Register | Login | Help |
 
Bookmark

Title: 

Virus vectors and methods of making and administering the same



Patent ID: 

US7172893


Issue Date: 

February 06, 2007



Abstract:

The present invention provides genetically-engineered parvovirus capsids and viruses designed to introduce a heterologous gene into a target cell. The parvoviruses of the invention provide a repertoire of vectors with altered antigenic properties, packaging capabilities, and/or cellular tropisms as compared with current AAV vectors.


Download PDF Powered by Patents.com   (Registration Required)

Inventor(s): 
Rabinowitz;  Joseph E.  (Carrboro,  NC,  US) , Email and Contact Information
Samulski;  Richard Jude  (Chapel Hill,  NC,  US) , Email and Contact Information
Xiao;  Weidong  (Jenkintown,  PA,  US) Email and Contact Information
Assignee:  University of North Carolina at Chapel Hill;  (Chapel Hill,  NC,  US)
Agent:  Myers Bigel Sibley & Sajovec, PA
Application No.:  10/205,942
Filing Date:  July 26, 2002
Gov't Interest:  STATEMENT OF FEDERAL SUPPORT This was made, in part, with government support under grant numbers DK42701 and 5-32938 0-110 from the National Institutes of Health. The United States government has certain rights to this invention.
Primary Class:  435/235.1
Other Classes:  424/93.1  435/239  435/471  435/5 
Field of Search:  427/93.1,93.2,93.21,93.3,93.6 435/235.1,455 536/23.1,23.4
Intern'l Class:  C12N 7/00 (20060101)  A01N 63/00 (20060101)  C12N 15/74 (20060101)  C12N 7/02 (20060101)  C12Q 1/70 (20060101) 
Primary Examiner:Woitach; Joseph
US Patent Document(s):
  5139941    Muzyczka et al.    August 01, 1992
  5436146    Shenk et al.    July 01, 1995
  5478745    Samulski et al.    December 01, 1995
  5589377    Lebkowski et al.    December 01, 1996
  5622856    Natsoulis    April 01, 1997
  5658785    Johnson    August 01, 1997
  5681731    Lebkowski et al.    October 01, 1997
  5753500    Shenk et al.    May 01, 1998
  5756283    Wilson et al.    May 01, 1998
  5773289    Samulski et al.    June 01, 1998
  5780280    Lebkowski et al.    July 01, 1998
  5780447    Nienhuis    July 01, 1998
  5786211    Johnson    July 01, 1998
  5834441    Philip et al.    November 01, 1998
  5843742    Natsoulis et al.    December 01, 1998
  5846528    Podsakoff et al.    December 01, 1998
  5846546    Hurwitz et al.    December 01, 1998
  5856152    Wilson et al.    January 01, 1999
  5858351    Podsakoff et al.    January 01, 1999
  5858775    Johnson    January 01, 1999
  5861171    Philip et al.    January 01, 1999
  5861314    Philip et al.    January 01, 1999
  5863541    Samulski et al.    January 01, 1999
  5866552    Wilson et al.    February 01, 1999
  5866696    Carter et al.    February 01, 1999
  5869305    Samulski et al.    February 01, 1999
  5871982    Wilson et al.    February 01, 1999
  5872005    Wang et al.    February 01, 1999
  5874304    Zolotukhin et al.    February 01, 1999
  5874556    Lupton et al.    February 01, 1999
  5882652    Valdes et al.    March 01, 1999
  5905040    Mazzara et al.    May 01, 1999
  5916563    Young et al.    June 01, 1999
  5922315    Roy    July 01, 1999
  5945335    Colosi    August 01, 1999
  5952221    Kurtzman et al.    September 01, 1999
  5962274    Parks    October 01, 1999
  5962313    Podsakoff et al.    October 01, 1999
  6001371    Young et al.    December 01, 1999
  6156303    Russell et al.    December 01, 2000
  6468524    Chiorini et al.    October 01, 2002
  6491907    Rabinowitz et al.    December 01, 2002
