd, grape, grapefruit, honey dew,
jicama, kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine, linseed,
mango, melon, mushroom, nectarine, nut, oat, oil palm, oil seed rape,
okra, olive, onion, orange, an ornamental plant, palm, papaya, parsley,
parsnip, pea, peach, peanut, pear, pepper, persimmon, pine, pineapple,
plantain, plum, pomegranate, poplar, potato, pumpkin, quince, radiata
pine, radicchio, radish, rapeseed, raspberry, rice, rye, sorghum,
Southern pine, soybean, spinach, squash, strawberry, sugarbeet,
sugarcane, sunflower, sweet potato, sweetgum, tangerine, tea, tobacco,
tomato, triticale, turf grass, turnip, a vine, watermelon, wheat, yams,
and zucchini.
Compositions Comprising Defense Signal Peptides for Application to Plants
[0169]According to one embodiment of the invention, compositions for
application to plants comprise an oil flowable suspension, comprising
purified defense signal peptides or unpurified forms of the peptides,
including lysed or unlysed bacterial cells or fractions thereof that
contain one or more of the defense signal peptides disclosed herein. Any
such bacterial host cell expressing the novel polynucleotides disclosed
herein and producing a defense signal peptide is contemplated to be
useful, such as Bacillus spp., including B. thuringensis, B. megateriun,
B. subtilis; B. cereus, Escherichia spp., including E. coli, and/or
Pseudomonas spp., including P. cepacia, P. aeruginosa, and P.
fluorescens.
[0170]In another embodiment, compositions for application to plants
comprise a water dispersible granule or powder comprising purified or
unpurified defense signal peptides.
[0171]In another embodiment, compositions for application to plants
comprise a wettable powder, spray, emulsion, colloid, aqueous or organic
solution, dust, pellet, or colloidal concentrate comprising purified or
unpurified defense signal peptides. Such dry forms of the insecticidal
compositions may be formulated to dissolve immediately upon wetting, or
alternatively, dissolve in a controlled-release, sustained-release, or
other time-dependent manner. Alternatively, such a composition may
consist of a combination of one or more of the following compositions:
lysed or unlysed bacterial cells, spores, crystals, and/or purified
crystal proteins.
[0172]In another embodiment, compositions for application to plants
comprise an aqueous solution or suspension comprising purified or
unpurified defense signal peptides. Such aqueous solutions or suspensions
may be provided as a concentrated stock solution which is diluted prior
to application, or alternatively, as a diluted solution ready-to-apply.
[0173]Such compositions may be formulated in a variety of ways. They may
be employed as wettable powders, granules or dusts, by mixing with
various inert materials, such as inorganic minerals (phyllosilicates,
carbonates, sulfates, phosphates, and the like) or botanical materials
(powdered corncobs, rice hulls, walnut shells, and the like). The
formulations may include spreader-sticker adjuvants, stabilizing agents,
other pesticidal additives, or surfactants. Liquid formulations may be
aqueous-based or non-aqueous and employed as foams, suspensions,
emulsifiable concentrates, or the like. The ingredients may include
rheological agents, surfactants, emulsifiers, dispersants, or polymers.
Detergents may be included to facilitate uptake of the defense signal
peptides by plant tissues and cells.
[0174]Regardless of the method of application, the amount of the active
component(s) are applied at an amount that is effective to confer
enhanced disease resistance to plants, which will vary depending on such
factors as, for example, the specific disease to be controlled, the
specific plant or crop to be treated, the environmental conditions, and
the method, rate, and quantity of application of the composition.
[0175]Such compositions may be made by formulating purified or unpurified
defense signal peptides with the desired biologically-acceptable carrier.
The compositions may be formulated prior to administration in an
appropriate means such as lyophilized, freeze-dried, desiccated, or in an
aqueous carrier, medium or suitable diluent, such as saline or other
buffer, for example. The formulated compositions may be in the form of a
dust or granular material, or a suspension in oil (vegetable or mineral),
or water or oil/water emulsions, or as a wettable powder, or in
combination with any other carrier material suitable for agricultural
application. Suitable agricultural carriers can be solid or liquid and
are well known in the art.
[0176]The term "biologically-acceptable carrier" refers to all carriers
that are compatible with the growth and development of a cultured cell or
tissue, an excised plant part, a seed, a plant grown under greenhouse or
field conditions, or other biological entity, e.g., aqueous solutions,
buffers, adjuvants, etc. that are ordinarily used in connection with the
biological entity, including but not limited to any carrier used in
bacterial or plant cell or tissue culture and agriculturally-acceptable
carriers. The term "agriculturally-acceptable carrier" covers all
adjuvants, e.g., inert components, dispersants, surfactants, tackifiers,
binders, etc. that are ordinarily used in formulation technology for
compositions used in agriculture to be applied to plants, soils, etc. The
formulations may be mixed with one or more solid or liquid adjuvants and
prepared by various means, e.g., by homogeneously mixing, blending and/or
grinding.
[0177]Such compositions of this invention are applied to the environment
of the plant for uptake into plant tissues and cells, typically onto the
foliage of the plant or crop to be protected, by conventional methods,
such as by spraying. The strength and duration of application will be set
with regard to conditions specific to the particular pest(s), crop(s) to
be treated and particular environmental conditions. The proportional
ratio of active ingredient to carrier will naturally depend on the
chemical nature, solubility, and stability of the defense signal
protein(s), as well as the particular formulation contemplated.
[0178]Other application techniques, e.g., dusting, sprinkling, soaking,
soil injection, seed coating, seedling coating, spraying, aerating,
misting, atomizing, and the like, are also feasible and may be required
under certain circumstances.
[0179]The defense signal peptides of the invention may be employed in such
compositions singly, in a mixture of defense signal peptides, or in
combination with other compounds, including and not limited to other
proteins or chemical compounds used for treatment of plants, including
but not limited to proteins or chemical compounds used to treat plants
for pathogens, insect pests, etc. The method of the invention may also be
used in conjunction with other treatments such as surfactants,
detergents, polymers or time-release formulations.
[0180]The compositions of the present invention may be formulated for
either systemic or topical use. The concentration of insecticidal
composition which is used for environmental, systemic, or foliar
application will vary widely depending upon the nature of the particular
formulation, means of application, environmental conditions, and degree
of biocidal activity. Typically, the composition will be present in the
applied formulation at a concentration of at least about 0.1% by weight
and may be up to and including about 99% by weight. Dry formulations of
the compositions may be from about 0.1% to about 99% or more by weight of
the composition, while liquid formulations may generally comprise from
about 0.1% to about 99% or more of the active ingredient by weight.
[0181]The formulation may be administered to a particular plant or target
area in one or more applications as needed, with a typical field
application rate per hectare ranging on the order of from about 0.1 g to
about 1 kg, 2 kg, 5, kg, or more of active ingredient.
Identifying Defense Signal Proteins
[0182]According to one aspect of the invention, methods are provided for
identifying native defense signal peptides from plants and also for
screening synthetic peptides for defense signal peptide activity.
[0183]A sensitive, rapid "alkalinization assay" (see Examples) is useful
for isolate native defense signal peptides from plants or synthetic
defense signal peptides produced by chemical synthesis or other means.
Cultured plant cells, for example suspension cell cultures that grow at
about pH 5 are used. Several laboratories have developed such cell
cultures for Arabidopsis, tomato (Lycopersicon esculentum), tobacco
(Nicotiana tabacum), alfalfa (Medicago sativa), maize (Zea mays), petunia
(Petunia hybrida), nightshade (Solanum nigrum), and sweet potato (Ipomoea
batatus), for example. Within minutes after adding systemin to cells, an
ATP-driven proton pump is inhibited, causing the extracellular medium of
the cells to become alkaline. When 1-10 .mu.L aliquots from fractions
from plant tissues, e.g., leaves, that have eluted from HPLC columns were
added to 1 mL of suspension cultured cells, some fractions caused the
cell medium to increase in pH. In order to confirm that a candidate
peptide is a defense signal peptide, the peptide is applied to a plant as
described in the Examples below or a polynucleotide sequence encoding the
candidate peptide is expressed in a plant in order to observe whether
disease resistance is enhanced in the plant. Confirmation of the identity
of a candidate peptide may be obtained by determining whether the peptide
induces defense gene expression (for example, of PDF1.2 and PR-1), e.g.,
by supplying a solution of the peptide to excised leaves through their
cut petioles then analyzing transcript levels, e.g., by semi-quantitative
RT-PCR.
Identifying Compounds that Interact with Receptors for Defense Signal
Proteins and that Enhance Plant Disease Resistance
[0184]According to another aspect of the invention, substances other than
peptides and polypeptides, for example, chemical compounds, are screened
for their ability to enhance plant defense against diseases. In one
approach, the alkalinization assay is used to screen such substances.
