Register | Login | Help |
 
Bookmark

Title: 

Use of cytokine receptors as biomarkers and therapeutic targets in human cancer



Patent ID: 

US7598057


Issue Date: 

October 06, 2009



Abstract:

Nucleic acids encoding erythropoietin receptor isoforms are described, as well as the encoded isoforms, methods of detecting the same, and methods of screening for and treating cancer.


Download PDF Powered by Patents.com   (Registration Required)

Inventor(s): 
Arcasoy;  Murat O.  (Chapel Hill,  NC,  US) , Email and Contact Information
Haroon;  Zishan A.  (Ironwood,  MI,  US) Email and Contact Information
Assignee:  Duke University;  (Durham,  NC,  US)
Application No.:  11/512,501
Filing Date:  August 30, 2006
Primary Class:  435/69.1
Other Classes:  530/350  536/23.1  536/24.3 
Intern'l Class:  C12N 15/00 (20060101)  C07H 21/04 (20060101)  C07K 14/00 (20060101) 
US Related Documents:Application No.:  10625137
Filing Date:  July 31, 2003
Patent Number: 7160697

Application No.:  60404870
Filing Date:  August 31, 2002
Patent Number: 

US Patent Document(s):
Foreign Reference(s):
Parent Case Text: CLAIM FOR PRIORITY AND CROSS-REFERENCE TO OTHER APPLICATIONS This application claims priority to and is a divisional of parent application Ser. No. 10/625,137 filed Jul. 23, 2003, now U.S. Pat. No. 7,160,697, which claims priority to provisional application Ser. No. 60/404,870 filed Aug. 21, 2002, the disclosures of which are hereby incorporated herein by reference in their entirety.


Claim(s):

That which is claimed is:

1. An isolated nucleic acid selected from the group consisting of a nucleic acid encoding erythropoietin receptor isoform 2 and having the sequence given herein as SEQID NO: 6; and a nucleic acid that is the full length complement of SEQ ID NO:6.

2. The nucleic acid according to claim 1 encoding erythropoietin receptor isoform 2 and having the sequence given herein as SEQ ID NO: 6.

3. The nucleic acid according to claim 1, wherein said nucleic acid is an RNA.

4. A recombinant nucleic acid comprising a promoter operatively associated with a nucleic acid according to claim 1.

5. An isolated host cell in culture containing a recombinant nucleic acid according to claim 4 and which expresses the encoded erythropoetin receptor isoform.

6. A method of screening a subject for cancer, comprising: detecting the presence or absence of a nucleic acid according to claim 1 in said subject, the presence of such a nucleic acid indicating said subject is afflicted with cancer; whereinsaid cancer is selected from the group consisting of breast, lung, and ovarian cancer.

7. The method according to claim 6, wherein said cancer is breast cancer.

8. The method according to claim 6, wherein said detecting step is carried out by collecting a biological sample from said subject, and then detecting the presence or absence of said nucleic acid in said biological sample.



Description:

FIELD OF THE INVENTION

The present invention concerns nucleic acids encoding erythropoietin receptor isoforms, proteins encoded by such nucleic acids, antibodies that bind to such proteins, and methods of using the same.

BACKGROUND OF THE INVENTION

Erythropoietin (Epo) is the principal hematopoietic growth factor that promotes the viability, differentiation and proliferation of mammalian erythroid progenitor cells (S. Krantz, Blood 77, 419-34 (1991)). The biologic effects of Epo aremediated via its interaction with its specific transmembrane receptor, EpoR (H., Youssoufian, Blood 81, 2223-36 (1993)). The EpoR lacks intrinsic tyrosine kinase activity and upon ligand binding activates a receptor-associated tyrosine kinase Jak2 whichis critical for anti-apoptosis and mitogenic signaling via the EpoR (O. Miura et al., Blood 84, 1501-7 (1994); B. Witthuhn et al., Cell 74, 227-36 (1993); J. Ihle, Nature 337, 591-4 (1995); H. Zhuang et al., J. Biol Chem. 270, 14500-4 (1995)). ActivatedJak2 then phosphorylates a number of cytoplasmic proteins as well as the EpoR itself. Expression of Epo receptors has been reported on several non-hematopoietic cell types including vascular endothelial cells, placental tissue, neuronal cells, kidneyand cardiomyocytes (A. Anagnostou et al., Proc. Natl. Acad. Sci. USA 91, 3974-8 (1994); S. Masuda et al., J. Biol. Chem. 268, 112-8-16 (1993); S. Sawyer et al., Blood74, 103-9 (1989); M. Wald et al., J. Cell. Physiol. 167, 461-8 (1996)).

Recombinant human Epo (r-HuEpo) has been widely used in many different types of cancers for the treatment or prevention of chemo-radiotherapy induced anemia (A. Moliterno and J. Spivak, Hematol. Oncol. Clin. North Am. 10, 345-63 (1996)). Forinstance, in patients with breast cancer, r-HuEpo has been investigated in clinical trials for its potential beneficial effects in the prevention or treatment of chemotherapy or radiation therapy-related anemia (L. Del Mastro et al., J. Clin. Oncol. 15,2715-21 (1997); H. Ludwig et al., Ann. Oncol. 4, 161-7 (1993); P. Sweeney et al., Br. J. Cancer 77, 1996-2002 (1998); S. Vijayakumar et al., Int. J. Radiat. Oncol. Biol. Phys 26, 721-9 (1993)), for mobilization of peripheral blood progenitor cells(C. Waller et al., Bone Marrow Transplant 24, 19-24 (1999)), to increase the rate of hematopoietic recovery following high dose chemotherapy (P. Benedetti Panici et al., Br. J. Cancer 75, 1205-12 (1997); S. Filip et al., Neoplasma 46, 166-72 (1999)) aswell as use in ex vivo expansion strategies of stem cells (C. Bachier et al., Exp Hematol. 27, 615-23 (1999); L. Pierelli et al., Exp. Hematol. 27, 416-24 (1999); P. Stiff et al., Blood 95, 2169-74 (2000); W. Vogel et al., Blood 86, 1362-7 (1996)). Similarly, r-HuEpo has been investigated in several clinical trials of squamous cell cancers of head-neck (F. Dunphy et al., Cancer 86, 1362-7 (1999); M. Henke et al., radiother Oncol 50, 185-90 (1999); G. Mantovani et al., Oncol. Rep. 6, 421-6 (1999))and uterine cervix (K. Dusenbery et al., Int. J. Radiat. Oncol. Biol. Phys. 29, 1079-84 (1994)).

In view of the foregoing, it would be extremely desirable to understand the association of Epo with tumor growth and how EpoR may be involved in cancer pathophysiology and progression.

SUMMARY OF THE INVENTION

A first aspect of the present invention is an isolated nucleic acid encoding erythropoietin receptor isoform 1, erythropoietin receptor isoform 2, erythropoietin receptor isoform 3, erythropoietin receptor isoform 4, or erythropoietin receptorisoform 5, or a nucleic acid thatencodes the opposite or complementary strand of a nucleic acid as set forth above (e.g., a DNA encoding an RNA).

A second aspect of the present invention is a protein encoded by a nucleic acid as described above (e.g., an isolated and/or purified protein).

A third aspect of the present invention is an antibody that selectively or specifically binds to a protein as described above.

A further aspect of the present invention is an oligonucleotide probe that selectively or specifically binds to a nucleic acid as described above.

A further aspect of the present invention is a method of screening a subject for cancer, comprising: detecting the presence or absence of a nucleic acid encoding an isoform as described above in the subject, the presence of such a nucleic acidindicating the subject is afflicted with or at risk of developing cancer.

A further aspect of the present invention is a method of screening a subject for cancer, comprising detecting the presence or absence of a protein or isoform as described above in the subject, the presence of such a protein indicating the subjectis afflicted with or at risk of developing cancer.

Particular cancers which may be screened by the methods described herein include, but are not limited to, breast, cervix, ovarian, prostate, colon and lung cancer.

The foregoing and other objects and aspects of the present invention are explained in detail in the drawings herein and the specification set forth below.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. The organization of the EpoR gene (GenBank accession number S45332, SEQ ID NO: 1). The splicing that results in the mature mRNA for the wild-type receptor (SEQ ID NO: 3), and five alternatively spliced isoforms (1-5) described hereinare depicted schematically. The translated regions of the gene are indicated in black, whereas untranslated regions are indicated in white. Novel amino acid translations that result from alternative splicing of the EpoR gene transcript are indicated ingrey.

FIG. 2. Changes in the open reading frames (ORFs) of mature mRNA sequences from the full-length wild-type receptor in the isoforms of EpoR described herein. Isoform 1 (SEQ ID NO: 4): Additional nucleotides from intron 6 (nucleotides 5949-6062,SEQ ID NO: 1) are spliced between exons 6 and 7. Isoform 2 (SEQ ID NO: 6): Splicing at the 5' end of exon 8 occurs 19 nucleotides upstream (nucleotide 7498) from that seen in the full-length wild-type message (nucleotide 7517). Isoform 3 (SEQ ID NO:8): Intron 7 is not spliced out of the final message. Isoform 4 (SEQ ID NO: 10): Intron 5 is not spliced out of the final message. Isoform 5 (SEQ ID NO: 12): exon 6 is skipped, with exon 5 spliced directly to exon 7. Putative C-terminal amino acidsequence changes from wild-type EpoR are depicted in bold.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention is explained in greater detail below. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented or all the features that may be added to the instantinvention. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. In addition, numerousvariations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure which do not depart from the instant invention. Hence, the following specification is intended toillustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations and variations thereof.

Nucleic acid as used herein refers to any type of nucleic acid, including naturally occurring and synthetic nucleic acids and including both DNA and RNA.

Subjects with which the present invention may be carried out are generally mammalian subjects, including both human subjects and non-human subjects (e.g. dog, cat, horse, rabbit, rat) for veterinary or research purposes.