  6759237    Wilson et al.    July 01, 2004
  20040057931    WIlson et al.    March 01, 2004
  20040057932    Wilson et al.    March 01, 2004
  20040057933    Wilson et al.    March 01, 2004
Foreign Reference(s):199942205  AU  June 01, 2003
WO 95/28493  WO  October 01, 1995
WO 96/00587  WO  January 01, 1996
WO 96/36364  WO  November 01, 1996
WO 97/05266  WO  February 01, 1997
WO 97/38423  WO  October 01, 1997
WO 98/09524  WO  March 01, 1998
WO 98/11244  WO  March 01, 1998
WO 98/32842  WO  July 01, 1998
WO 98/41240  WO  September 01, 1998
WO 99/61601  WO  December 01, 1999
WO 99/67393  WO  December 01, 1999
WO 00/28061  WO  May 01, 2000
WO 01/05991  WO  January 01, 2001
WO 01/05990  WO  February 01, 2001
Other References:Horiuchi et al. J Gen Virol. Jun. 1994; 75 (Pt 6):1319-28, Mapping of determinants of the host range for canine cells in the genome of canine parvovirus using canine parvovirus/mink enteritis virus chimeric viruses. cited by examiner .
Wang et al: J Virol. Mar. 1996; 70(3):1668-77. Rescue and replication of adeno-associated virus type 2 as well as vector DNA sequences from recombinant plasmids containing deletions in the viral inverted terminal repeats: selective encapsidation of viral gen. cited by examiner .
Srivastava et al. Proc. Natl Acad Sci U S A. Oct. 1989; 86(20):8078-82. Construction of a recombinant human parvovirus B19: adeno-associated virus 2 (AAV) DNA inverted terminal repeats are functional in a AAV-B19 hybrid virus. cited by examiner .
Bartlett et al. Viral Vectors, Chapter 4, pp. 55-73. cited by examiner .
Chapman et al. Virology (1993) 194:491-508. cited by examiner .
Brown et al. Virology (1994), 198:477-488. cited by examiner .
Rabinowitz et al., "Insertional Mutagenesis of AAV2 Capsid and the Production of Recombinant Virus," Virology 265:274-285 (1999). cited by other .
Bloom et al., "Characterization of Chimeric Full-Length Molecular Clones of Aleutian Mink Disease Parvoviurs (ADV): Identification of a Determinant Governing Replication of ADV in Cell Culture," Journal of Virology: 5976-5988 (Oct. 1993). cited by other .
Spitzer et al., "Tropic determinant for canine parvovirus and feline panleukopenia virus functions through the capsid protein VP2," Journal of General Virology 78: 925-928 (1997). cited by other .
Xiao et al., "Gene Therapy Vectors Based on Adeno-Associated Virus Type 1," Journal of Virology 73(5): 3994-4003 (May 1999). cited by other .
Anderson, "Human Gene Therapy," Nature 392: 25-30 (1998). cited by other .
Antonietti et al.; "Characterization of the Cell Type-Specific Determinant in the Genome of Minute Virus of Mice," Journal of Virology 62:2 552-557 (Feb. 1988). cited by other .
Ball-Goodrich et al.; Two Amino Acid Substitutions within the Capsid Are Coordinately Required for Acquisition of Fibrotropism by the Lymphotropic Strain of Minute Virus of Mice, Journal of Virology 66:6 3415-3423 (Jun. 1992). cited by other .
Bartlett et al., "Genetics and Biology of Adeno-Associated Virus," Viral Vectors 55-73 (1995). cited by other .
Bartlett et al.; Targeted adeno-associated virus vector transduction of nonpermissive cells mediated by a bispecific F(ab'.gamma.).sub.2 antibody, Nature Biotechnology 17 181-191 (Feb. 1999). cited by other .
Bloom et al.; Construction of Pathogenic Molecular Clones of Aleutian Mink Disease Parvovirus that Replicate Both in Vivo and in Vitro, Virology 251 288-296 (1998). cited by other .
Brown et al.; Chimeric Parvovirus B19 Capsids for the Presentation of Foreign Epitopes, Virology 198 477-488 (1994). cited by other .