Candidate substances are added to cultured plant cells and a rise in pH
indicates that a candidate substance interacts with a receptor. In a
second approach, candidate substances are assayed for binding by an
AtPep1 receptor or another receptor for a defense signal peptide. A
composition comprising one or more candidate substances that are selected
after being screened in an alkalinization assay or receptor binding assay
may then be administered to plants in a greenhouse or field trial to
assess whether the candidate substance(s) confer enhanced plant defense
against a disease. Substances that have activity in conferring enhanced
plant defense may be formulated according to standard formulation
approaches for application to plants, to seeds, to the
soil, etc. The
present invention also includes compositions comprising an amount of such
substances that is effective to enhance plant defense against a disease
and a biologically (including agriculturally) compatible carrier. Such
compositions may also include other ingredients that are used in
formulations for application to plants as detailed above.
[0185]The invention will be better understood by reference to the
following Examples, which are intended to merely illustrate the best mode
now known for practicing the invention. The scope of the invention is not
to be considered limited thereto.
EXAMPLE 1
Isolation and Analysis of AtPep1 and Paralogs and Orthologs thereof
[0186]Innate immunity is initiated in animals and plants through the
recognition of a variety of pathogen associated molecules that in animals
are called "pathogen-associated molecular patterns," or PAMPS, and in
plants are called elicitors. Peptides derived from pathogens can be
powerful elicitors of plant defense responses (Hahlbrock et al., Proc.
Natl. Acad. Sci. USA 92:4150-4157, 1995; van den Askerveken et al., Plant
Physiol. 103:91-96, 1993; Kammpren, Curr. Opin. Plant Biol. 4:295-300,
2001; Kunze et al., Plant Cell, 16:3496-3507, 2004; Navarro et al., Plant
Physiol. 135:1113-1128, 2004; Fellbrich et al., Plant J. 32:375-390,
2002; He et al., Cell 73:1255-1266, 1993), but plant-derived peptides
have not been identified previously that are elicitors of immune
responses directed against pathogens.
[0187]We have isolated and characterized a 23 amino acid peptide, called
AtPep1, that is a signaling component of the innate immune system of
Arabidopsis. The peptide precursor gene is transcribed in response to
elicitors generated by pathogens, and AtPep1 is produced to amplify the
signaling pathways. Seven paralogs of the AtproPep1 gene are present in
the Arabidopsis genome, and orthologs have been identified in species of
several agriculturally important families including Solanaceae, Poaceae,
Salicaceae, Vitaceae, and Fabaceae. AtPep1 and its paralogs and orthologs
play important roles as endogenous signals to amplify innate immunity.
Materials and Methods
[0188]Plant growth conditions. Arabidopsis thaliana ecotype Columbia seeds
were grown in soil in four-inch square pots for six days under low light
at approximately 18.degree. C. Germinated seedlings were then grown under
day lengths of 16 hours at 21.degree. C. Mutant plants were grown in
autoclaved soil.
[0189]Alkalinization Assay. Arabidopsis suspension cells were grown with
shaking in the dark in 125 mL flasks, using 40 mL NT media as previously
described (Pearce et al., Proc. Natl. Acad. Sci. USA 98:12843-12847,
2001). The cells were transferred weekly (2.5 mL) and used for assays 3-5
days after transfer. One mL aliquots of cells were transferred to wells
of 24-well culture plates and allowed to equilibrate for one hour while
agitated on a rotary shaker at 160 rpm. Aliquots of 1-10 .mu.L from
extracts or fractions eluted from HPLC columns were added to cells and
the pH of the media was monitored after 20 min.
[0190]Purification of AtPep1. Arabidopsis thaliana (Columbia ecotype), 28
days after planting, consisting of rosettes, flowers, stems and seed
pods, were harvested, frozen in liquid nitrogen, ground to a powder, and
stored at -20.degree. C. Peptides were extracted from 600 g of powder as
previously described (Pearce et al., Nature 411:817-820, 2001; Pearce and
Ryan, J. Biol. Chem. 278:30044-30050, 2003), using 1200 mL 1%
trifluoroacetic acid (TFA). The clear extract was applied to a
reversed-phase C18 flash column (Bondesil, Varian Analytical Instruments,
Walnut Creek, Calif.) that was equilibrated with 0.1% TFA/H.sub.2O. After
washing with equilibration buffer, the column was eluted with 50%
methanol/0.1% TFA. The eluate was vacuum-evaporated and lyophilized to
dryness. This material was dissolved in 0.1% TFA and chromatographed on a
G-25 Sephadex column (2.5.times.33 cm), and the fractions were monitored
with the alkalinization assay. The broad peak of activity that eluted
between 1-1.5 void volumes was collected and lyophilized. The yield of
dry powder was 109 mgs.
[0191]Two hundred forty mg of the powder was dissolved in 9 mL of 0.1%
TFA/H.sub.2O, centrifuged, and the clarified solution was applied to a 5
micron, 10.times.250 mm semi-preparative C18 column (#218TP510, Vydac,
Hesperia, Calif.) with a flow rate of 2 ml/min and monitored at 225 nm.
After 2 min, a gradient from 0-40% acetonitrile/0.1% TFA was applied to
the column and 1 min fractions were collected and assayed as above. A
defined activity peak was identified in fractions 36-37 and designated
Arabidopsis Peptide 1 (AtPep1). AtPep1 was further purified by strong
cation exchange chromatography on a 5 .mu.m, 4.6.times.200 mm
PolySulfoethyl Aspartamide.TM. column (The Nest Group, Southborough,
Mass.) equilibrated with 5 mM potassium phosphate, pH 3, in 25%
acetonitrile. Two min after applying AtPep1 to the column, a gradient of
0-100% elution buffer consisting of 5 mM potassium phosphate, 1 M
potassium chloride, pH 3, in 25% acetonitrile was applied for 60 min.
Absorbance was monitored at 214 nm and the flow rate was 1 mL/min.
Fractions were collected at minute intervals and 10 .mu.L aliquots were
assayed for alkalinization activity. The fractions with activity, 58 and
59, were pooled and lyophilized. Further purification of AtPep1 was
performed on a narrow-bore reversed-phase 218TP52, 5 .mu.m, 2.1.times.250
mm C18 column (Vydac, Hesperia, Calif.) that had been equilibrated with
0.1% TFA/H.sub.20. The lyophilized material was dissolved in the
equilibration buffer and applied to the column. After two min, a gradient
of 0-50% acetonitrile in 0.1% TFA was applied over 90 min with a flow
rate of 0.25 mL/min, and monitored at 214 nm. Fractions were collected at
1 min intervals and assayed as above. The activity was present in
fractions 48-50, which were pooled and lyophilized. Further purification
was obtained on the same narrow-bore column but using a 0-50%
methanol/0.05% TFA gradient over 90 min for elution. The activity was
found exclusively in fractions 63-64. These fractions were pooled and
subjected to amino acid sequence analysis and MALDI-mass spectroscopy.
[0192]Peptide sequence analysis and synthesis. N-terminal sequence
analysis was performed using Edman chemistry on an Applied Biosystems
Procise Model 492 protein sequencer. MALDI-mass spectroscopy was
performed on a PerSeptive Biosystems Voyager time-of-flight mass
spectrometer equipped with a nitrogen laser (337 nm) with
.alpha.-cyano-4-hydroxycinnamic acid as the matrix. Peptide synthesis was
performed using Fmoc (N-(9-fluorenyl)methoxycarbonyl) chemistry by solid
phase techniques using an Applied Biosystems Model 431 synthesizer.
Synthetic peptides were purified by reversed-phase C18 HPLC. Peptide
stocks (250 .mu.M) were assayed for purity and the mass verified with a
Finnigan LC/Q mass spectrometer using direct injection.
[0193]Plant stress and hormone treatments. To examine effects of cold
stress, plants were placed in a refrigerated growth chamber set to
2.degree. C. To simulate drought stress conditions, plants grown under
standard growth chamber conditions were grown without watering. Methyl
jasmonate (Bedoukian Research Inc., Danbury Conn.) was applied as a 625
.mu.M solution in 0.1% Triton X-100 to the upper surface of leaves and
the plants were incubated in plexiglass boxes. Methyl salicylate
(Sigma-Aldrich, St. Louis Mo.), was applied to leaf surfaces at 2 mM in a
0.1% Triton X-100 solution. Ethephon (Phytotechnology Laboratories,
Shawnee Mission Kans.) was sprayed on plants as a 7 mM solution in 0.1%
Triton X-100 (Sigma-Aldrich, St. Louis Mo.). ABA effects were analyzed by
spraying plants with a 100 .mu.M solution (mixed isomer, Sigma-Aldrich,
St. Louis Mo.) in 0.1% Triton X-100 (Denekamp and Smeekens, Plant
Physiol. 132, 1415-1423, 2003).