Any type of antibody may be used in the present invention. The term "antibodies" as used herein refers to all types of immunoglobulins, including TgG, IgM, IgA, IgD, and IgE. Of these, IgM and IgG are particularly preferred. The antibodies maybe monoclonal or polyclonal (with monoclonal antibodies preferred) and may be of any species of origin, including (for example) mouse, rat, rabbit, horse, or human. See, e.g., M. Walker et al., Molec. Immunol. 26, 403-11 (1989). Antibody fragmentsthat retain specific binding to the protein or epitope bound by the antibody are included within the scope of the term "antibody" and include, for example, Fab, F(ab')2, and Fc fragments, and the corresponding fragments obtained from antibodies otherthan IgG. Such fragments can be produced by known techniques. The antibodies may be chimeric or humanized, particularly when they are used for therapeutic purposes.

Applicants specifically intend that all United States patent references cited herein be incorporated herein by reference in their entirety.

1. Nucleic acids.

As noted above, a first aspect of the present invention is a nucleic acid encoding an erythropoieitin receptor isoform as described herein. In certain embodiments the nucleic acid may be an RNA such as an mRNA, or may be a DNA.

In one embodiment, the nucleic acid encodes erythropoietin receptor isoform 1 and has the sequence given herein as SEQ ID NO: 4.

In another embodiment, the nucleic acid encodes erythropoietin receptor isoform 2 and has the sequence given herein as SEQ ID NO: 6.

In another embodiment, the nucleic acid encodes erythropoietin receptor isoform 3 and has the sequence given herein as SEQ ID NO: 8.

In another embodiment, the nucleic acid encodes erythropoietin receptor isoform 4 and has the sequence given herein as SEQ ID NO: 10.

In another embodiment, the nucleic acid encodes erythropoietin receptor isoform 5 and has the sequence given herein as SEQ ID NO: 12.

In another embodiment, the nucleic acid that encodes the opposite strand of a nucleic acid as set forth above (e.g., is a DNA encoding an RNA).

Nucleic acids as described above may be natural or synthetic, and can be produced in accordance with techniques known in the art or variations thereof which will be apparent in light of the disclosure herein.

Nucleic acids as described above may be coupled to appropriate regulatory elements such as a promoter to produce a recombinant nucleic acid construct, which construct may be inserted into a host cell in which the promoter is operable so that theencoded protein is expressed by the host cell. Recombinant techniques and the production of proteins in recombinant cells may be carried out in accordance with known techniques.

2. Antibodies.

Polyclonal antibodies used to carry out the present invention may be produced by immunizing a suitable animal (e.g., rabbit, goat, etc.) with the antigen to which the monoclonal antibody binds, collecting immune serum from the animal, andseparating the polyclonal antibodies from the immune serum, in accordance with known procedures. Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's,mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Among adjuvants used in humans, BCG (bacilliCalmette-Guerin) and Corynebacterium parvum are especially preferable.

Monoclonal antibodies of the present invention may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, thehuman B-cell bybridoma technique, and the EBV-hybridoma technique (Kohler, G. et al. (1975) Nature 256:495-497; Kozbor, D. et al. (1985) J. Immunol. Methods 81:31-42; Cote, R. J. et al. (1983) Proc. Natl. Acad. Sci. 80:2026-2030; Cole, S. P. et al.(1984) Mol. Cell Biol. 62:109-120). Briefly, the procedure is as follows: an animal is immunized with antigen or immunogenic fragments or conjugates thereof. For example, haptenic oligopeptides of antigen can be conjugated to a carrier protein to beused as an immunogen. Lymphoid cells (e.g. splenic lymphocytes) are then obtained from the immunized animal and fused with immortalizing cells (e.g. myeloma or heteromyeloma) to produce hybrid cells. The hybrid cells are screened to identify thosewhich produce the desired antibody.

Human hybridomas which secrete human antibody can be produced by the Kohler and Milstein technique. Although human antibodies are especially preferred for treatment of human, in general, the generation of stable human-human hybridomas forlong-term production of human monoclonal antibody can be difficult. Hybridoma production in rodents, especially mouse, is a very well established procedure and thus, stable murine hybridomas provide an unlimited source of antibody of selectcharacteristics. As an alternative to human antibodies, the mouse antibodies can be converted to chimeric murine/human antibodies by genetic engineering techniques. See V. T. Oi et al., Bio Techniques 4(4):214-221 (1986); L. K. Sun et al., Hybridoma 5(1986).

In addition, techniques developed for the production of "chimeric antibodies", the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity can be used (S. L.Morrison, et al. Proc. Natl. Acad. Sci. 81, 6851-6855 (1984); M. S. Neuberger et al., Nature 312:604-608 (1984); S. Takeda, S. et al., Nature 314:452-454 (1985)). Alternatively, techniques described for the production of single chain antibodies maybe adapted, using methods known in the art, to produce isoform-specific single chain antibodies. Antibodies with related specificity, but of distinct idiotypic composition, may be generated by chain shuffling from random combinatorial immunoglobinlibraries (D. R. Burton, Proc. Natl. Acad. Sci. 88,11120-3 (1991)).

Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (R. Orlandi et al., Proc. Natl. Acad. Sci. 86, 3833-3837 (1989)); G. Winter et al., Nature 349, 293-299 (1991)).

Antibodies that selectively bind to a particular erythropoietin receptor isoform as described herein (i.e., that selectively bind to one of isoforms 1-5 but do not bind to the other of isoforms 1-5) can be identified in accordance with knowntechniques, such as their ability to compete with labeled antibody to in binding to that isoform in a competitive binding assay.

If desired, antibodies specific for a particular isoform can be used to produce anti-idiotypic (paratope-specific) antibodies. See e.g., McNamara et al., Science 220,1325-26 (1984), R. C. Kennedy, et al., Science 232,220 (1986).

3. Immunoassay Techniques.

Those skilled in the art will be familiar with numerous specific immunoassay formats and variations thereof which may be useful for carrying out the method disclosed herein. See generally E. Maggio, Enzyme-Immunoassay, (1980)(CRC Press, Inc.,Boca Raton, Fla.); see also U.S. Pat. No. 4,727,022 to Skold et al. titled "Methods for Modulating Ligand-Receptor Interactions and their Application," U.S. Pat. No. 4,659,678 to Forrest et al. titled "Immunoassay of Antigens," U.S. Pat. No.4,376,110 to David et al., titled "Immunometric Assays Using Monoclonal Antibodies," U.S. Pat. No. 4,275,149 to Litman et al., titled "Macromolecular Environment Control in Specific Receptor Assays," U.S. Pat. No. 4,233,402 to Maggio et al., titled"Reagents and Method Employing Channeling," and U.S. Pat. No. 4,230,767 to Boguslaski et al., titled "Heterogenous Specific Binding Assay Employing a Coenzyme as Label."

Antibodies as described herein may be coupled or conjugated to a solid support suitable for a diagnostic assay (e.g., beads, plates, slides or wells formed from materials such as latex or polystyrene) in accordance with known techniques, such asprecipitation. Antibodies as described herein may likewise be coupled or conjugated to detectable groups such as radiolabels (e.g., .sup.35S, .sup.125I, .sup.131I), enzyme labels (e.g., horseradish peroxidase, alkaline phosphatase), fluorescent labels(e.g., fluorescein), chemiluminescent labels (e.g., acridinium groups, metalloporphyrins such as phthalocyanine dyes, luminol, etc.), metal atoms (e.g., technetium-99m), etc., in accordance with known techniques. See, e.g., U.S. Pat. No. 4,472,509 toGansow (metal chelates to monoclonal antibodies); U.S. Pat. No. 5,061,641 to Schochat et al.; and U.S. Pat. No. 4,861,869 to Nicoleotti et al. (radiolabelling proteins).

Immunoassays, or other types of assays to detect and/or quantitate the level of the isoform in samples as described below, may be used in screening assays to detect pathologic states associated with aberrant levels of isoform expression (e.g.,tumors, inflammatory states), diagnostic studies, prognostic studies, or to monitor the progression or diminution of isoform expression in correlation with disease state.

Samples that may be collected for use in carrying out the immunoassay may be tissue samples from the organ or tissue of interest within the subject, such tissue generally of most interest being those types of tissues/cells that express differingamounts of isoform in pathologic states as compared to non-pathologic states, or biological fluids such as blood (including blood fractions such as blood plasma or blood serum), urine, cerebrospinal fluid, etc). Examples may include overexpression oraberrant expression of the isoform in various types of malignancies (e.g ovarian cancer, endometrial cancer, pancreatic cancer, breast cancer, urinary bladder cancer, lung cancer, etc.), as well as overexpression or aberrant expression in otherpathologic states.

A biological sample may be a cell sample, with an intervening culturing step being performed between the time the cell sample is collected from the subject and the immunoassay is carried out on the biological sample.

For immunohistological techniques, a tissue sample is collected from the subject, and the presence or absence of binding of an antibody of the invention is detected. The presence of binding of the antibody in an abnormal pattern or a patternindicative of a tumor or cancer indicates the presence of a tumor or cancer in the subject from which the tissue sample is collected. The presence of the antigen in a metastatic tumor deposit can also be used to determine a likely source of the primarytumor. Any suitable immunohistology format may be used. The tissue sample may include patient biopsies, resections or cells for cytologic study. A similar technique to immunohistology is the use of similar techniques to detect and/or phenotype cellsin body fluids or other suspensions as is used for flow cytometric examination.

For in vivo diagnostic purposes the antibody according to the invention is coupled to or provided with a suitable externally detectable label, such as e.g. a radiolabel as described above or a metal atom (e.g., technetium-99m), and administeredto a subject (e.g., by intraveneous or intraarterial injection), in an amount sufficient to produce an externally detectable signal, whereupon the possible localized accumulation of antibody in the body is determined, with a localized accumulation of theantibody (in a region other than that which would ordinarily be expected for normal subjects or subjects free of disease) indicating the present of a tumor in that subject.

4. Nucleic Acid Assay Techniques.

Detection of mRNAs specific to EpoR isoforms 1, 2, 3, 4, and 5 may be carried out by any suitable technique, including but not limited to using reverse transcriptase-polymerase chain reaction (RT-PCR) amplification with isoform-specific primersand Southern blot analysis of the resulting RT-PCR amplicons. For example, PolyA.sup.+ RNA may be isolated by any technique known by those skilled in the art from patients patient cells and/or cancer cells, including but not limited to breast, colon,lung, ovary, and prostate cells or cancer cells. Methods for RT-PCR amplification of the isolated RNA are known in the art and may be carried out using EpoR isoform-specific primer pairs, preferably as described below.