Brown et al.; Erythrocyte P Antigen: Cellular Receptor for B19 Parvovirus, Science 262 114-117 (Oct. 1, 1993). cited by other .
Chang et al.; Multiple Amino Acids in the Capsid Structure of Canine Parvovirus Coordinately Determine the Canine Host Range and Specific Antigenic and Hemagglutination Properties, Journal of Virology 66:12 6858-6867 (Dec. 1992). cited by other .
Chapman et al.; Structure, Sequence, and Function Correlation Among Parvoviruses, Virology 194:491-508 (1993). cited by other .
Chiorini et al.; Adeno-Associated Virus (AAV) Type 5 Rep Protein Cleaves a Unique Terminal Resolution Site Compared with Other AAV Serotypes, Journal of Virology 73:5 4293-4298 (May 1999). cited by other .
Chiorini et al.; Cloning and Characterization of Adeno-Associated virus Type 5, Journal of Virology 73:2 1309-1319 (Feb. 1999). cited by other .
Chiorini et al.; Cloning of Adeno-Associated Virus Type 4 (AAV4) and Generation of Recombinant AAV4 Particles, Journal of Virology 71:9 6823-6833 (Sep. 1997). cited by other .
Fu et al., Viral sequences enable efficient and tissue-specific expression of transgenes in Xenopus, Nature Biotechnology 16 253-257 (Mar. 1998). cited by other .
Gao et al.; High-Titer Adeno-Associated Viral Vectors from a Rep/Cap Cell Line and Hybrid Shuttle Virus, Human Gene Therapy 9:23253-2362 (Nov. 1, 1998). cited by other .
Gardiner et al.; "Mapping of the Fibrotropic and Lymphotropic Host Range Determinants of the Parvovirus Minute Virus of Mice," Journal of Virology 62:8 2605-2613 (Aug. 1988). cited by other .
Girod et al.; Genetic capsid modifications allow efficient re-targeting of adeno-associated virus type 2, Nature Medicine 5:9 1052-1056 (Sep. 1999). cited by other .
Goldman et al.; Targeted Gene Delivery to Kaposi's Sarcoma Cells via the Fibroblast Growth Factor Receptor, Cancer Research 57 1447-1451 (Apr. 15, 1997). cited by other .
Hermonat et al.; Genetics of Adeno-Associated Virus: Isolation and Preliminary Characterization of Adeno-Associated Virus Type 2 Mutants, Journal of Virology 51:2 329-339 (Aug. 1984). cited by other .
Horiuchi et al.; Mapping of Determinants of the Host Range for Canine Cells in the Genome of Canine Parvovirus Using Canine Parvovirus/Mink Enteritis Virus Chimeric Viruses, Journal of General Virology 75:1319-1328 (1994). cited by other .
International Search Report, PCT/US99/26505, Date of Mailing: Mar. 22, 2000. cited by other .
Li et al.; Role for Highly Regulated rep Gene Expression in Adeno-Associated Virus Vector Production, Journal of Virology 71:7 5236-5243 (Jul. 1997). cited by other .
Maxwwell et al.; Targeting a Feline Parvovirus to Human Tumor Cells (abstract), Cold Spring Harbor Laboratory, Vector Targeting Strategies for Therapeutic Gene Delivery meeting (Mar. 11-14, 1999) p. 87. cited by other .
Miyamura et al.; Parvovirus particles as platforms for protein presentation, Proc. Natl. Acad. Sci. USA 91 8507-8511 (Aug. 1994). cited by other .
Moskalenko et al.; Epitope Mapping of Human Anti-Adeno-Associated Virus Type 2 Neutralizing Antibodies: Implications for Gene Therapy and Virus Structure, Journal of Virology 74:4 1761-1766 (Feb. 2000). cited by other .
Muralidhar et al.; Site-Directed Mutagenesis of Adeno-Associated Virus Type 2 Structural Protein Initiation Codons: Effects on Regulation of Synthesis and Biological Activity, Journal of Virology 68:1 170-176 (Jan. 1994). cited by other .