[0194]Excised-leaf assays. AtPep1 peptide dissolved in double distilled
water was supplied to excised leaves of 3 to 4 week old Arabidopsis
plants. Leaves were excised and the petioles were immersed in 800 .mu.L
centrifuge tubes containing either the peptide solution or distilled
water, and placed in a closed clear plexiglass box containing a thin
layer of water for humidity, and a small opening to allow air to enter.
Boxes were incubated in a growth chamber under the plant growth
conditions described above and sprayed with a fine mist of distilled
water every half hour to ensure humidity and prevent wilting. To
determine variations in basal levels of the AtproPep1 transcript among
assays, four different leaves from four different plants were used for
each treatment, and leaves supplied with either water or AtPep1 were
taken from the same plants. Assays were terminated by immersing the
leaves in liquid nitrogen.
[0195]Hydrogen peroxide accumulation was visualized using diaminobenzidine
(DAB) (Thordal-Christensen et al., Plant J. 11:1187-1194, 1997).
[0196]Semi-quantitative RT-PCR analysis of relative gene expression
levels. RNA was isolated using Trizol reagent and manufacturer's
instructions (Invitrogen, Carlsbad Calif.), and 2 .mu.g of RNA template
was reverse transcribed with a RETROscript kit (Ambion, Austin Tex.). PCR
reactions were carried out with ExTaq Hot Start polymerase and reagents
(Fisher Scientific, Pittsburgh Pa.). The AtproPep1 forward and reverse
primers with the respective sequences of 5' CTT ATC AGA TCT CAA TGG AGA
AAT C3' and 5' CAA TGT AAC TTA AAG TGC CTA ATT ATG 3' generated a 310 bp
intron-spanning product. Primers to .beta.-tubulin (At5g62690) of 5' CAA
CGC TAC TCT GTC TGT CC 3' and 5' TCT GTG AAT TCC ATC TCG TC 3' generated
a 681 base pair intron-spanning product. An initial denaturing/polymerase
activating step of 5 minutes at 94.degree. C. was followed by 31
repetitions of the following three steps: a thirty second denaturation
phase at 94.degree. C., a thirty second annealing period at 55.5.degree.
C., and a one minute elongation step at 72.degree. C. The amplification
program was terminated with a ten minute final 72.degree. C. elongation
phase.
[0197]The products of each reaction were separated by electrophoresis and
were visualized on a Bio Imaging System (SynGene, Frederick Md.) using
GeneSnap version 6.00.26 software (SynGene, Frederick Md.). A high
resolution image of the gel was analyzed using GeneTools analysis
software version 3.02.00 (SynGene, Frederick Md.). Relative band
intensities for each band were normalized to the .beta.-tubulin band. A
numerical ratio of amplified AtproPep1 cDNA to amplified tubulin cDNA was
obtained for every sample. To calculate average values, semi-quantitative
RT-PCR assays were performed in duplicate, and RNA extractions were
performed in triplicate.
[0198]Transformation of Arabidopsis with a CaMV 35S:proAtPep1 gene.
Genomic DNA was isolated from Arabidopsis leaves using the DNAzol reagent
(Invitrogen, Carlsbad Calif.). The genomic sequence encoding AtproPep1
was amplified using a forward primer 5' ATA AAG AGT CAC ACC CAA TAC CG 3'
and a reverse primer 5' TGA TAC TGG TTA TGA ACT TAT GAT GG 3' to generate
a 1078 base pair product. A 5' Xho I recognition site and a 3' BamH I
site were amplified onto the genomic fragment for ligation into the
pART-7 vector (Gleave, Plant Mol. Biol. 20:1203-1207, 1992). Both the
proAtPep1 genomic product and the pART-7 vector were digested with BamH I
and Xho I enzymes (Promega Biosciences Inc., San Luis Obispo Calif.), and
ligated using the LigaFast rapid DNA ligation system (Promega Biosciences
Inc., San Luis Obispo Calif.). The construct was transformed into
chemically-competent E. coli TOP 10F' cells (Invitrogen, Carlsbad Calif.)
that were plated out on LB-ampicillin (50 .mu.g/mL). A plasmid clone
containing the full AtproPep1 genomic DNA insert with no nucleotide
errors was used to generate an AtproPep1/pBART construct. Both pBART and
AprotPep1/PART-7 plasmid were digested with Not I (Promega Biosciences
Inc., San Luis Obispo Calif.) to enable ligation of the CaMV
35S/AtproPep1 expression cassette into the digested pBART plasmid using
the Promega LigaFast kit (Promega Biosciences Inc., San Luis Obispo
Calif.). An empty pART-7 vector was digested with Not I to generate a
control pBART construct. TOP 10F' chemically competent cells were
transformed with the constructs and grown in Luria-Berftani media
containing 100 .mu.g/mL spectinomycin (Sigma-Aldrich, St. Louis Mo.), 40
.mu.L of a 40 mg/mL solution of X-Gal (Sigma-Aldrich, St. Louis Mo.) and
40 .mu.L of a 100 mM IPTG (Sigma-Aldrich, St. Louis Mo.) stock. A pBART
clone containing the CaMV 35S/proAtPep1 construct, and a second clone
containing the empty CaMV 35S construct, were transformed into
Agrobacterium tumefaciens strain AGLO cells (Lazo and Ludwig,
Biotechnology (NY) 9:963-967, 1991) by electroporation using a BioRad
electroporator (BioRad Laboratories, Hercules, Calif.). The transformed
cells were grown on 2XYT media (Lazo et al., Biotechnology (NY)
9:963-967, 1991) containing 100 .mu.g/mL spectinomycin, and viable
colonies were screened using RT-PCR with the pART F and pART R primers.
[0199]Liquid cultures of Agrobacterium carrying the CaMV 35S:AtproPep1 or
empty CaMV 35S constructs were grown in 2XYT media and used for floral
dip transformation of Arabidopsis plants (Clough and Bent, Plant J.
16:735-743, 1998). Transformed plants were grown to maturity, and the
seed was collected and planted. Newly germinated seedlings were treated
with a 350 .mu.M solution of the herbicide BASTA (glufosinate ammonium,
brand name Finale; Farnam Companies Inc., Phoenix Ariz.) four times at
three day intervals, and healthy plants were screened for the proAtPep1
transgene via PCR. Plants that were both glufosinate-resistant and that
amplified products of the appropriate size were grown to maturity and the
seeds planted to recover T2 progeny.
[0200]Growth and inoculation of plants with Pythium irregulare. Two
strains of the oomycete root pathogen Pythium irregulare, strain 110305)
were grown on water-agar (1%) plates for maintenance of stock cultures
and, after growing at room temperature in the dark for one week, were
stored at 4.degree. C. Pythium stocks for infection assays were grown on
1.times. potato dextrose agar (Sigma-Aldrich, St. Louis Mo.) in the dark
for one week at room temperature.
[0201]Week-old P. irregulare cultures were scraped from the plates into 20
mL of sterile distilled water, the mixture was lightly ground with a
mortar and pestle to produce a uniform suspension. Aliquots (250 .mu.L)
of the suspension or water were pipetted into the soil of plants having a
rosette diameter of 2-3 cm. Plants were grown for 25 days as described
above and assayed. The experiments were repeated five times. After two
and a half weeks, the plants were photographed to show rosette
morphology, and at three and a half weeks were harvested and the roots
examined. The day prior to harvest, plants were not watered, so that the
soil would easily separate from the roots. Soil was gently rinsed from
the roots of each plant with water, taking care to minimize damage, and
each plant was trimmed at the base of the rosette to fully expose the
root structure, and photographed.
[0202]Identification the AtproPep1 gene and homologous genes. The gene
locus encoding the AtPep1 peptide precursor was identified using the
National Center for Biotechnology Information (NCBI) TBLASTN version
2.2.7 algorithm (Altschul et al., Nucleic Acids Res. 25:3389-3402, 1997)
to search genomic sequences from Arabidopsis thaliana. To determine
possible localization of the protein in the cell, several predictive
programs were employed, including pSORT (Nakai and Kanehisa, Proteins
11:95-110, 1991), ChloroP41 and MitoProt (Emanuelsson et al., J. Mol.