Oligonucleotide probes (or primers) that specifically bind to a nucleic acid encoding an isoform as described above (including the opposite strands thereof), and pairs of probes (where at least one member of the pair is specific for a nucleicacid encoding one particular isoform), are also an aspect of the present invention. In general, such probes are from 8 or 10 nucleic acids in length up to 40 or 50 nucleic acids in length, or more. By "specifically bind" is meant that a probe binds toa nucleic acid (or complement thereof) that encodes one isoform as described herein, but does not bind to a nucleic acid (or complement thereof) that encodes another isoform as described herein. Probes may optionally be labeled with a detectable groupsuch as a radioisotope, enzyme, or member of a binding pair in some assay formats.

Where a pair of probes or primers is used for amplification, it will be appreciated that only one member of the pair need be isoform-specific, and that the other member of the pair may be one which will bind to nucleic acids encoding more thanone of the isoforms described herein, so long as the primer pair specifically amplifies only nucleic acid encoding one of the isoforms described herein. Examples of such oligonucleotide probes, and pairs thereof, are as follows:

TABLE-US-00001 Primer pair specific for intron 6 insert (isoform 1) (SEQ ID NO: 14) 28AS-: 5' TCA AGC GGC TGC TTC CTT CCA A 3' (SEQ ID NO: 15) ER4-5: 5' GCA GGG AGC GTA CAG AGG GTG GAG 3' Primer pair specific for intron 7 insert (isoform 2) (SEQID NO: 16) 33AS: 5' GAA GAA ATA GCA CCA ACC TGG AAG 3' (SEQ ID NO: 17) 31S: 5' CTG ACG CCT AGC GAC CTG GAC C 3' Primer pair specific for intron 7 unspliced (isoform 3) (SEQ ID NO: 18) 31AS: 5' GCA GTT TGG CTG CAA GAA GCA 3' (SEQ ID NO: 17) 31S: 5' CTGACG CCT AGC GAC CTG GAC C 3' Primer pair specific for intron 5 unspliced (isoform 4) (SEQ ID NO: 19) 26S: 5' GGA GCC AGG GCG AAT CAC GG 3' (SEQ ID NO: 20) 32S: 5' GCC TTC AAA CTC GCT CTC TG 3' Primer pair specific for exon 6 skipped (isoform 5) (SEQ IDNO: 21) 34AS 5' GCT TCA GAG CCC GCT AGG CGT 3' (SEQ ID NO: 15) ER4-5 5' GCA GGG AGC GTA CAG AGG GTG GAG 3'

Note that, in the foregoing pairs, the primers of SEQ ID NO. 14, 16, 18, 19 and 21 are specific for the identified isoform, and the primers of SEQ ID NO. 15, 17 and 20 are not specific. In each pair, only one primer need be specific to providean isoform-specific primer pair.

Blotting techniques are well known in the art. See, e.g., Sambrook et al., Molecular Clooning: a Laboratory Manual 3rd Ed. (Cold Spring Harbor, NY.); Ausubel et al. Current Protocols in Molecular Biology (Green Publishing Associates, Inc. andJohn Wiley & Sons, Inc., New York). The nucleic acids resulting from RT-PCR amplification may be separated by gel electrophoresis and immobilized on a suitable matrix, e.g. a filter of nitrocellulose. The presence of target sequences among theamplification products may be shown by incubation of the blotted amplicons with a probe (usually labeled) under conditions that promote denaturation and rehybridization. Because the probe is designed to base pair with target sequences, the probe willbind under renaturing conditions. Unbound probe is then removed, and detection of target sequences may be accomplished via known techniques to detect the labeled probe.

The present invention and the various methods and compounds therein are explained in greater detail in the following non-limiting examples.

EXAMPLE 1

The Erythropoietin Receptor (EpoR) gene. The human EpoR gene has been cloned and sequenced as previously described (Noguchi et al. (1991) Blood 78:2548-2556). The gene spans 8.6 kilobases, and comprises of 8 exons with 7 intervening introns,the latter of which range in size from 81 bp to 2.1 kb. The organization of the EpoR gene is outlined in FIG. 1. The full-length wild-type form of EpoR comprises of 508 amino acids (SEQ ID NO: 2) in three domains: extracellular, transmembrane (TM), andcytoplasmic. Exons 1-5 encode for the extracellular domain of EpoR, exon VI encodes for the transmembrane domain, while exons VII and VIII encode for the cytoplasmic domain of the receptor. In the examination of EpoR expression in tumor vasculature,analysis by RT-PCR indicated a high level of EpoR mRNA expression in breast cancer cells, as well as squamous cell cancers of head-neck and uterine cervix was observed.

EXAMPLE 2

Novel Isoforms of EpoR mRNA Transcripts. The resulting RT-PCR amplification products derived from human cervix, breast, prostate, and ovarian cancer cell lines were sequenced and analyzed. The results of this study revealed five alternativelyspliced EpoR mRNA transcripts that differ from the mature, full-length wild-type EpoR mRNA. Using isoform-specific PCR primers, transcripts corresponding to each isoform were detected in breast, colon, lung, ovarian and prostate cancer. Theorganization of these five isoforms is outlined in FIG. 1. The alternative forms of EpoR predicted to be coded for from these alternatively spliced mRNAs fall into two categories isoforms 1, 2, and 3 are described as truncated (EpoR-T), and possess theextracellular and transmembrane domains of the wild-type receptor, while lacking portions of the cytoplasmic domain. Isoforms 4 and 5 are described as soluble (EpoR-S), and only possess the extracellular domain of the wild-type receptor intact. Thechanges in the putative C-terminal amino acid sequence encoded by these mRNAs are outlined in FIG. 2.

EXAMPLE 3

EpoR Isoform 1. The mRNA that codes for Isoform 1 contains an additional 114 nucleotides from intron 6 (nucleotides 5949-6062, SEQ ID NO: 1) spliced between exons 6 and 7. The resulting mRNA will code for an EpoR peptide 285 amino acids inlength (SEQ ID NO: 5) with a severe truncation in the cytoplasmic region. At the C-terminal, 9 novel amino acids (M V R E G S R R R STOP) inserted at position 277 of the full-length EpoR peptide sequence.

EXAMPLE 4

EpoR Isoform 2. The mRNA that codes for Isoform 2 is the result of an alternative splicing event between the 3' end of exon 7 and 5' end of exon 8, in which an additional 19 nucleotides (nucleotides 7498-7516, SEQ ID NO: 1) are added to the 5'end of exon 8. The mRNA from this splicing event codes for an EpoR peptide 317 amino acids in length (SEQ ID NO: 7) with a severe truncation in the cytoplasmic domain, in which 12 novel amino acids (V G A I S S A V A V P E STOP) are inserted at position306 of the EpoR peptide sequence. As with Isoform 1, Isoform 2 also possesses a truncation of the cytoplasmic domain of the full-length peptide sequence of EpoR.

EXAMPLE 5

EpoR Isoform 3. The translation of isoform 3 results from a processed EpoR mRNA in which sequences from intron 7 (nucleotides 7422-7516, SEQ ID NO: 1) are not spliced out of the final message. The resulting translation is a 328 amino acidpeptide (SEQ ID NO: 9), with 23 novel amino acids introduced to the C-terminus (V G G L V V P S V P G L P C F L Q P N C R P L STOP) at position 306 of the EpoR peptide sequence. As with Isoforms 1 and 2, Isoform 3 possesses a truncation of thecytoplasmic domain of the full-length peptide sequence of EpoR. The sequence of the ORF of the mRNA message (SEQ ID NO: 8) and the peptide sequence of EpoR Isoform 3 (SEQ ID NO: 9) is identical to the translation predicted from an mRNA describedpreviously (Nakamura et al. (1992) Science 257:1138-1141).

EXAMPLE 6

EpoR Isoform 4. The processed EpoR mRNA that translates into Isoform 4 contains sequences from intron 5 (nucleotides 5061-5144, SEQ ID NO: 1) are not spliced out of the final message. The resulting translation is a 267 amino acid peptide (SEQID NO: 11) with 21 novel amino acids (G E A P G G G V G G A R A N H G A S P P P STOP) introduced to the C-terminus at position 247 of the full-length EpoR peptide sequence. This isoform of EpoR possesses neither the transmembrane nor cytoplasmic domainsof the full-length receptor. The translation that codes for Isoform 4 results in a soluble form of EpoR, containing the extracellular domain of the receptor only.

EXAMPLE 7

EpoR Isoform 5. Isoform 6 is a translation that results from the alternatively processed EpoR mRNA in which sequences from exon 6 are skipped, i.e. exons 5 and 7 are spliced together directly. The translation of this message results in a 248amino acid peptide (SEQ ID NO: 13), in which 2 novel amino acids (G L STOP) are introduced at position 247 of the full-length peptide sequence of EpoR. As with Isoform 4, Isoform 5 of EpoR is a soluble form of the receptor that comprises of only theextracellular domain.

The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.