Muramatsu et al.; Nucleotide Sequencing and Generation of an Infectious Clone of Adeno-Associated Virus 3, Virology 221 208-217 (1996). cited by other .
Parrish et al.; "Canine Host Range and a Specific Epitope Map along with Variant Sequences in the Capsid Protein Gene of Canine Parvovirus and Related Feline, Mink, and Raccoon Parvoviruses," Virology 166:293-307 (1988). cited by other .
Parrish et al.; "Rapid Antigeneic-Type Replacement and DNA Sequence Evolution of Canine Parvovirus," Journal of Virology 65:12 6544-6552 (Dec. 1991). cited by other .
Ponnazhagan et al.; Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes, Journal of Virology 72:6 5224-5230 (Jun. 1998). cited by other .
Rabinowitz et a.; Adeno-Associated Virus Expression Systems for Gene Transfer, Current Opinion in Biotechnology 9:5 470-475 (Oct. 1998). cited by other .
Rabinowitz et al.; Targeted Adeno-Associated Virus (abstract), Cold Spring Harbor Laboratory, Vector Targeting Strategies for Therapeutic Gene Delivery meeting (Mar. 11-14, 1999) p. 82. cited by other .
Ruffing et al.; Mutations in the carboxy terminus of adeno-associated virus 2 capsid proteins affect viral infectivity: lack of an RGD integrin-binding motif, Journal of General Virology 75 3385-3392 (1994). cited by other .
Russell et al.; Retroviral vectors displaying functional antibody fragments, Nucleic Acids Research 21:5 1081-1085 (1993). cited by other .
Rutledge et al.; Infectious Clones and Vectors Derived from Adeno-Associated Virus (AAV) Serotypes Other Than AAV Type 2, Journal of Virology 72:1 309-319 (Jan. 1998). cited by other .
Sedlik et al.; Recombinant parvovirus-like particles as an antigen carrier: A novel nonreplicative exogenous antigen to elicit protective antiviral cytotoxic T cells, Proc. Natl. Acad. Sci. USA 97 7503-7508 (Jul. 1997). cited by other .
Smuda et al.; Adeno-Associated Viruses Having Nonsense Mutations in the Capsid Genes: Growth in Mammalian Cells Containing an Inducible Amber Suppressor, Virology 184 310-318 (1991). cited by other .
Somia et al.; Generation of targeted retroviral vectors by using single-chain variable fragment: An approach to in vivo gene delivery, Proc. Natl. Acad. Sci. USA 92 7570-7574 (Aug. 1995). cited by other .
Spitzer et al.; Species specificity for transduction of cultured cells by a recombinant lulll roden parvovirus genome encapsidated by canine parvovirus or feline panleukopenia virus, Journal of General Virology 77 1787-1792 (1996). cited by other .
Srivastava et al.; Construction of a recombinant human parvovirus B19: Adeno-associated virus 2 (AAV) DNA inverted terminal repeats are functional in an AAV-B19 hybrid virus, Proc. Natl. Acad. Sci. USA 86 8078-8082 (Oct. 1989). cited by other .
Tsao et al.; "The Three-Dimensional Structure of Canine Parvovirus and Its Functional Implications," Science 251:1456-1464 (Mar. 22, 1991). cited by other .
Verma et al., "Gene therapy-promises, problems and prospects," Nature 389:239-242 (1997). cited by other .
Williams & Wilkins, "Stedman's Medical Dictionary" (1995). cited by other .
Xiao et al.; Efficient Long-Term Gene Transfer into Muscle Tissue of Immunocompetent Mice by Adeno-Associated Virus Vector, Journal of Virology 70:11 8098-8108 (Nov. 1996). cited by other .
Xiao et al.; Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus, J. Virol. 72:3 2224 (15 pp.) (Mar. 1998). cited by other .
Yang et al.; Development of Novel Cell Surface CD34-Targeted Recombinant Adenoassociated Virus Vectors for Gene Therapy, Human Gene Therapy 9 1929-1937 (Sep. 1, 1998). cited by other.