Biol. 300:1005-1016, 2000; Emanuelsson et al., Prot. Sci. 8:978-984,
1999). Orthologs to the AtproPep1 gene were identified using the NCBI
TBLASTN version 2.2.7 and Institute of Genomic Research (TIGR) TBLASTN
2.0 MP algorithms (Gish, TBLASTN 2.0 MP-WashU [27 Aug. 2000] [linux-i686
21:46:47 28 Aug. 2000] Copyright 1996-2000 Washington University, Saint
Louis, Mo. USA. [http://blast.wust1.edu]). The predicted protein sequence
for each was aligned using the program Clustal W version 1.8, available
at the Baylor College of Medicine Search Launcher website.
[0203]Analysis of gene expression using RT-PCR. Gene expression was
analyzed using RT-PCR (Nishimura et al., Plant Cell 16:1365-1377, 2004).
Forward and reverse primers used for RT-PCR analysis are shown in Table
4.
Results
[0204]We have isolated a 23 amino acid peptide called AtPep1 from extracts
of Arabidopsis leaves that exhibits characteristics of an elicitor of the
innate immune response. Endogenous peptide elicitors of innate immunity
have not been previously known. The identification and isolation of the
peptide from soluble extracts of Arabidopsis leaves was facilitated by
its ability, at sub-nanomolar concentrations, to cause an alkalinization
response that is typical of elicitors (Moyen and Johannes, Plant Cell
Environ. 19:464-470, 1996; Felix and Boller, Plant J. 7:381-389, 1999;
Pearce et al., Proc. Natl. Acad. Sci. USA 98:12843-12847, 2001; Pearce et
al., Nature 411:817-820, 2001; Pearce and Ryan, J. Biol. Chem.
278:30044-30050, 2003).
[0205]A bioactive component, AtPep1, was identified and purified to
homogeneity. Peptides present in a 1% TFA/water extract of Arabidopsis
tissues were passed through a reverse phase semi-preparative C18 flash
chromatography column and separated on a G-25 Sepharose column. The
breakthrough peak was applied to a C18 HPLC column and 10 .mu.L from 2 mL
fractions from the column were assayed for alkalinization activity. The
peak identified as AtPep1 was further purified through two additional
chromatography steps and finally purified by narrow bore HPLC. Fractions
were assayed for alkalinization activity and the active peak was analyzed
by MALDI mass spectroscopy. The amino acid sequence of the purified
peptide was determined by Edman degradation. Its identity as a peptide
was established by its molecular mass (M/Z, 2492.65) and amino acid
sequence (from amino terminus to carboxy terminus,
ATKVKAKQRGKEKVSSGRPGQHN (see Table 1) with a calculated molecular mass of
2491.8). The kD determined by mass spectroscopy matched the kD calculated
from the amino acid sequence, indicating that the peptide was not
post-translationally modified. The chemically synthesized peptide was
found to be as active as the native AtPep1, with a 1/2 maximal activity
of 0.25 nM.
[0206]The sequence of AtPep1 was identified in GenBank as being derived
from the accession At5g64900, which encodes a small protein of 92 amino
acids, with its C-terminal 23 amino acids comprising AtPep1. FIG. 1 shows
the amino acid sequence of the AtPep1 precursor protein, AtproPep1,
deduced from the protein encoded by the gene At5g64900. The AtPep1
sequence at the carboxyl terminus of the precursor protein, is
underlined. The amino acid sequence of the precursor protein is highly
charged and lacks a leader sequence, indicating that it is not
synthesized through the secretory pathway, but rather on cytoplasmic
ribosomes.
[0207]Expression analysis of AtproPep1 in response to abiotic and biotic
cues. As a first step in seeking a possible function for AtproPep1 and
its encoded peptide, the basal expression level of the gene was assessed
in leaves, stems, roots and flowers of Arabidopsis plants was studied
using semi-quantitative RT-PCR analysis of AtproPep1 gene expression in
response to treatment of leaves with MeJA, ethephon, MeSA, and AtPep1.
The relative abundance of the proAtPep1 transcript was estimated from the
expression of the .beta.-tubulin gene as a control. Leaves were wounded
by crushing once across the mid-vein with a hemostat. Plants were sprayed
with a 250 .mu.M solution of MeJA in 0.1% Triton X-100; with a 2 .mu.M
solution of MeSA in 0.1% Triton X-100 or with a 7 mM solution of ethephon
in 0.1% Triton X-100. AtPep1 peptide (10 nM in water) was supplied
through cut petioles of excised leaves. Total RNA was extracted and
analyzed. The forward and reverse primers for real-time PCR (RT-PCR)
analysis are shown in Table 4 below.
TABLE-US-00004
TABLE 4
RT-PCR primers
Gene Primers Product size
AtproPep1 5' CTTATCAGATCTCAATGGAGAAATC 3' (F*) 310 bp
(At5g64900) 5' CAATGTAACTTAAAGTGCCTAATTATG 3' (R)
PDF1.2 5' ATGGCTAAGTTTGCTTCCA 3' (F) 243 bp
(At5g44420) 5' TTAACATGGGACGTAACAGATAC 3' (R)
PR-1 5' GGAGCTACGCAGAACAACTA 3' (F) 306 bp
(At2g14610) 5' AGTATGGCTTCTCGTTCACA 3' (R)
TAT3 5' TACAGGGGTAGTTCAAGCAA 3' (F) 330 bp
(At2g24850) 5' CCTAGAGCCACTCCTGGTAT 3' (R)
LOX2 5' ACGGTAGAAGACTACGCACA 3' (F) 312 bp
(At3g45140) 5' TAAGGTCTCGAGCTCCTCTT 3' (R)
VSP2 5' CAAAATATGGATACGGGACA 3' (F) 317 bp
(At5g24770) 5' ATTGCCAACGATGTTGTATC 3' (R)
ATTI3 5' TGGCAATGAAGTCAGTTTCT 3' (F) 231 bp
(At2g43530) 5' AGAAGTCGCAGAAGCACTTA 3' (R)
.beta.-tubulin 5' CAACGCTACTCTGTCTGTCC 3' (F) 681 bp
(At5g62690) 5' TCTGTGAATTCCATCTCGTC 3' (R)
*F = Forward primers; R = Reverse primers.
[0208]The AtproPep1 gene was expressed at low levels in all tissues,
giving no clues as to its possible function. Monitoring the expression of
AtproPep1 in intact plants exposed to different environmental conditions
and chemicals, including drought and cold stress, UV-B irradiation,
wounding, methyl jasmonate (MeJA), methyl salicylate (MeSA), abscissic
acid (ABA) and ethephon.RTM., provided more definitive clues. Whereas
most treatments did not cause changes in expression of AtproPep,
wounding, MeJA, ethephon, and AtPep1 all induced expression of AtproPep1,
indicating a possible relationship of the gene and its encoded peptide in
plant defense. Transcription of the gene in response to wounding was
detected within about 8 h, whereas spraying the plants with a 250 .mu.M
solution of MeJA or 7 mM ethephon induced a strong expression of the gene
within an hour. Supplying 10 nM AtPep1 through cut petioles of excised
leaves induced expression of the AtproPep1 gene within two hours.
[0209]AtPep1 regulates transcription of pathogen defense genes. The
expression of AtproPep1 in response to MeJA and ethylene (Et) suggested
that the encoded peptide might have a role in activating innate immunity
in Arabidopsis, although an endogenous peptide had not previously been
reported in the innate immune system of any plant. The jasmonic acid
(JA)/Et signaling pathway in Arabidopsis activates the expression of
defensive genes including PDF1.2 (defensin), while the salicylic acid
(SA) pathway activates several pathogen-related (PR) genes (Penninckx et
al., Plant Cell 8:2309-2323, 1996; Lorenzo et al., Plant Cell 15:165-178,
2003; Zimmerli et al., Plant J. 40:633-646, 2004; Penninckx et al., Plant
Cell 10:2103-2113, 1998; Hammond-Kosack and Parker, Curr. Opin.
Biotechnol. 14:177-193, 2003; Mauch-Mass and Matreau, Ann. Bot.
82:535-540, 1998).
[0210]In order to determine whether AtPep1 regulates defense gene
expression, we determined the fold induction of defense related genes in
excised Arabidopsis leaves in response to 10 nM AtPep1 supplied through
their cut petioles. After 2 hr, transcript levels were analyzed for
expression levels of PDF1.2 (defensin), PR-1 (pathogenesis-related 1)
LOX2 (lipoxygenase 2), VSP2 (vegetative storage protein 2) and ATTI3
(Arabidopsis thaliana trypsin inhibitor 3), relative to levels in
untreated excised leaves. Expression was determined by semi-quantitative
RT-PCR using a P-tubulin gene as a control. Supplying excised Arabidopsis
leaves with solutions of AtPep1 through their cut petioles induced a
strong expression of PDF1.2 and PR-1.