>

27 DNA Homo sapiens CDS ((2on tccaccc acctcggcct cccaaagtgc tgggattaca ggcatgagca ctgtgcatgg 6ttatt tatttttttg aaacagagtt tcaatcttgt tgcacagcct ggagtgcaat gtgatct cagctcactg caacctctgc cttctggttt caagcaattc tcctgcctcatcctgag tagctgggat tacaggcacc caccaccacg ctcgaatata tatatatatt 24agacg gagtccgctc tgtcaccagg ctggagtgca gtggccaaat atcggctcac 3acctcc ggctcctggg ttcaagcgat tctcctgcag cctcccaagt agctgggatt 36catgc agcaccacgc ccatctaatttttgtatttt tggtagagat ggggttttac 42tggcc aggatggtct tgatctcttg acctcgtgat ctgcccacct cggcctccca 48ctggg attacaggcg tgacgaccgc gcccggccta cgcctggcta atttttgtat 54gtaga gacgtggttt cgccatgttg cccaggctgg tctcgaactc ctgacctcat 6cgcctg tctcggcctc ccaaagtgtt gggattacaa gtatgagcca ccgcgccact 66atttt ttttattttt tgagatgcag tctcactctg ttgcccaggc tggagttgca 72atgat cttggctcac tgcaatcttc atctcccaga ctgaagcagt tctcatgcct 78tcctg agtagctggg attacagcac acgccaccacacctggctaa tttttgtatt 84tagag atgggatttc accatgttgg ccaggctggt ctcaaactcc tgacctcaag 9ttgccc acgtcggcct cccaaagtgc tgggattata ggcgtgagcc accgcccagc 96agaat aaaaatgtgg gtggtaaaaa tttttttccc aaaaattcgt aaatgaaaat cacatattatgcatactg cccaggagca tggcctagca ctgtgcaaac actcaactgc gtcgttgc aaggattatt attggccggc ttcagtggct tgctggtatt cccagcacat ggagatgg aggctggagg attgcttaag tccgggattt caagaccagc ctggacaaca gtgggatc ccatctctac aaagaatttt aaaaattagccaggtgcagt gggaagattg tcagtcca gaggctgcag tgagctatga ttgtgccact gcactccagc ctgggtgaca gcaacacc ctgagacaga gagagagagg gggaaggagg gaaggaggga aggaaggaag aggaagga aggaaggaag gaaggaagga aggaaggaaa ggagagagag agagagagag agagagagagagagaaaa taatttttat ttatttccag gctgggaaga gatgctgatt tgcgataa aatcagtagg tacatttttt ggaatgttcg ctatgtgcca ggctagattt cagatgag aagtctgaag ctcaggtaag gtaagtcacc tgtccagggc cacaaagaaa aaaaacgt gtgtctgaag ccagaacggg agctgttgcgcccaactccc tcccctgccc aagcggcc tctgggctcg ggaagggccc ctgcctcctc ccgccaggca cttatctcta caggctga gtgctggccc cgcccctcgg ggatctgcca cttagaggcg cctggtcggg gggcctgg tcagctgcgt ccggcggagg cagctgctga cccagctgtg gactgtgccg ggtgggggacggaggggc aggagccctg ggctccccgt ggcgggggct gtatc atg t ac ctc ggg gcg tcc ctc tgg ccc cag gtc ggc tcc ctt tgt ctc p His Leu Gly Ala Ser Leu Trp Pro Gln Val Gly Ser Leu Cys Leu 5 tg ctc gct ggg gcc gcc tgg gcg ccc ccg cct aacctc ccg gac ccc 2 Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp Pro 2 aag ttc gag agc aaa g gtaaggatga gctgcgtgtg gacccctacg ctggagcctg 2 Phe Glu Ser Lys 35 caggaccatg ctggggcctg aactcccagc ctaggtcctg ggggccatgc tgtttctgga2cctgacc gggtcctggg ggccaagctg gcatctgaac ccttagactg ggtcctggat 2tgggggg cggggtgggg tatgttagga tccaagactc ctgatcgcgt cccgggcaag 225gagtg ggcttaacat tcccgtttta ccttttcagg gagtctggga catgctaaat 23aggggg ctgacttggt gctaaggtccctggggggtg gggaccaagc cgatccctag 237ggagg gtaaagcccg ggtccgagtt agagggccaa gccacaggct actgtaaaca 243tgtgt gagggcgcca gatcacttgc ccggcccggt ggagggaggg aggcgggggg 249ttggc gctatcggtt ggcggggagc ctgccggggc cgataggggg cccgcctctc 255acacc cccagccgcg cgcgtgtcct aggctggggc ggggctggca gtcccgagct 26gtcttg aacgccgcgc ccagctcagc tggccgctgg gtgggcaggt gtgcgccagt 267acggc gggggacagt aaggcgagaa acttgcccct gggaattagg ggggcaccac 273cggac ccctccaagg gacccgcttgggaagatggc agggcggggc ttttttctta 279tccgc ccaggctgcg ggagggaaga ggagggggct gtctcccgag gatagagctc 285cccat gcccttcctt tgtcgcccct ccccag cg gcc ttg ctg gcg gcc 29Ala Leu Leu Ala Ala 4gg ccc gaa gag ctt ctg tgc ttc acc gag cggttg gag gac ttg 295ly Pro Glu Glu Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp Leu 45 5 gtg tgt ttc tgg gag gaa gcg gcg agc gct ggg gtg ggc ccg ggc aac 2999 Val Cys Phe Trp Glu Glu Ala Ala Ser Ala Gly Val Gly Pro Gly Asn 65 7c agc ttc tcctac cag ctc ga gtgagtccga tccggcgggt gcctccaagg 3 Ser Phe Ser Tyr Gln Leu Glu 8gggag ggggtggggc agagctccct ggaggtcgta gcctcgtatg tcccctgctg 3gaggccc gacggcgcct ccagtcgtgg tcactggagg gaaacctgcg ggtccagggc 3cacgcct ctatgggccggggcgcgaac actcccgcga tcaccgctgg aacgcgaccc 3232 caaacatcag gctgggataa caacgcctcc aaatcgaggg taaggcgtta ctacgtcggg 3292 gctgggacgc cttctcgagg tagtatccaa aaggaggcca gcagtgctca tgcctgtaat 3352 cccaactctt tggaaggtcg agcggaagaa ccgcttgagc ccaggtgttcaagaccagcc 34caacac agcgagatcc ccgtctctta aaaaaaaatt agactgggcg cggctgcacg 3472 cctgtaatcc cagcactttg ggaggctgag gcgggcggat cacctgaggt cgggagtttg 3532 agagccagcc tggccaacat ggagaaactc tatctctact aaaaatacaa aattagccgg 3592 gcgtggtggc gcatgcctgtgatcccagct actcgggagg ctgaggcagg agaatcgctt 3652 gaacccggga ggcggaggtt gcggtgagcc gaggtagcgc cattgcactc cagcctgggc 37agagcg aaactccgtc tcaaaaaaaa aaaaaataaa agccaggcgt ggcgcgtgcc 3772 tgtggtctca actacttggg aagctgaggt gggaggatcc cttaagccccagaatttgag 3832 gctgcagtga gccatgatcg cgccactgca ctccagcctg ggcgacgaag gaacaccttg 3892 tcacacacac acacaaggct agaccttgtg tcacacatac acactgcccc ccacaggccg 3952 ggcaatgcca actccccggt cccccctccc aacctgctcc cttccctggg cgcatag g 4 gag cca tgg aag ctgtgt cgc ctg cac cag gct ccc acg gct cgt 4 Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala Pro Thr Ala Arg 85 9cg gtg cgc ttc tgg tgt tcg ctg cct aca gcc gac acg tcg agc 4 Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala Asp Thr Ser Ser gtg ccc cta gag ttg cgc gtc aca gca gcc tcc ggc gct ccg cga 4 Val Pro Leu Glu Leu Arg Val Thr Ala Ala Ser Gly Ala Pro Arg cac cgt gtc atc cac atc aat gaa gta g gtaagtgctc tgggaatgga 42His Arg Val Ile His IleAsn Glu Val ggagtggtcg gaggagaggg tctcagtcct cgcccacctg accaaccccc atgcctgcag 4265 tg ctc cta gac gcc ccc gtg ggg ctg gtg gcg cgg ttg gct gac gag 43Leu Leu Asp Ala Pro Val Gly Leu Val Ala Arg Leu Ala Asp Glu ggc cac gta gtgttg cgc tgg ctc ccg ccg cct gag aca ccc atg 436ly His Val Val Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met tct cac atc cgc tac gag gtg gac gtc tcg gcc ggc aac ggc gca 44Ser His Ile Arg Tyr Glu Val Asp Val Ser Ala Gly Asn GlyAla ggg agc gta cag agg gtgaggccag cccctacggc ccagccccca aagctccact 4463 Gly Ser Val Gln Arg tacggcc cagccacgcc tctcgaggtc gcgcccggtg ccgctttcag ggccggtccg 4523 taacatccca catcccatta ccctggtgct gaagaccgtt ccacgcccac agacacagcc 4583ccctttccta atgtcctcgc aagcctgttg aaccccaact tcttctccct ccggcccgta 4643 accctagacc cctttagcgc ccgggtccct ctacgagtgc tagcccagat attaaattgc 47gtcccg ccctttcgta ccagagactc tctctctgat tggccctgag ctttcttggg 4763 ctcctccccc tactcttatt ggtcccattgcaattctagg gcaccgtttt cctttcccct 4823 gattggctca gttccaccag ggcccgcccc cacgtcatct atttttgtct gctacgcgtc 4883 cctcgccctg attccgcccc cag gtg gag atc ctg gag ggc cgc acc gag tgt 4936 Val Glu Ile Leu Glu Gly Arg Thr Glu Cys 2gtg ctg agc aac ctg cggggc cgg acg cgc tac acc ttc gcc gtc cgc 4984 Val Leu Ser Asn Leu Arg Gly Arg Thr Arg Tyr Thr Phe Ala Val Arg 222gt atg gct gag ccg agc ttc ggc ggc ttc tgg agc gcc tgg tcg 5 Arg Met Ala Glu Pro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser225 23ag cct gtg tcg ctg ctg acg cct agc g gtgaggcccc aggcgggggt 5 Pro Val Ser Leu Leu Thr Pro Ser 24taggaggag ccagggcgaa tcacggggca agcccaccgc cctgacctcc tccccgcctc 5g ac ctg gac ccc ctc atc