Parent Case Text: RELATED APPLICATION INFORMATION This application is a divisional of U.S. patent application Ser. No. 09/438,268, filed Nov. 10, 1999 now U.S. Pat. No. 6,491,907, which claims the benefit of U.S. Provisional Application Ser. No. 60/107,840, filed Nov. 10, 1998, and Ser. No. 60/123,651, filed Mar. 10, 1999, which are incorporated herein by reference in their entireties.


Claim(s):

That which is claimed is:

1. A hybrid virus particle comprising: a parvovirus capsid; and a nucleic acid comprising at least one adeno-associated virus (AAV) serotype 2 inverted terminal repeatpackaged within said parvovirus capsid, subject to the proviso that if said parvovirus capsid is an AAV capsid, the serotypes of said AAV capsid and said at least one AAV inverted terminal repeat are different.

2. The hybrid virus particle of claim 1, wherein said nucleic acid comprises at least one heterologous nucleotide sequence.

3. The hybrid virus particle of claim 2 comprising two AAV inverted terminal repeats that flank said at least one heterologous nucleotide sequence.

4. The hybrid virus particle of claim 2, wherein said at least one heterologous nucleotide sequence encodes a protein or peptide.

5. The hybrid virus particle of claim 4, wherein said protein or peptide is a therapeutic protein or peptide.

6. The hybrid virus particle of claim 4, wherein said protein or peptide is an immunogenic protein or peptide.

7. The hybrid virus particle of claim 4, wherein said at least one heterologous nucleotide sequence encodes dystrophin, a mini-dystrophin, a clotting factor, .beta.-glucocerebrosidase, erythropoietin, cystic fibrosis transmembrane regulatorprotein, a cytokine, .beta.-globin, a hormone, .alpha.-globin or a growth factor.

8. The hybrid virus particle of claim 2, wherein said at least one heterologous nucleotide sequence encodes an untranslated RNA.

9. The hybrid virus particle of claim 1, wherein said parvovirus capsid is an autonomous parvovirus capsid.

10. The hybrid virus particle of claim 1, wherein said parvovirus capsid is a B19 capsid.

11. The hybrid virus particle of claim 1, wherein said parvovirus capsid is an AAV capsid.

12. The hybrid virus particle of claim 11, wherein: said AAV capsid is of a serotype selected from the group consisting of AAV serotypes 1, 3, 4, 5 and 6.

13. The hybrid virus particle of claim 12 selected from the group consisting of: (a) a hybrid virus particle comprising an AAV serotype-1 capsid and at least one AAV serotype-2 inverted terminal repeat. (b) a hybrid virus particle comprisingan AAV serotype-3 capsid and at least one AAV serotype-2 inverted terminal repeat, (c) a hybrid virus particle comprising an AAV serotype-4 capsid and at least one AAV serotype-2 inverted terminal repeat, (d) a hybrid virus particle comprising an AAVserotype-5 capsid and at least one AAV serotype-2 inverted terminal repeat, and (e) a hybrid virus particle comprising an AAV serotype-6 capsid and at least one AAV serotype-2 inverted terminal repeat.

14. The hybrid virus particle of claim 1, wherein said nucleic acid does not comprise AAV cap genes or AAV rep genes.

15. A pharmaceutical formulation comprising the hybrid virus particle of claim 1 in a pharmaceutically-acceptable carrier.

16. An isolated nucleic acid for producing the hybrid virus particle of claim 1, wherein said isolated nucleic acid comprises parvovirus cap genes and adeno-associated virus (AAV) rep genes, subject to the proviso that if said parvovirus capgenes are AAV cap genes, the serotypes of said AAV cap genes and said AAV rep genes are different.

17. The isolated nucleic acid of claim 16, wherein said parvovirus cap genes are operably associated with an authentic parvovirus promoter.