[0211]We also performed similar assays with an Arabidopsis triple mutant
(fad3-2, fad7-2, fad8; McConn and Browse, Plant Cell 8:403-416, 1996)
that is incapable of synthesizing jasmonic acid, and a mutant (ein2-1;
Guzman and Ecker, Plant Cell 2:513-523, 1990) that is incapable of
perceiving ethylene. AtPep1 was supplied at 10 nM for 2 hr, and RNA
isolated and assayed by semi-quantitative RT-PCR for gene expression
levels. AtPep1 did not induce the expression of AtproPep1, PDF1.2 or
PR-1. These experiments suggested that AtPep1 acts upstream from the
JA/Et and SA pathways to activate PDF1.2, PR-1 and AtproPep1.
[0212]We also studied the accumulation of H.sub.2O.sub.2 in leaves
supplied for 2 hr with water, 10 nM AtPep1, or with 10 nM AtPep1, all
containing 1 mg/mL of DAB to visualize H.sub.2O.sub.2 accumulation.
Leaves treated with AtPep1 and DAB were also co-supplied with 100 .mu.M
DPI, an inhibitor of NADPH oxidase. We also studied the transcription of
PDF1.2 and PR-1 in leaves of wild-type plants in response to supplying
with 10 nM AtPep1 in the presence or absence of DPI (diphenylene iodonium
chloride), an inhibitor of NADPH oxidase in both plants and animals
(O'Donnell et al., Biochem. J. 290:41-49, 1993). The expression of each
gene was analyzed by RT-PCR and compared to expression in excised plants
treated only with water. The results indicated that reactive oxygen
species (ROS) generated in both the JA/Et and SA pathways is required for
PDF1.2 and PR-1 transcription (Penninckx et al., Plant Cell 8:2309-2323,
1996; Hammond-Kosack and Parker, Curr. Opin. Biotechnol. 14:177-193,
2003; Mackerness et al., Plant Cell and Environ. 22:1413-1423, 1999).
[0213]AtproPep1 over-expression in Arabidopsis enhances innate immunity.
Arabidopsis plants were transformed with a CaMV-358-AtproPep1 transgene
in order to assess the effects of the constitutive synthesis of AtPep1 on
the expression of defense genes using semi-quantitative RT-PCR. In
previous studies, overexpression of the tomato prosystemin precursor gene
(McGurl et al., Proc. Natl. Acad. Sci. USA 91:9799-9802, 1994) caused a
constitutive over-expression of defense genes. This is apparently due to
the constitutive synthesis of prosystemin in the cytoplasm of cells
(prosystemin, like AtproPep1, lacks a leader sequence) where it is
processed to systemin. Analysis of transgenic Arabidopsis plants
overexpressing AtproPep1 behaved in a similar manner as the prosystemin
gene in that it caused an over-expression of defense genes, in this case
of PDF1.2 and PR-1. The fold expression of the various genes (compared to
wild-type) was found to be: AtproPep1, 12.7.+-.6.4; PDF1.2, 4.4.+-.0.5;
PR-1, 2.1.+-.0.4; LOX2, 1.0.+-.0.2; VSP-2, 0.9.+-.0.1; and ATTI3,
1.2.+-.0.1. These results indicated that plants over-expressing AtproPep1
were synthesizing AtPep1 in the absence of pathogen attacks or elicitors,
constitutively signaling the defense response.
[0214]Transgenic Arabidopsis plants constitutively over-expressing
AtproPep1 were assayed for enhanced resistance against a root pathogen,
Pythium irregulare, an oomycete that has been employed previously to
demonstrate the effects of signaling mutants of Arabidopsis on disease
resistance (Staswick et al., Plant J. 15:747-754, 1998; Vijayan et al.,
Proc. Natl. Acad. Sci. USA 95:7209-7214, 1998). The soils of young wild
type (Columbia) and transgenic plants overexpressing a 35S:AtproPep1 gene
(having rosette diameters of 2-3 cm) were inoculated with either a
suspension of Pythium irregulare strain 110305 propagules, or with
sterile water, and the plants were grown for 25 days post-inoculation.
Five repetitions were performed with 16 plants of each genotype in each
experiment. The aerial parts of the wild-type plants inoculated with
Pythium were slightly smaller than uninoculated wild-type or transgenic
plants. However, the roots of plants from duplicate experiments in which
the root masses of uninoculated wild-type and transgenic plants are
compared to the roots of inoculated wild-type and transgenic plants
clearly showed that the over-expression of AtproPep1 had enhanced the
resistance of the plants toward the root pathogen.
[0215]AtProPep1 paralogs. AtproPep1 belongs to a seven-member gene family
in Arabidopsis of which one gene is unannotated. Three paralogs,
At5g64890, At5g64900 (AtproPep1), and At5g64905, are sequentially encoded
in a 5.5 kilobase region of chromosome V (NCBI Arabidopsis Genome
Database). Paralogs At5g09980 and At5g09990 and the unannotated gene are
also found on chromosome V, but in a 3.8 kb region at a distal region on
the second arm of the chromosome. At2g22000 is found on chromosome II. In
comparing the amino acid sequences of the open reading frames of the
paralogs, a low overall amino acid sequence identity was found, but
within the C-terminal region of each gene where the putative AtPep1
sequences reside, the amino acid identities ranged from 35% to 65%. Four
genes, At5g64905, At5g64900, At5g64890 and At5g09980, are expressed
relatively strongly in excised Arabidopsis leaves in response to
supplying either AtPep1 through cut petioles, or by spraying with MeJA.
However, spraying plants with MeSA strongly induced only two of the genes
that are induced by AtPep1 and MeJA, i.e. At5g64890 and At5g64905. This
differential regulation of AtproPep1 paralogs suggests that a complex
signaling network is at play in the leaves, and that cross-talk occurs
between the JA/Et and SA pathways, regulating the expression levels of
the paralogs. This differential expression of AtproPep1 paralogs was also
found in the results from several recent microarray analyses of
Arabidopsis genes transcribed in response to pathogens and elicitors. In
these analyses the AtproPep1 paralogs were included without any knowledge
of their possible signaling roles.
[0216]We performed a transcript analysis in order to determine the
increases in transcription of AtproPep1 paralogs in Arabidopsis leaves in
response to the pathogens P. infestans (oomycete), B. cineria (fungus),
and Ps. syringae DC 3000 (bacteria) (Toufighi et al., Plant J.
43:153-163, 2005; Craigon et al., Nucleic Acids Res. 32:D575-577, 2004),
and to the elicitors NPP1, HrpZ, flg22, and elf18, derived from
oomycetes, and bacteria, respectively (Kammpren, Curr. Opin. Plant Biol.
4:295-300, 2001; Kunze et al., Plant Cell, 16:3496-3507, 2004; Navarro et
al., Plant Physiol. 135:1113-1128, 2004; Fellbrich et al., Plant J.
32:375-390, 2002); He et al., Cell 73:1255-1266, 1993). All of these
treatments strongly induce the transcription of At5g64890 and At5g64905,
the two paralogs that are strongly induced by treating leaves with MeJA,
MeSA and AtPep1. However, the lack of induction of At5g64900 by the
pathogens, a gene induced by MeJA and AtPep1, and the induction of
At5g64900, At5g64890 and At5g64905 by elicitors as well as by the
pathogens, indicates that differential induction of the AtproPep family
of genes may be governed by the types of elicitors related to individual
pathogens. The data presented herein supports a model in which the
paralogs At5g64900, At5g64905, and At5g64890 are transcribed in response
to elicitors of the JA/Et signaling pathway, while the genes At5g64905,
and At5g64890 are transcribed in response to elicitors of SA. The nascent
proproteins or processed peptides are transported to the apoplast, where
they interact with a cell surface receptor(s) to amplify the immune
response. Thus, the AtproPep1 paralogs are components of an amplification
system for a broad spectrum of elicitors that activate the innate immune
response.
2. Discussion
[0217]Some fundamental similarities are found among signaling components
of animal and plant innate immune systems, including the recognition of
PAMPS and/or elicitors from pathogens, the involvement of LRR receptor
kinases that monitor the signals, and the resulting activation of defense
gene transcription of genes involved in early steps of innate immunity.