ctg acg ctc tcc ctc atc ctc gtggtc 5 Leu Asp Pro Leu Ile Leu Thr Leu Ser Leu Ile Leu Val Val 256tg gtg ctg ctg acc gtg ctc gcg ctg ctc tcc cac cgc cg 5232 Ile Leu Val Leu Leu Thr Val Leu Ala Leu Leu Ser His Arg Arg 265 27tgagctccc catttgggcg ctgggcccagactcctcccc gccaacggtc ctctttcact 5292 atggaaacct aggctcagag agagacacgc acttgcccaa ggtcacgcag taaggattca 5352 catcagtggc agggctggga tgcatgccag actagaccca gactcttcgt taacattttc 54cttggg gactttcacc tgattttcct tctacatcag gggctgccat ttcttgggtc 5472cctttgttag ttcctttccc cagtgtcatc acctttgtaa aatcaactag atggatttag 5532 tgaaagaatt taagaccctg aatgcctccg cacccctgcg gtcaagcttc tcagacacta 5592 tgatcagact agccgttctg aggtatttgt aattccaagc acacactagg tggtttcaca 5652 cccccaagct tttgcccatg ctgttccctctgcctggaat gcccttcctg ccttgtctgc 57caatct tctagtcgtc tttcatggcc ctgttcattt acttggttgg aaaatacaaa 5772 cagagtgcca aacatgtgcc aggcactgga gagagaatgg agaacaagct agaccctgac 5832 cacaagtccc tgaccttgtg gatctcaagt caacaaacaa gggacccaag aaatatttga 5892tgacaaattg taatgagtga tatcacagaa acaaacagaa tgtggtgaca tgacaggatg 5952 gtcagggaag gctccaggag gaggtgacat cagagtggaa acctgaagat tggaaggaag 6ccgcttg aaaagtgggg agaagaaaca gcaagtgcaa aggccctgag gtgggaatga 6tggaacg ttcagccagc ttcaagaattgccacatgca tggcctggca tggtggctca 6ctgtaat cccagcactt tgggatgccg aggcaggcag atcacctgag gttgggagtt 6gaccagc ctgaccaaca tggagaaacc ccacctctac taaaaataca aaactagcca 6252 agcgtggtgg cacatgcctg taatccccgc tactcgggag gctgaggcag gagaatcact 63cctggg aggtggaggt tgcgggtgag ccgagatcgt gccatcgcat tccagcctgg 6372 gcaataagag tgaaactccg tctcaaaaaa aaaaaaaaaa ttgccacatg gctagagtgg 6432 tatgtaaggg ggtgtggcag atattgagat gagggaggtg acaggggtca tataacgcag 6492 ggccttctgc agggtggtgg ggaggagtttggaatttttt ttttttttga gacagagtca 6552 ctcttgtcgc ccaagctgta gtgcagtgca gcagtcttgg ctcactgcaa ctctgcctcc 66ttcaag tgattctcct gcctcaaccg cctgagtagc tgagattaca ggcgtgcatg 6672 cccggctaat tttgtagttt tagtagagac ggggttccac catgttggcc aggctggtct 6732caaactcctg acctcaggtg atctgctcac atcagcctct caaagtgctg ggattatagg 6792 catgagccac cgtgcctggc ttggatttta tcctaaatgc ctctctcatt accccagaag 6852 gtaacataat atttatctat gaagtgacat catggacctc ctggaaaaat ctgggccagg 69tgggtt ttttaattta ttttattttattttttttag agatgggggt ctcactatgt 6972 ttcctaggct ggtcttgaac tcctgggttc aaatgatcct cccacctcag cctcccaaag 7tgggatt atagtgctgg tgtaaaccac tgcacctggc catggccagg attaaaggga 7tgaccaa ggtatattga actcctatgc acccttcaat accctgttcc atttaccctt 7tagggcc ttgctgatgc ttcagccaaa acccctgtcc cctggccctg atgtactcct 72ctccat tgtgatcaca gggaccaagt gtatctgtgc ctctatgact gggagtggag 7272 ggggaattgg tgagtattca atgagtcata tctatgtaac tatttatatt ggcttcaaca 7332 g g gct ctg aag cag aag atc tgg cct ggcatc ccg agc cca gag agc 7379 Ala Leu Lys Gln Lys Ile Trp Pro Gly Ile Pro Ser Pro Glu Ser 289tt gaa ggc ctc ttc acc acc cac aag ggt aac ttc cag 742he Glu Gly Leu Phe Thr Thr His Lys Gly Asn Phe Gln 295 3gtaggtggcc tggttgtcccctcagtgcct gggcttccct gcttcttgca gccaaactgc 748tctct gagcaggttg gtgctatttc ttcag ctg tgg ctg tac cag aat 7534 Leu Trp Leu Tyr Gln Asn 3ggc tgc ctg tgg tgg agc ccc tgc acc ccc ttc acg gag gac cca 7582 Asp Gly Cys Leu Trp Trp Ser Pro Cys ThrPro Phe Thr Glu Asp Pro 3325 cct gct tcc ctg gaa gtc ctc tca gag cgc tgc tgg ggg acg atg cag 763la Ser Leu Glu Val Leu Ser Glu Arg Cys Trp Gly Thr Met Gln 334tg gag ccg ggg aca gat gat gag ggc ccc ctg ctg gag cca gtg 7678 AlaVal Glu Pro Gly Thr Asp Asp Glu Gly Pro Leu Leu Glu Pro Val 345 35gc agt gag cat gcc cag gat acc tat ctg gtg ctg gac aaa tgg ttg 7726 Gly Ser Glu His Ala Gln Asp Thr Tyr Leu Val Leu Asp Lys Trp Leu 367tg ccc cgg aac ccg ccc agt gaggac ctc cca ggg cct ggt ggc agt 7774 Leu Pro Arg Asn Pro Pro Ser Glu Asp Leu Pro Gly Pro Gly Gly Ser 389ac ata gtg gcc atg gat gaa ggc tca gaa gca tcc tcc tgc tca 7822 Val Asp Ile Val Ala Met Asp Glu Gly Ser Glu Ala Ser Ser Cys Ser 395 4tct gct ttg gcc tcg aag ccc agc cca gag gga gcc tct gct gcc agc 787la Leu Ala Ser Lys Pro Ser Pro Glu Gly Ala Ser Ala Ala Ser 442ag tac act atc ctg gac ccc agc tcc cag ctc ttg cgt cca tgg 79Glu Tyr Thr Ile Leu Asp Pro SerSer Gln Leu Leu Arg Pro Trp 425 43ca ctg tgc cct gag ctg ccc cct acc cca ccc cac cta aag tac ctg 7966 Thr Leu Cys Pro Glu Leu Pro Pro Thr Pro Pro His Leu Lys Tyr Leu 445ac ctt gtg gta tct gac tct ggc atc tca act gac tac agc tca ggg8 Leu Val Val Ser Asp Ser Gly Ile Ser Thr Asp Tyr Ser Ser Gly 467cc cag gga gcc caa ggg ggc tta tcc gat ggc ccc tac tcc aac 8 Ser Gln Gly Ala Gln Gly Gly Leu Ser Asp Gly Pro Tyr Ser Asn 475 48ct tat gag aac agc ctt atccca gcc gct gag cct ctg ccc ccc agc 8 Tyr Glu Asn Ser Leu Ile Pro Ala Ala Glu Pro Leu Pro Pro Ser 49gtg gct tgc tct taggacacca ggctgcagat gatcagggat ccaatatgac 8 Val Ala Cys Ser 5agaacc agtgcagact caagacttat ggaacagggatggcgaggcc tctctcagga 8225 gcaggggcat tgctgatttt gtctgcccaa tccatcctgc tcaggaaacc acaaccttgc 8285 agtattttta aatatgtata gttttttttt gtatctatat atatatatac acatatgtat 8345 gtaagttttt ctaccatgat ttctacaaac accctttaag tcccatcttc ccctgggcat 84catagggatagaagtt aaagttcttg agcttattca gaagctggat ctgcaatctg 8465 aatgctactc ataacataac aaaatagtat gttaaacagc tcttaaatct tactggctta 8525 ccacattaaa tgatttctct ctcctaactc agctcaaatg ggcagccatc catggatgag 8585 tcagaggttc agactcttcc agtctgtagc tctaccttctcttagggtac ttagatggat 8645 cc 8647 2 5Homo sapiens 2 Met Asp His Leu Gly Ala Ser Leu Trp Pro Gln Val Gly Ser Leu Cys Leu Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp 2 Pro Lys Phe Glu Ser Lys Ala Ala Leu Leu Ala AlaArg Gly Pro Glu 35 4u Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp Leu Val Cys Phe Trp 5 Glu Glu Ala Ala Ser Ala Gly Val Gly Pro Gly Asn Tyr Ser Phe Ser 65 7 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9o ThrAla Arg Gly Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala Thr Ser Ser Phe Val Pro Leu Glu Leu Arg Val Thr Ala Ala Ser Ala Pro Arg Tyr His Arg Val Ile His Ile Asn Glu Val Val Leu Asp Ala Pro Val Gly Leu ValAla Arg Leu Ala Asp Glu Ser Gly His Val Val Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met Thr Ser Ile Arg Tyr Glu Val Asp Val Ser Ala Gly Asn Gly Ala Gly Ser Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu CysVal Leu Ser 2Leu Arg Gly Arg Thr Arg Tyr Thr Phe Ala Val Arg Ala Arg Met 222lu Pro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234eu Leu Thr Pro Ser Asp Leu Asp Pro Leu Ile Leu Thr Leu Ser 245 25eu Ile Leu Val Val Ile Leu Val Leu Leu Thr Val Leu Ala Leu Leu 267is Arg Arg Ala Leu Lys Gln Lys Ile Trp Pro Gly Ile Pro Ser 275 28ro Glu Ser Glu Phe Glu Gly Leu Phe Thr Thr His Lys Gly Asn Phe 29Leu Trp Leu TyrGln Asn Asp Gly Cys Leu Trp Trp Ser Pro Cys 33Thr Pro Phe Thr Glu Asp Pro Pro Ala Ser Leu Glu Val Leu Ser Glu 325 33rg Cys Trp Gly Thr Met Gln Ala Val Glu Pro Gly Thr Asp Asp Glu 345ro Leu Leu Glu Pro Val Gly Ser GluHis Ala Gln Asp Thr Tyr 355 36eu Val Leu Asp Lys Trp Leu Leu Pro Arg Asn Pro Pro Ser Glu Asp 378ro Gly Pro Gly Gly Ser Val Asp Ile Val Ala Met Asp Glu Gly 385