Several peptides originating from plant pathogens can activate the plant
innate immune response, including Pep13, AVR9, and elicitins derived from
fungi (Hahlbrock et al., Proc. Natl. Acad. Sci. USA 92:4150-4157, 1995;
van den Askerveken et al., Plant Physiol. 103:91-96, 1993; Kammpren,
Curr. Opin. Plant Biol. 4:295-300, 2001), and the peptides hrpZ, NPP1,
flg22 and elf13 from bacteria (Kunze et al., Plant Cell, 16:3496-3507,
2004; Navarro et al., Plant Physiol. 135:1113-1128, 2004; Fellbrich et
al., Plant J. 32:375-390, 2002; He et al., Cell 73:1255-1266, 1993), as
examples. However until this report endogenous plant peptides have not
been reported that are involved with signaling roles directed against
pathogen attacks. We have discovered a family of genes that encode small
peptides are rapidly and are strongly transcribed along with defense
genes in response to pathogens and their elicitors, appearing to assure a
rapid, strong amplification of the innate immune response. The low
expression or lack of expression of some of the AtproPep genes
demonstrates that the paralogs are differentially expressed in response
to pathogen infections and elicitors. Fusions of all paralogs with green
fluorescent protein (GFP) and beta-glucuronidase (GUS) are used to
investigate expression of the paralogs to determine their tissue-specific
expression and their roles in defense responses.
[0218]The induction of the defense responses by AtPep1 is mediated by a
binding protein on the cell surface of Arabidopsis suspension cultured
cells that interacts with AtPep1 with the characteristics of a receptor,
further supporting the fundamental concept proposed in the model
described above in which the AtproPep1 paralogs serve as components of an
amplification system for a broad spectrum of elicitors that activate the
innate immune response.
[0219]Searches of plant genomic databases and EST collections identified
AtproPep orthologs in species from several plant families. Table 1,
supra, shows the C-terminal sequences of paralogs and orthologs of
AtproPep1 aligned with the AtPep1 peptide sequence. Paralogs are grouped
above and dicot and monocot orthologs are grouped below.
[0220]The regions with the highest amino acid identities among the deduced
proteins occur within the C-terminal residues of each where the AtPep
homologs are found. The deduced canola peptide exhibited the highest
identity with the AtPep peptides, being a Brassicaceae species. All of
the putative AtPep homologs have a conserved glycine at residue #17
(numbers aligned with AtPep1), and all but paralogs from the Poeceae
family contain an asparagine at residue #23. Each peptide contains
several proline, glycine, and serine residues within a ten amino acid
C-terminal region that may be important for receptor recognition.
[0221]The chemical and physiological properties of the AtPep1 family
members, their precursor proteins, and their genes, are strikingly
similar to the properties of the 18 amino acid peptide signal systemin,
its precursor prosystemin, and its gene, that are components of the
signaling pathway for defense against herbivorous pests of the Solanaceae
family (Ryan and Pearce, "Peptide hormones/systemins," in Encyclopedia of
Biological Chemistry, ed. Lennarz and Lane, vol 3, pp. 381-384, Elsevier,
2004). Both AtPep1 homologs and tomato systemin homologs are cleaved from
the carboxy (C)-termini of precursor proteins that lack leader peptides,
both precursors are small, highly positively charged proteins, and each
activates defense genes. The mechanism for processing AtPep1 is not
known, nor is it known if it is the AtPep1 or its peptide precursor that
is transported to the apoplast, or if more than one receptor is involved
in recognizing the different peptides.
[0222]These results indicate that the major role for receptor-mediated
defense-signaling peptides in plants is to amplify signaling that is
initiated by wounding and elicitors to mount a rapid, strong defense
against herbivores and pathogens. If AtproPep orthologs behave in the
same manner when over-expressed in other plant species by constitutively
expressing defense genes, they may provide an important new approach to
enhance innate immunity in a broad spectrum of agriculturally important
crops.
EXAMPLE 2
An LRR Receptor Kinase is a Component of AtPep1 Amplification of Innate
Immunity in Arabidopsis
[0223]Over 200 LRR receptor kinases are present in the Arabidopsis genome.
Only a few LRR receptor kinases have been identified that interact with
the peptide signals in plants. This includes the receptor for the defense
peptide signal, systemin (Scheer and Ryan, Proc. Natl. Acad. Sci.
99:9585-9590, 2002) and receptors for the developmental peptide signals
CLAVATA1 (Clark and Meyerowitz, Cell 89:575-585, 1997),
phytosulfokine-alpha (Matsubayashi et al., Science 296:1470-1472, 2002)
and the pathogen-derived peptide flg22 (Gomez-Gomez and Boller, Trends
Plant Sci. 7:251-256, 2000).
[0224]The discovery that the AtPep family of endogenous peptides from
Arabidopsis leaf extracts cause an alkalinization of the medium of
Arabidopsis suspension cultured cells indicates that the peptide plays a
role in plant cells by interacting with a cell surface receptor.
Investigations of the biological role of the peptide in Arabidopsis
plants indicated that it activates the innate immune system of the plants
and functions through an interaction with a cell surface receptor.
[0225]We have isolated from Arabidopsis a cell surface LRR Thr/Ser kinase
receptor for AtPep1, a 23 amino acid signal that that amplifies defense
genes for innate immunity. The interaction of AtPep1 with the receptor is
saturable and exhibits a Kd of 0.25 nM. Two SALK mutant lines with T-DNA
insertions in exons of At1g73080 do not express the receptor gene and are
not labeled by an AtPep1 photoaffinity analog that was used to identify
and isolate the receptor protein. However, in contrast to wild-type
plants, the SALK insertional lines constitutively expressed high levels
of PDF1.2 and PR-I, indicting that the receptor was negatively regulating
defense gene expression in the absence of AtPep1. The AtPep1 receptor
plays a central role in amplifying innate immunity activating defense
gene expression when interacting with AtPep peptides that are synthesized
in response to elicitors.
Methods
[0226]Synthesis of AtPep1 analogs. AtPep1, Cys-AtPep1 and Tyr-AtPep1 were
synthesized using solid-phase instrumentation, (peptide synthesizer Model
431A; Applied Biosystems, Foster City, Calif.). After synthesis, the
polypeptides were purified using C18 reverse-phase, high-performance
liquid chromatography (HPLC), as previously described (Pearce and Ryan,
J. Biol. Chem. 278:30044-30050, 2003; Pearce et al., Proc. Natl. Acad.
Sci. USA 98:12843-12847, 2001; Pearce et al., Nature 411:817-820, 2001;
Scheer and Ryan, The Plant Cell 11:1525-1535, 1999; Shevchenko et al.,
Anal. Chem. 68:850-858, 1996). Stock solutions of the peptides (2.5 mM)
were prepared in water and stored at -20.degree. C. Iodination of
Tyr-AtPep1 was performed using IODO-GEN Pre-Coated Iodination Tubes
(Pierce, Rockford, Ill.). Two hundred .mu.l of NaI (20 mM in 0.1 M
phosphate buffer, pH 8.0) solution was oxidized in the IODO-GEN
Pre-Coated Iodination Tube for 6 min. Oxidized NaI solution was
transferred into a 1.5 ml tube containing 100 mmol Tyr-AtPep1, and
maintained at room temperature for 6 min in the dark gently agitating the
tube every 30 sec. Iodinated Tyr-AtPep1 was purified using HPLC as
described previously (Scheer and Ryan, The Plant Cell 11:1525-1535,
1999), and quantified with bicinchoninic acid (Pierce, Rockford, Ill.).
All analogs were analyzed by LCQ ion trap mass spectrometry (Finnigan,
San Jose, Calif.). Cys-AtPep1 was coupled through a disulfide bond to the
photoaffinity cross-linker,
N-(4-[p-azidosalicylamido]butyl)-3'-(2'-pyridyldithio)propionamide (APDP)
(Pierce, Rockford, Ill.) to produce azido-Cys-AtPep1, which was purified
by HPLC by methods previously described (Scheer and Ryan, Proc. Natl.
Acad. Sci. 99:9585-9590, 2002).
[0227]Radioactive iodinations of Tyr-AtPep1 and azido-Cys-AtPep1 were
performed using 2 mCi of Na.sup.125I and 12.5 mmol and the products were
purified by HPLC (Scheer and Ryan, Proc. Natl. Acad. Sci. 99:9585-9590,
2002). The specific activity of the purified mono-iodinated Tyr-AtPep1
and azido-Cys-AtPep1 were 2.58 mCi/nmol, while the specific activity of
the diiodinated forms was 5.15 mCi/nmol. The mono-iodinated analog of
azido-Cys-AtPep1 was found to comprise 90% of the iodinated analog and
was employed for p
hotoaffinity labeling.
[0228]Alkalinization assay. Medium alkalinization activity of Arabidopsis
suspension cultured cells by AtPep1 analogs was analyzed as previously
described for systemin (Pearce et al., Science 253:895-897, 1991), RALF
(Pearce et al., Proc. Natl. Acad. Sci. USA 98:12843-12847, 2001), HypSys
peptides (Pearce and Ryan, J. Biol. Chem. 278:30044-30050, 2003; Pearce
et al., Nature 411:817-820, 2001), and AtPep1 (supra). The alkalinization
activity of azido-Cys-AtPep1 were carried out after incubation the analog
with cells in darkness for 10 min, when the pH was recorded.
[0229]Binding assays. Binding assays of Arabidopsis cells with
.sup.125I.sub.1-Tyr-AtPep1 were performed by the methods of Scheer and
Ryan (Pearce et al., Nature 411:817-820, 2001) modified as follows:
Arabidopsis suspension cultured cells were subcultured and grown for 4-5
days, washed with culture medium, and diluted with medium to a level of
0.2 mg fresh weight/ml. Two mL of cells were aliquoted into each well of
12-well culture plates and allowed to equilibrate on an orbital shaker
(160 rpm) at room temperature for 1 hr. .sup.125I.sub.1-Tyr-AtPep1 was
added to the medium, and 500 .mu.L of cells were removed at selected
times and filtered through a 2.5 cm Type A/E Glass Fiber Filter (Pall
Corporation, Ann Arbor, Mich.) using a 12-well vacuum filtration manifold
(illipore, Bedford, Mass.). The filtered cells were washed three times
with 5 mL of cold MS medium containing 3% sucrose, suspended in 1 mL MS
medium containing 3% sucrose in a glass test tube, and analyzed for total
radioactivity in a gamma-ray counter (Isodata 2020; Isodata Inc.,
Palatine, Ill.). Specific binding was calculated by subtracting
nonspecific binding (binding in the presence of 250-fold native AtPep1)
from total binding. .sup.125I.sub.1-Tyr-AtPep1 bound to the cell surface
within a minute, and equilibrated within 4 min.
[0230]Photoaffinity labeling. To 1 mL of cultured cells in darkness was
added .sup.125I-azido-Cys-AtPep1 (0.25 nM final concentration as
described above) and the cells were shaken for 10 min on an orbital
shaker (160 rpm) at room temperature. The cells were transferred to a 1.5
mL glass tube, centrifuged at 10,000.times.g and the sedimented cells
were dispersed in 1 mL cold MS medium containing 3% sucrose and
centrifuged as above. This wash was repeated twice. The cells were
resuspended in 1 mL MS medium and irradiated with UV-B for 10 min on ice
to photoactivate the azido group to effect the crosslinking. The cells
were washed with 1 mL MS medium, centrifuged as above, and resuspended in
400 .mu.L of 5% SDS. The cells were disrupted by boiling for 30 min, and
the insoluble debris was removed by centrifugation at 10,000.times.g.
Proteins in the clear supernatant were precipitated by adding 1.25
volumes of methanol/chloroform (vol/vol). After centrifugation at
10,000.times.g, the pellet was recovered and dissolved in 100 .mu.L of
Laemmli sample buffer containing 5% SDS, boiled for 10 min, and separated
using 8% SDS-PAGE. The gels were dried and exposed to X-ray film for 50
hr to visualize labeled proteins. In competition assays, unlabeled AtPep1
and suramin were added to the cells and incubated for 10 min before
adding .sup.125I-azido-Cys-AtPep1. The same procedures described above
were employed to detect labeled proteins.
[0231]Purification of AtPep1-binding protein. .sup.125I-azido-Cys-AtPep1
(0.25 nM) was added to 1 L of Arabidopsis suspension cultured cells and
incubated for 10 min in the dark as described above, and collected on
Miracloth (Calbiochem, San Diego, Calif.). After washing the cells with 1
L of cold water, the cells were suspended in 500 ml of MS medium
containing 3% sucrose, and irradiated with UV-B for 15 min while being
mixed on an orbital shaker at 160 rpm. The cells were again collected on
Miracloth and washed with 1 L cold water. Microsomal fractions were
prepared by differential centrifugation as previously described (Pearce
et al., Proc. Natl. Acad. Sci. USA 98:12843-12847, 2001), and stored at
-80.degree. C. This process was repeated three times and the microsomal
proteins were pooled. Protein was measured by Bio-Rad Protein Assay
reagent (BIO-RAD, Hercules, Calif.) using bovine serum albumin as a
standard.
[0232]Purification of AtPep1-binding protein from the membranes was
performed as described previously with modifications (Pearce et al.,
Proc. Natl. Acad. Sci. USA 98:12843-12847, 2001). Briefly, 25 and 55 mg
of radiolabeled and unlabeled microsomal proteins, respectively, were
mixed and separated by 2 sets of 7.5% SDS-PAGE (0.6.times.14.times.9 cm)
for 16 with 37 V at room temperature. The gels were sliced horizontally
into 5 mm width and the radioactivity measured with a gamma-counter
(Isodata 2020; Isodata Inc., Palatine, Ill.). The gel slices near 180 kD,
containing the highest radioactivity were pooled. The gel slices were
mascerated and the proteins were recovered by incubating the mascerate
three times for 30 min with 25 mL of 20 mM Tris-HCl, 0.5 M NaCl, pH 7.5.
The eluted proteins were pooled and incubated with 75 .mu.L of
Conconavalin A-Sepharose 4B (Amersham Bioscience, Piscataway, N.J.) for 6
h at room temperature to trap the Con A-protein complexes. The Con
A-Sepharose was washed with 50 mL of 0.5 M alpha-methyl-D-glucoside three
times, followed by 50 mL of H.sub.2O three times, to elute loosely bound
proteins. Bound proteins were eluted by boiling the Con A-Sepharose in
500 .mu.L of 5% SDS, and the eluted proteins were precipitated by adding
1.25 volumes of methanol/chloroform (2:1, vol/vol). Half of the eluted
proteins were separated using 7.5% SDS-PAGE (0.15.times.14.times.8.5 cm)
at 100 V for 8 h at room temperature. The gel was sliced horizontally
into 1 mm widths, and the gel slice containing highest radioactivity was
digested with trypsin (Promega, Madison, Wis.) according to Shevchenko et
al. (Anal. Chem. 68:850-858, 1996). The other half of the eluted proteins
were digested with Peptide-N-Glycosidase F (PNGase F) (Prozyme, San
Leandro, Calif.), separated by 7.5% SDS-PAGE, recovered as above, and
digested with trypsin. Peptides generated in the trypsin digests were
analyzed by matrix-assisted laser desorption ionization time-of-flight
mass spectrometer (MALDI-TOF MS), Voyager-DE RP Biospectrometry
Workstation (Applied Biosystems, Framingham, Mass.). Protein was
identified by searching in the National Center for Biotechnology
Information database using Mascot (www.matrixscience.com).
[0233]Analysis of T-DNA insertional lines. Arabidopsis thaliana T-DNA
insertional lines, SALK 014538, SALK 059281 and SALK 064539, were
obtained from ABRC (Ohio State University) through The Arabidopsis
Information Resource. The plants were screened by RT-PCR using
gene-specific primer pairs and a primer specific for the T-DNA left
border. Total RNA was purified from rosette leaves.
[0234]Microsomal fractions were prepared from one-month-old plants by
differential centrifugation as previously described (Scheer and Ryan,
Proc. Natl. Acad. Sci. 99:9585-9590, 2002). The membranes were
photoaffinity labeled (Takayama et al, Nature 413:534-538, 2001) using
the radiolabeled azido analog used with suspension cultured cells. The
membranes were incubated for 60 min at approximately 4.degree. C.,
irradiated with UV-B for 15 min, separated by SDS-PAGE, dried and
analyzed by radioautography to identify labeled proteins.
Results
[0235]An analog of AtPep1 was synthesized with a Tyr residue attached to
its N-terminus and radiolabeled with .sup.125I to quantify binding. The
Tyr analog and mono- and di-iodo-Tyr-AtPep1 analogs were separated by
HPLC, and the concentration-dependent activities of AtPep1 and these
analogs where tested in the alkalinization assay. All were found to be as
fully active as AtPep1 in the alkalinization assay. The mono-iodinated
Tyr-AtPep .sup.125I comprised about 95% of the iodinated proteins and was
employed for binding studies. Saturation kinetics of the binding of
mono-.sup.125I-Tyr-AtPep1 with Arabidopsis suspension cultured cells (six
repetitions using 10.sup.6 cells/assay) showed that the .sup.125I-labeled
peptide was maximally bound to Arabidopsis cells within about 10 min,
saturating the sites at about 0.1 nM peptide. A Kd of 0.25 nM was
estimated from Scatchard analysis of the saturation data, which is
typical of ligand-receptor interactions and indicates that AtPep1 was
interacting with a cell surface binding protein with the characteristics
of a receptor.