39Glu Ala Ser Ser Cys Ser Ser Ala Leu Ala Ser Lys Pro Ser Pro 44Gly Ala Ser Ala Ala Ser Phe Glu Tyr Thr Ile Leu Asp Pro Ser 423ln Leu Leu Arg Pro Trp Thr Leu Cys Pro Glu Leu Pro Pro Thr 435 44roPro His Leu Lys Tyr Leu Tyr Leu Val Val Ser Asp Ser Gly Ile 456hr Asp Tyr Ser Ser Gly Asp Ser Gln Gly Ala Gln Gly Gly Leu 465 478sp Gly Pro Tyr Ser Asn Pro Tyr Glu Asn Ser Leu Ile Pro Ala 485 49la Glu Pro Leu Pro ProSer Tyr Val Ala Cys Ser 53 A Homo sapiens misc_feature (65) Mature full-length EpoR mRNA 3 acttagaggc gcctggtcgg gaagggcctg gtcagctgcg tccggcggag gcagctgctg 6gctgt ggactgtgcc gggggtgggg gacggagggg caggagccct gggctccccg cgggggc tgtatcatgg accacctcgg ggcgtccctc tggccccagg tcggctccct tctcctg ctcgctgggg ccgcctgggc gcccccgcct aacctcccgg accccaagtt 24gcaaa gcggccttgc tggcggcccg ggggcccgaa gagcttctgt gcttcaccga 3ttggag gacttggtgt gtttctggga ggaagcggcgagcgctgggg tgggcccggg 36acagc ttctcctacc agctcgagga tgagccatgg aagctgtgtc gcctgcacca 42ccacg gctcgtggtg cggtgcgctt ctggtgttcg ctgcctacag ccgacacgtc 48tcgtg cccctagagt tgcgcgtcac agcagcctcc ggcgctccgc gatatcaccg 54tccacatcaatgaag tagtgctcct agacgccccc gtggggctgg tggcgcggtt 6gacgag agcggccacg tagtgttgcg ctggctcccg ccgcctgaga cacccatgac 66acatc cgctacgagg tggacgtctc ggccggcaac ggcgcaggga gcgtacagag 72agatc ctggagggcc gcaccgagtg tgtgctgagc aacctgcggggccggacgcg 78ccttc gccgtccgcg cgcgtatggc tgagccgagc ttcggcggct tctggagcgc 84cggag cctgtgtcgc tgctgacgcc tagcgacctg gaccccctca tcctgacgct 9ctcatc ctcgtggtca tcctggtgct gctgaccgtg ctcgcgctgc tctcccaccg 96ctctg aagcagaagatctggcctgg catcccgagc ccagagagcg agtttgaagg tcttcacc acccacaagg gtaacttcca gctgtggctg taccagaatg atggctgcct ggtggagc ccctgcaccc ccttcacgga ggacccacct gcttccctgg aagtcctctc agcgctgc tgggggacga tgcaggcagt ggagccgggg acagatgatgagggccccct tggagcca gtgggcagtg agcatgccca ggatacctat ctggtgctgg acaaatggtt tgccccgg aacccgccca gtgaggacct cccagggcct ggtggcagtg tggacatagt ccatggat gaaggctcag aagcatcctc ctgctcatct gctttggcct cgaagcccag cagaggga gcctctgctgccagctttga gtacactatc ctggacccca gctcccagct tgcgtcca tggacactgt gccctgagct gccccctacc ccaccccacc taaagtacct accttgtg gtatctgact ctggcatctc aactgactac agctcagggg actcccaggg cccaaggg ggcttatccg atggccccta ctccaaccct tatgagaacagccttatccc ccgctgag cctctgcccc ccagctatgt ggcttgctct taggacacca ggctgcagat tcagggat ccaatatgac tcagagaacc agtgcagact caagacttat ggaacaggga gcgaggcc tctctcagga gcaggggcat tgctgatttt gtctgcccaa tccatcctgc aggaaacc acaaccttgcagtattttta aatatgtata gtttttttat atgtatagtt ttt 858 DNA Homo sapiens CDS (5) EpoR Isoform on 6 insert 4 atg gac cac ctc ggg gcg tcc ctc tgg ccc cag gtc ggc tcc ctt tgt 48 Met Asp His Leu Gly Ala Ser Leu Trp Pro Gln Val Gly SerLeu Cys ctg ctc gct ggg gcc gcc tgg gcg ccc ccg cct aac ctc ccg gac 96 Leu Leu Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp 2 ccc aag ttc gag agc aaa gcg gcc ttg ctg gcg gcc cgg ggg ccc gaa Lys Phe Glu Ser Lys AlaAla Leu Leu Ala Ala Arg Gly Pro Glu 35 4g ctt ctg tgc ttc acc gag cgg ttg gag gac ttg gtg tgt ttc tgg Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp Leu Val Cys Phe Trp 5 gag gaa gcg gcg agc gct ggg gtg ggc ccg ggc aac tac agc ttc tcc 24lu Ala Ala Ser Ala Gly Val Gly Pro Gly Asn Tyr Ser Phe Ser 65 7 tac cag ctc gag gat gag cca tgg aag ctg tgt cgc ctg cac cag gct 288 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9c acg gct cgt ggt gcg gtg cgc ttctgg tgt tcg ctg cct aca gcc 336 Pro Thr Ala Arg Gly Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala acg tcg agc ttc gtg ccc cta gag ttg cgc gtc aca gca gcc tcc 384 Asp Thr Ser Ser Phe Val Pro Leu Glu Leu Arg Val Thr Ala Ala Ser gct ccg cga tat cac cgt gtc atc cac atc aat gaa gta gtg ctc 432 Gly Ala Pro Arg Tyr His Arg Val Ile His Ile Asn Glu Val Val Leu gac gcc ccc gtg ggg ctg gtg gcg cgg ttg gct gac gag agc ggc 48sp Ala Pro Val Gly Leu Val Ala ArgLeu Ala Asp Glu Ser Gly cac gta gtg ttg cgc tgg ctc ccg ccg cct gag aca ccc atg acg tct 528 His Val Val Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met Thr Ser atc cgc tac gag gtg gac gtc tcg gcc ggc aac ggc gca ggg agc 576His Ile Arg Tyr Glu Val Asp Val Ser Ala Gly Asn Gly Ala Gly Ser cag agg gtg gag atc ctg gag ggc cgc acc gag tgt gtg ctg agc 624 Val Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu Cys Val Leu Ser 2ctg cgg ggc cgg acg cgc tacacc ttc gcc gtc cgc gcg cgt atg 672 Asn Leu Arg Gly Arg Thr Arg Tyr Thr Phe Ala Val Arg Ala Arg Met 222ag ccg agc ttc ggc ggc ttc tgg agc gcc tgg tcg gag cct gtg 72lu Pro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234tg ctg acg cct agc gac ctg gac ccc ctc atc ctg acg ctc tcc 768 Ser Leu Leu Thr Pro Ser Asp Leu Asp Pro Leu Ile Leu Thr Leu Ser 245 25tc atc ctc gtg gtc atc ctg gtg ctg ctg acc gtg ctc gcg ctg ctc 8Ile Leu Val Val Ile Leu ValLeu Leu Thr Val Leu Ala Leu Leu 267ac cgc cgg atg gtc agg gaa ggc tcc agg agg agg tga 858 Ser His Arg Arg Met Val Arg Glu Gly Ser Arg Arg Arg 275 28 285 PRT Homo sapiens 5 Met Asp His Leu Gly Ala Ser Leu Trp Pro Gln Val Gly Ser LeuCys Leu Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp 2 Pro Lys Phe Glu Ser Lys Ala Ala Leu Leu Ala Ala Arg Gly Pro Glu 35 4u Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp Leu Val Cys Phe Trp 5 Glu Glu Ala Ala SerAla Gly Val Gly Pro Gly Asn Tyr Ser Phe Ser 65 7 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9o Thr Ala Arg Gly Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala Thr Ser Ser Phe Val Pro Leu Glu Leu Arg ValThr Ala Ala Ser Ala Pro Arg Tyr His Arg Val Ile His Ile Asn Glu Val Val Leu Asp Ala Pro Val Gly Leu Val Ala Arg Leu Ala Asp Glu Ser Gly His Val Val Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met Thr Ser Ile Arg Tyr Glu Val Asp Val Ser Ala Gly Asn Gly Ala Gly Ser Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu Cys Val Leu Ser 2Leu Arg Gly Arg Thr Arg Tyr Thr Phe Ala Val Arg Ala Arg Met 222lu Pro SerPhe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234eu Leu Thr Pro Ser Asp Leu Asp Pro Leu Ile Leu Thr Leu Ser 245 25eu Ile Leu Val Val Ile Leu Val Leu Leu Thr Val Leu Ala Leu Leu 267is Arg Arg Met Val Arg Glu GlySer Arg Arg Arg 275 28 954 