[0236]A photoaffinity labeled AtPep1 was prepared by synthesizing an
analog with a Cys residue at its N-terminus so that an .sup.125I-labeled
azido adduct, APDP, could be crosslinked to the peptide through a
disulfide bond. All procedures were in darkness unless otherwise
specified. The azido-Cys-AtPep1 was purified by HPLC and assayed for its
alkalinization response under red light to avoid photoactivating the
azido group. The analog was as fully active as the native peptide in the
alkalinization assay. The azido analog was iodinated with .sup.125I and
incubated with Arabidopsis suspension cultured cells for 10 min and
subjected to UV-B irradiation to activate the azido group for
crosslinking with binding proteins. SDS-PAGE analyses of the radiolabeled
membrane proteins revealed a single labeled protein band of Mr
approximately 180 kD. Pre-incubation of 2.5 nM AtPep1 to cells totally
abolished labeling. Tomato systemin (LeSys), a nonhomologous 18 amino
acid peptide signal from tomato plants (Pearce et al., Science
253:895-897, 1991) did not compete for binding with the labeled analog
and had not effect on photoaffinity labelling. Suramin, a polycyclic
non-specific inhibitor of peptide hormone-receptor interactions in both
animals and plants (Stratmann et al., Proc. Natl. Acad. Sci. USA,
97:8862-8867, 2000), inhibited the labeling of the 180 kD protein by the
photoaffinity AtPep1 analog at 100 nM, supporting a membrane association
for the 180 kD labeled protein. The labeled protein band from SDS-PAGE
gels was eluted and incubated with the carbohydrase PNGaseF to
enzymatically remove covalently bound carbohydrates. This enzyme caused a
decrease in the kD of the photoaffinity labeled protein from about 180 kD
to about 150 kD, indicating that the binding protein was glycosylated.
[0237]Purification of the radiolabeled protein from 1 L of Arabidopsis
cells in late log phase was achieved using final steps of ConA-Sepharose
affinity chromatography followed by SDS-PAGE. After electrophoresis, the
labeled 180 kD protein band was excised from the gel and the protein
recovered. Half of the protein was digested with trypsin and the
fragments were analyzed by MALDI-TOF mass spectroscopy. The other half of
the eluted protein was treated with the enzyme PNGase F to remove
carbohydrate and was subjected to gel electrophoresis. The protein in the
150 kD band was recovered, digested with trypsin, and was also analyzed
by mass spectroscopy. The amino acid sequences of 18 tryptic fragments
from the 180 kD peptide exactly matched sequences of the Arabidopsis LRR
receptor kinase gene, At1g73080. The deglycosylated protein yielded three
large fragments of from 12 to 18 amino acids in length that were also
exact matches to sequences within the At1g73080 gene. The nucleotide
sequence of the AtPep1 receptor gene (At1g73080) the deduced receptor
polypeptide is provided in FIG. 2 shows the structure of the At1g73080
gene, which is comprised of an 646 amino acid extracellular domain
containing 27 LRR motifs; a 22 amino acid transmembrane domain; and a 280
amino acid Ser/Thr receptor kinase domain.
[0238]The leaves of two SALK T-DNA insertional lines having insertions in
the exons of the gene At1g73080, SALK 014538 and SALK 059281, did not
express the gene when analyzed by RT-PCR, using wild-type plants and a
SALK 059281 insertional mutant of gene At5g55480 as controls. Microsomal
membrane proteins from the two At1g73080 mutant lines, and from wild type
plants and the control SALK 059281 line, were analyzed for proteins that
were specifically photoaffinity labeled by .sup.125I-azido-Cys-AtPep1. A
protein was labeled in the membranes from wild-type plants and the SALK
059281 plants, but not from the SALK mutants unable to express the
receptor gene. The label was found in a 180 kD protein band and in a
slightly lower doublet band that appears to be degradation products of
the receptor protein, since they were labeled. The proteins labeled in
the wild-type and SALK 059281 microsomal membranes were absent when the
membranes were preincubated with 2.5 nM AtPep1 and then photoaffinity
labeled, indicating that the proteins labeled in the membranes of
wild-type and SALK 059281, and not in membranes from the lines with
mutants in the At1g73080 gene, were the AtPep1 receptor and its
biologically active fragments.
[0239]To further investigate the role of the 180 kD protein as the
receptor of AtPep1, competition experiments were performed between the
.sup.125I.sub.1-Tyr-AtPep1 analog and synthetic peptide homologs derived
from sequences at the N-termini of all seven of the AtPep family members
that corresponded to the 23 amino acid AtPep1 (gene At5g684900). The
peptides were purified after synthesis on HPLC and each assayed for
biological activities at increasing concentrations in the alkalinization
assay to determine the concentration of each that caused maximal
activity. FIG. 4 shows the concentration dependence of synthetic AtPep
peptides deduced from the seven members of the AtproPep1 gene family in
the alkalinization assay. All peptides except those derived from
At1g09980 gene and the unannotated gene were fully active at about 2.5 nM
concentrations. The two genes with diminished activity were from
Subfamily II, which reside relatively close together on Chromosome V. All
seven synthetic peptides competed with the .sup.125I.sub.1-Tyr-AtPep1
analog for binding with Arabidopsis suspension cultured cells, with a
pattern similar to their biological activities in the alkalinization
response. As in the alkalinization assay, the peptides derived from the
At5g09980 gene and the unannotated gene were much weaker competitors than
peptides derived from the other genes.
EXAMPLE 3
Shorter Peptides from the C-Terminus of AtPep1 Possess Substantial Defense
Signal Peptide Activity
[0240]Analogs of AtPep1 from the C-terminus of AtPep1 were synthesized and
assayed in the alkalinization assay. One mL aliquots of 4 day old
Arabidopsis cells were allowed to equilibrate on an orbital shaker at 180
rpm for one hour. A ten .mu.L aliquot of each peptide solution was added
to the cells. Peptide concentrations of 0.25 nM, 2.5 mM, and 25 nM were
tested. After 20 min, the pH of the media was recorded. The results are
shown in FIG. 5. An analog of AtPep1 missing the carboxy-terminal amino
acid was completely inactive, whereas deletions from the amino-terminus
of the peptide resulted in a sequential reduction in activity, until
peptides with 9 carboxy-terminal amino acids remaining (SSGRPGQHN) were
inactive. A peptide with 10 carboxy-terminal amino acids remaining had
substantial defense signal peptide activity at the 25 nM peptide
concentration, causing a change in pH of over 0.20 units, and longer
analogs had progressively greater activity. A peptide consisting of only
the 15 C-terminal amino acids was nearly as active as the native peptide
at approximately 2.5 nM and had substantial activity even at the lowest
concentration tested. It is expected that substantial defense signal
peptide activity will be retained by analogs of other defense signal
peptides that comprise sequences from the C-terminus of the peptides.
EXAMPLE 4
Alanine Substitutions in Residues of a 15-mer Analogs from the C-Terminus
of AtPep1
[0241]The 15-mer from the carboxy-terminus of AtPep1 (RGKEKVSSGRPGQHN) was
substituted with alanine at each position to assess which amino acids
were necessary for the alkalinizing activity. FIG. 6 shows the effect of
these single alanine amino acid substitutions on the activity of the
15-mer peptide in the alkalinization assay. The set of substituted 15-mer
peptides was assayed using four-day-old Arabidopsis cells. Ten ml of each
peptide (2.5 pmoles) was added to 1 ml of cells to make a final
concentration of 2.5 nM. After 20 min, the pH of the media was recorded.
The data is the average of three separate experiments.
[0242]A Ser to Ala substitution at position 7, counting from the
amino-terminus of the 15-mer, and a Gly to Ala substitution at position
9, exhibited little activity. Computer modeling predicted that these two
amino acids would be involved in a beta-turn within the peptide region of
--SSGR-- (compare with residues 15-18 of the sequence of AtPep1 shown in
Table 1). Substituting Ala for Ser (-ASGR--) abolished the predicted turn
and severely abolished activity (half-maximal activity at .about.250 nM),
while substituting Ala for Gly was even less active (half-maximal
activity of >250 nM. However, neither of these analogs were able to
compete with the non-substituted 15-mer for receptor binding, indicating
that the structural changes in this region may have severely modified the
conformation without competing for the receptor binding site. Peptides
with alanine substitutions at all residues were synthesized and assayed,
with most showing no differences in activity than the native AtPep1.
[0243]All publications, patents and patent applications are incorporated
herein by reference. While in the foregoing specification, this invention
has been described in relation to certain preferred embodiments thereof,
and many details have been set forth for purposes of illustration, it
will be apparent to those skilled in the art that the invention is
susceptible to additional embodiments and that certain of the details
herein may be varied considerably without departing from the basic
principles of the invention.
* * * * *