DNA Homo sapiens CDS ( Isoform 2, intron 7 insert 6 atg gac cac ctc ggg gcg tcc ctc tgg ccc cag gtc ggc tcc ctt tgt 48 Met Asp His Leu Gly Ala Ser Leu Trp Pro Gln Val Gly Ser Leu Cys ctg ctcgct ggg gcc gcc tgg gcg ccc ccg cct aac ctc ccg gac 96 Leu Leu Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp 2 ccc aag ttc gag agc aaa gcg gcc ttg ctg gcg gcc cgg ggg ccc gaa Lys Phe Glu Ser Lys Ala Ala Leu Leu Ala Ala Arg GlyPro Glu 35 4g ctt ctg tgc ttc acc gag cgg ttg gag gac ttg gtg tgt ttc tgg Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp Leu Val Cys Phe Trp 5 gag gaa gcg gcg agc gct ggg gtg ggc ccg ggc aac tac agc ttc tcc 24lu Ala Ala Ser Ala GlyVal Gly Pro Gly Asn Tyr Ser Phe Ser 65 7 tac cag ctc gag gat gag cca tgg aag ctg tgt cgc ctg cac cag gct 288 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9c acg gct cgt ggt gcg gtg cgc ttc tgg tgt tcg ctg cct aca gcc336 Pro Thr Ala Arg Gly Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala acg tcg agc ttc gtg ccc cta gag ttg cgc gtc aca gca gcc tcc 384 Asp Thr Ser Ser Phe Val Pro Leu Glu Leu Arg Val Thr Ala Ala Ser gct ccg cga tat cac cgtgtc atc cac atc aat gaa gta gtg ctc 432 Gly Ala Pro Arg Tyr His Arg Val Ile His Ile Asn Glu Val Val Leu gac gcc ccc gtg ggg ctg gtg gcg cgg ttg gct gac gag agc ggc 48sp Ala Pro Val Gly Leu Val Ala Arg Leu Ala Asp Glu Ser Gly cac gta gtg ttg cgc tgg ctc ccg ccg cct gag aca ccc atg acg tct 528 His Val Val Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met Thr Ser atc cgc tac gag gtg gac gtc tcg gcc ggc aac ggc gca ggg agc 576 His Ile Arg Tyr Glu Val AspVal Ser Ala Gly Asn Gly Ala Gly Ser cag agg gtg gag atc ctg gag ggc cgc acc gag tgt gtg ctg agc 624 Val Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu Cys Val Leu Ser 2ctg cgg ggc cgg acg cgc tac acc ttc gcc gtc cgc gcg cgtatg 672 Asn Leu Arg Gly Arg Thr Arg Tyr Thr Phe Ala Val Arg Ala Arg Met 222ag ccg agc ttc ggc ggc ttc tgg agc gcc tgg tcg gag cct gtg 72lu Pro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234tg ctg acg cctagc gac ctg gac ccc ctc atc ctg acg ctc tcc 768 Ser Leu Leu Thr Pro Ser Asp Leu Asp Pro Leu Ile Leu Thr Leu Ser 245 25tc atc ctc gtg gtc atc ctg gtg ctg ctg acc gtg ctc gcg ctg ctc 8Ile Leu Val Val Ile Leu Val Leu Leu Thr Val Leu Ala LeuLeu 267ac cgc cgg gct ctg aag cag aag atc tgg cct ggc atc ccg agc 864 Ser His Arg Arg Ala Leu Lys Gln Lys Ile Trp Pro Gly Ile Pro Ser 275 28ca gag agc gag ttt gaa ggc ctc ttc acc acc cac aag ggt aac ttc 9Glu Ser Glu Phe GluGly Leu Phe Thr Thr His Lys Gly Asn Phe 29gtt ggt gct att tct tca gct gtg gct gta cca gaa tga 954 Gln Val Gly Ala Ile Ser Ser Ala Val Ala Val Pro Glu 337 PRT Homo sapiens 7 Met Asp His Leu Gly Ala Ser Leu Trp Pro Gln Val GlySer Leu Cys Leu Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp 2 Pro Lys Phe Glu Ser Lys Ala Ala Leu Leu Ala Ala Arg Gly Pro Glu 35 4u Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp Leu Val Cys Phe Trp 5 Glu Glu AlaAla Ser Ala Gly Val Gly Pro Gly Asn Tyr Ser Phe Ser 65 7 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9o Thr Ala Arg Gly Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala Thr Ser Ser Phe Val Pro Leu Glu LeuArg Val Thr Ala Ala Ser Ala Pro Arg Tyr His Arg Val Ile His Ile Asn Glu Val Val Leu Asp Ala Pro Val Gly Leu Val Ala Arg Leu Ala Asp Glu Ser Gly His Val Val Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met ThrSer Ile Arg Tyr Glu Val Asp Val Ser Ala Gly Asn Gly Ala Gly Ser Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu Cys Val Leu Ser 2Leu Arg Gly Arg Thr Arg Tyr Thr Phe Ala Val Arg Ala Arg Met 222luPro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234eu Leu Thr Pro Ser Asp Leu Asp Pro Leu Ile Leu Thr Leu Ser 245 25eu Ile Leu Val Val Ile Leu Val Leu Leu Thr Val Leu Ala Leu Leu 267is Arg Arg Ala Leu LysGln Lys Ile Trp Pro Gly Ile Pro Ser 275 28ro Glu Ser Glu Phe Glu Gly Leu Phe Thr Thr His Lys Gly Asn Phe 29Val Gly Ala Ile Ser Ser Ala Val Ala Val Pro Glu 337 DNA Homo sapiens CDS (4) EpoR Isoform 3, intron 7unspliced 8 atg gac cac ctc ggg gcg tcc ctc tgg ccc cag gtc ggc tcc ctt tgt 48 Met Asp His Leu Gly Ala Ser Leu Trp Pro Gln Val Gly Ser Leu Cys ctg ctc gct ggg gcc gcc tgg gcg ccc ccg cct aac ctc ccg gac 96 Leu Leu Leu Ala Gly Ala Ala TrpAla Pro Pro Pro Asn Leu Pro Asp 2 ccc aag ttc gag agc aaa gcg gcc ttg ctg gcg gcc cgg ggg ccc gaa Lys Phe Glu Ser Lys Ala Ala Leu Leu Ala Ala Arg Gly Pro Glu 35 4g ctt ctg tgc ttc acc gag cgg ttg gag gac ttg gtg tgt ttc tgg Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp Leu Val Cys Phe Trp 5 gag gaa gcg gcg agc gct ggg gtg ggc ccg ggc aac tac agc ttc tcc 24lu Ala Ala Ser Ala Gly Val Gly Pro Gly Asn Tyr Ser Phe Ser 65 7 tac cag ctc gag gat gag cca tgg aag ctgtgt cgc ctg cac cag gct 288 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9c acg gct cgt ggt gcg gtg cgc ttc tgg tgt tcg ctg cct aca gcc 336 Pro Thr Ala Arg Gly Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala acgtcg agc ttc gtg ccc cta gag ttg cgc gtc aca gca gcc tcc 384 Asp Thr Ser Ser Phe Val Pro Leu Glu Leu Arg Val Thr Ala Ala Ser gct ccg cga tat cac cgt gtc atc cac atc aat gaa gta gtg ctc 432 Gly Ala Pro Arg Tyr His Arg Val Ile His Ile AsnGlu Val Val Leu gac gcc ccc gtg ggg ctg gtg gcg cgg ttg gct gac gag agc ggc 48sp Ala Pro Val Gly Leu Val Ala Arg Leu Ala Asp Glu Ser Gly cac gta gtg ttg cgc tgg ctc ccg ccg cct gag aca ccc atg acg tct 528 His ValVal Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met Thr Ser atc cgc tac gag gtg gac gtc tcg gcc ggc aac ggc gca ggg agc 576 His Ile Arg Tyr Glu Val Asp Val Ser Ala Gly Asn Gly Ala Gly Ser cag agg gtg gag atc ctg gag ggc cgcacc gag tgt gtg ctg agc 624 Val Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu Cys Val Leu Ser 2ctg cgg ggc cgg acg cgc tac acc ttc gcc gtc cgc gcg cgt atg 672 Asn Leu Arg Gly Arg Thr Arg Tyr Thr Phe Ala Val Arg Ala Arg Met 222ag ccg agc ttc ggc ggc ttc tgg agc gcc tgg tcg gag cct gtg 72lu Pro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234tg ctg acg cct agc gac ctg gac ccc ctc atc ctg acg ctc tcc 768 Ser Leu Leu Thr Pro Ser

Asp Leu Asp Pro Leu Ile Leu Thr Leu Ser 245 25tc atc ctc gtg gtc atc ctg gtg ctg ctg acc gtg ctc gcg ctg ctc 8Ile Leu Val Val Ile Leu Val Leu Leu Thr Val Leu Ala Leu Leu 267ac cgc cgg gct ctg aag cag aag atc tgg cctggc atc ccg agc 864 Ser His Arg Arg Ala Leu Lys Gln Lys Ile Trp Pro Gly Ile Pro Ser 275 28ca gag agc gag ttt gaa ggc ctc ttc acc acc cac aag ggt aac ttc 9Glu Ser Glu Phe Glu Gly Leu Phe Thr Thr His Lys Gly Asn Phe 29gta ggtggc ctg gtt gtc ccc tca gtg cct ggg ctt ccc tgc ttc 96al Gly Gly Leu Val Val Pro Ser Val Pro Gly Leu Pro Cys Phe 33ttg cag cca aac tgc agg cct ctc tga 987 Leu Gln Pro Asn Cys Arg Pro Leu 325 9 328 PRT Homo sapiens 9 Met Asp His LeuGly Ala Ser Leu Trp Pro Gln Val Gly Ser Leu Cys Leu Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp 2 Pro Lys Phe Glu Ser Lys Ala Ala Leu Leu Ala Ala Arg Gly Pro Glu 35 4u Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp LeuVal Cys Phe Trp 5 Glu Glu Ala Ala Ser Ala Gly Val Gly Pro Gly Asn Tyr Ser Phe Ser 65 7 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9o Thr Ala Arg Gly Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala Thr Ser Ser Phe Val Pro Leu Glu Leu Arg Val Thr Ala Ala Ser Ala Pro Arg Tyr His Arg Val Ile His Ile Asn Glu Val Val Leu Asp Ala Pro Val Gly Leu Val Ala Arg Leu Ala Asp Glu Ser Gly His Val Val Leu Arg TrpLeu Pro Pro Pro Glu Thr Pro Met Thr Ser Ile Arg Tyr Glu Val Asp Val Ser Ala Gly Asn Gly Ala Gly Ser Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu Cys Val Leu Ser 2Leu Arg Gly Arg Thr Arg Tyr Thr Phe Ala ValArg Ala Arg Met 222lu Pro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234eu Leu Thr Pro Ser Asp Leu Asp Pro Leu Ile Leu Thr Leu Ser 245 25eu Ile Leu Val Val Ile Leu Val Leu Leu Thr Val Leu Ala Leu Leu 267is Arg Arg Ala Leu Lys Gln Lys Ile Trp Pro Gly Ile Pro Ser 275 28ro Glu Ser Glu Phe Glu Gly Leu Phe Thr Thr His Lys Gly Asn Phe 29Val Gly Gly Leu Val Val Pro Ser Val Pro Gly Leu Pro Cys Phe 33Leu Gln ProAsn Cys Arg Pro Leu 325 DNA Homo sapiens CDS ( Isoform 4, intron 5 unspliced gac cac ctc ggg gcg tcc ctc tgg ccc cag gtc ggc tcc ctt tgt 48 Met Asp His Leu Gly Ala Ser Leu Trp Pro Gln Val Gly Ser Leu Cys ctg ctcgct ggg gcc gcc tgg gcg ccc ccg cct aac ctc ccg gac 96 Leu Leu Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp 2 ccc aag ttc gag agc aaa gcg gcc ttg ctg gcg gcc cgg ggg ccc gaa Lys Phe Glu Ser Lys Ala Ala Leu Leu Ala Ala Arg GlyPro Glu 35 4g ctt ctg tgc ttc acc gag cgg ttg gag gac ttg gtg tgt ttc tgg Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp Leu Val Cys Phe Trp 5 gag gaa gcg gcg agc gct ggg gtg ggc ccg ggc aac tac agc ttc tcc 24lu Ala Ala Ser Ala GlyVal Gly Pro Gly Asn Tyr Ser Phe Ser 65 7 tac cag ctc gag gat gag cca tgg aag ctg tgt cgc ctg cac cag gct 288 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9c acg gct cgt ggt gcg gtg cgc ttc tgg tgt tcg ctg cct aca gcc336 Pro Thr Ala Arg Gly Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala acg tcg agc ttc gtg ccc cta gag ttg cgc gtc aca gca gcc tcc 384 Asp Thr Ser Ser Phe Val Pro Leu Glu Leu Arg Val Thr Ala Ala Ser gct ccg cga tat cac cgtgtc atc cac atc aat gaa gta gtg ctc 432 Gly Ala Pro Arg Tyr His Arg Val Ile His Ile Asn Glu Val Val Leu gac gcc ccc gtg ggg ctg gtg gcg cgg ttg gct gac gag agc ggc 48sp Ala Pro Val Gly Leu Val Ala Arg Leu Ala Asp Glu Ser Gly cac gta gtg ttg cgc tgg ctc ccg ccg cct gag aca ccc atg acg tct 528 His Val Val Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met Thr Ser atc cgc tac gag gtg gac gtc tcg gcc ggc aac ggc gca ggg agc 576 His Ile Arg Tyr Glu Val AspVal Ser Ala Gly Asn Gly Ala Gly Ser cag agg gtg gag atc ctg gag ggc cgc acc gag tgt gtg ctg agc 624 Val Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu Cys Val Leu Ser 2ctg cgg ggc cgg acg cgc tac acc ttc gcc gtc cgc gcg cgtatg 672 Asn Leu Arg Gly Arg Thr Arg Tyr Thr Phe Ala Val Arg Ala Arg Met 222ag ccg agc ttc ggc ggc ttc tgg agc gcc tgg tcg gag cct gtg 72lu Pro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234tg ctg acg cctagc ggt gag gcc cca ggc ggg ggt gta gga gga 768 Ser Leu Leu Thr Pro Ser Gly Glu Ala Pro Gly Gly Gly Val Gly Gly 245 25cc agg gcg aat cac ggg gca agc cca ccg ccc tga 8Arg Ala Asn His Gly Ala Ser Pro Pro Pro 26RT Homo sapiens Asp His Leu Gly Ala Ser Leu Trp Pro Gln Val Gly Ser Leu Cys Leu Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp 2 Pro Lys Phe Glu Ser Lys Ala Ala Leu Leu Ala Ala Arg Gly Pro Glu 35 4u Leu Leu Cys Phe Thr Glu ArgLeu Glu Asp Leu Val Cys Phe Trp 5 Glu Glu Ala Ala Ser Ala Gly Val Gly Pro Gly Asn Tyr Ser Phe Ser 65 7 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9o Thr Ala Arg Gly Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala Thr Ser Ser Phe Val Pro Leu Glu Leu Arg Val Thr Ala Ala Ser Ala Pro Arg Tyr His Arg Val Ile His Ile Asn Glu Val Val Leu Asp Ala Pro Val Gly Leu Val Ala Arg Leu Ala Asp Glu Ser Gly His ValVal Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met Thr Ser Ile Arg Tyr Glu Val Asp Val Ser Ala Gly Asn Gly Ala Gly Ser Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu Cys Val Leu Ser 2Leu Arg Gly Arg Thr Arg TyrThr Phe Ala Val Arg Ala Arg Met 222lu Pro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234eu Leu Thr Pro Ser Gly Glu Ala Pro Gly Gly Gly Val Gly Gly 245 25la Arg Ala Asn His Gly Ala Ser Pro Pro Pro 262747 DNA Homo sapiens CDS (4) EpoR Isoform 5, exon 6 skipped gac cac ctc ggg gcg tcc ctc tgg ccc cag gtc ggc tcc ctt tgt 48 Met Asp His Leu Gly Ala Ser Leu Trp Pro Gln Val Gly Ser Leu Cys ctg ctc gct ggg gcc gcc tgg gcg ccc ccgcct aac ctc ccg gac 96 Leu Leu Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp 2 ccc aag ttc gag agc aaa gcg gcc ttg ctg gcg gcc cgg ggg ccc gaa Lys Phe Glu Ser Lys Ala Ala Leu Leu Ala Ala Arg Gly Pro Glu 35 4g ctt ctg tgcttc acc gag cgg ttg gag gac ttg gtg tgt ttc tgg Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp Leu Val Cys Phe Trp 5 gag gaa gcg gcg agc gct ggg gtg ggc ccg ggc aac tac agc ttc tcc 24lu Ala Ala Ser Ala Gly Val Gly Pro Gly Asn Tyr Ser PheSer 65 7 tac cag ctc gag gat gag cca tgg aag ctg tgt cgc ctg cac cag gct 288 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9c acg gct cgt ggt gcg gtg cgc ttc tgg tgt tcg ctg cct aca gcc 336 Pro Thr Ala Arg Gly Ala ValArg Phe Trp Cys Ser Leu Pro Thr Ala acg tcg agc ttc gtg ccc cta gag ttg cgc gtc aca gca gcc tcc 384 Asp Thr Ser Ser Phe Val Pro Leu Glu Leu Arg Val Thr Ala Ala Ser gct ccg cga tat cac cgt gtc atc cac atc aat gaa gta gtgctc 432 Gly Ala Pro Arg Tyr His Arg Val Ile His Ile Asn Glu Val Val Leu gac gcc ccc gtg ggg ctg gtg gcg cgg ttg gct gac gag agc ggc 48sp Ala Pro Val Gly Leu Val Ala Arg Leu Ala Asp Glu Ser Gly cac gta gtg ttg cgctgg ctc ccg ccg cct gag aca ccc atg acg tct 528 His Val Val Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met Thr Ser atc cgc tac gag gtg gac gtc tcg gcc ggc aac ggc gca ggg agc 576 His Ile Arg Tyr Glu Val Asp Val Ser Ala Gly Asn Gly Ala GlySer cag agg gtg gag atc ctg gag ggc cgc acc gag tgt gtg ctg agc 624 Val Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu Cys Val Leu Ser 2ctg cgg ggc cgg acg cgc tac acc ttc gcc gtc cgc gcg cgt atg 672 Asn Leu Arg Gly Arg ThrArg Tyr Thr Phe Ala Val Arg Ala Arg Met 222ag ccg agc ttc ggc ggc ttc tgg agc gcc tgg tcg gag cct gtg 72lu Pro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234tg ctg acg cct agc ggg ctc tga 747 Ser Leu LeuThr Pro Ser Gly Leu 245 PRT Homo sapiens Asp His Leu Gly Ala Ser Leu Trp Pro Gln Val Gly Ser Leu Cys Leu Leu Ala Gly Ala Ala Trp Ala Pro Pro Pro Asn Leu Pro Asp 2 Pro Lys Phe Glu Ser Lys Ala Ala Leu Leu Ala Ala Arg GlyPro Glu 35 4u Leu Leu Cys Phe Thr Glu Arg Leu Glu Asp Leu Val Cys Phe Trp 5 Glu Glu Ala Ala Ser Ala Gly Val Gly Pro Gly Asn Tyr Ser Phe Ser 65 7 Tyr Gln Leu Glu Asp Glu Pro Trp Lys Leu Cys Arg Leu His Gln Ala 85 9o Thr Ala ArgGly Ala Val Arg Phe Trp Cys Ser Leu Pro Thr Ala Thr Ser Ser Phe Val Pro Leu Glu Leu Arg Val Thr Ala Ala Ser Ala Pro Arg Tyr His Arg Val Ile His Ile Asn Glu Val Val Leu Asp Ala Pro Val Gly Leu Val Ala ArgLeu Ala Asp Glu Ser Gly His Val Val Leu Arg Trp Leu Pro Pro Pro Glu Thr Pro Met Thr Ser Ile Arg Tyr Glu Val Asp Val Ser Ala Gly Asn Gly Ala Gly Ser Gln Arg Val Glu Ile Leu Glu Gly Arg Thr Glu Cys Val LeuSer 2Leu Arg Gly Arg Thr Arg Tyr Thr Phe Ala Val Arg Ala Arg Met 222lu Pro Ser Phe Gly Gly Phe Trp Ser Ala Trp Ser Glu Pro Val 225 234eu Leu Thr Pro Ser Gly Leu 245 NA Artificial sequence Syntheticoligonucleotide gcggct gcttccttcc aa 22 NA Artificial sequence Synthetic oligonucleotide ggagcg tacagagggt ggag 24 NA Artificial sequence Synthetic oligonucleotide aaatag caccaacctg gaag 24 NA Artificial sequenceSynthetic oligonucleotide cgccta gcgacctgga cc 22 NA Artificial sequence Synthetic oligonucleotide tttggc tgcaagaagc a 2 DNA Artificial sequence Synthetic oligonucleotide ccaggg cgaatcacgg 2 DNA Artificialsequence Synthetic oligonucleotide 2caaac tcgctctctg 2 DNA Artificial sequence Synthetic oligonucleotide 2agagc ccgctaggcg t 2BR>* * * * *

US Patent: 
7598057

Use of cytokine receptors as biomarkers and therapeutic targets in human cancer

We are your best, most user-friendly source for searching patents and patent attorneys on the Internet.