18. The isolated nucleic acid of claim 16, wherein said parvovirus cap genes are B19 cap genes.

19. The isolated nucleic acid of claim 18, wherein said AAV rep genes are AAV serotype-2 rep genes.

20. The isolated nucleic acid of claim 16, wherein said cap genes are AAV cap genes.

21. The isolated nucleic acid of claim 20, wherein said AAV cap genes are operably associated with an authentic AAV promoter.

22. The isolated nucleic acid of claim 21, wherein said authentic AAV promoter is an AAV p40 promoter.

23. The isolated nucleic acid of claim 20, wherein: said AAV cap genes are of a serotype selected from the group consisting of AAV serotypes 1, 3, 4, 5 and 6; and said AAV rep genes are of a serotype selected from the group consisting of AAVserotypes 1, 2, 3, 4, 5 and 6.

24. The isolated nucleic acid of claim 23 selected from the group consisting of: (a) an isolated nucleic acid comprising AAV serotype-1 cap genes and AAV serotype-2 rep genes, (b) an isolated nucleic acid comprising AAV serotype-3 cap genes andAAV serotype-2 rep genes, (c) an isolated nucleic acid comprising AAV serotype-4 cap genes and AAV serotype-2 rep genes, (d) an isolated nucleic acid comprising AAV serotype-5 cap genes and AAV serotype-2 rep genes, and (e) an isolated nucleic acidcomprising AAV serotype-6 cap genes and AAV serotype-2 rep genes.

25. A vector comprising the isolated nucleic acid of claim 16.

26. The vector of claim 25, wherein said vector is selected from the group consisting of plasmids, naked DNA vectors, bacterial artificial chromosomes, yeast artificial chromosomes, and viral vectors.

27. The vector of claim 26, wherein said vector is a plasmid.

28. A cell comprising the vector of claim 25.

29. The cell of claim 28, wherein said cell is selected from the group consisting of bacterial, protozoan, yeast, fungus, plant, and animal cells.

30. A method of delivering a nucleotide sequence to a cell, in vitro comprising introducing into a cell the hybrid virus particle according to claim 2.

31. The method of claim 30, wherein the heterologous nucleotide sequence is expressed in the cell.

32. The method of claim 31, wherein the protein or peptide is an immunogenic protein or peptide.

33. The method of claim 30, wherein the parvovirus capsid is a B19 capsid.

34. The method of claim 30, wherein the at least one heterologous nucleotide sequence encodes a protein or peptide.

35. The method of claim 34, wherein the protein or peptide is a therapeutic protein or peptide.

36. The method of claim 34, wherein the at least one heterologous nucleotide sequence encodes dystrophin, a mini-dystrophin, a clotting factor, .beta.-glucocerebrosidase, or a growth factor.

37. The method of claim 30, wherein the heterologous nucleotide sequence encodes an untranslated RNA.

38. The method of claim 30, wherein the cell is selected from the group consisting of a neural cell, lung cell, retinal cell, epithelial cell, muscle cell, pancreatic cell, hepatic cell, myocardial cell, bone cell, spleen cell, keratinocyte,fibroblast, endothelial cell, prostate cell, germ cell, progenitor cell, and a stem cell.

39. The method of claim 30, wherein the parvovirus capsid is an AAV capsid.

40. The method of claim 39, wherein: the AAV capsid is of a serotype selected from the group consisting of AAV serotypes 1, 3, 4, 5 and 6.

41. The method of claim 40, wherein the hybrid virus particle is selected from the group consisting of: (a) a hybrid virus particle comprising an AAV serotype-1 capsid and at least one AAV serotype-2 inverted terminal repeat, (b) a hybrid virusparticle comprising an AAV serotype-3 capsid and at least one AAV serotype-2 inverted terminal repeat, (c) a hybrid virus particle comprising an AAV serotype-4 capsid and at least one AAV serotype-2 inverted terminal repeat, (d) a hybrid virus particlecomprising an AAV serotype-5 capsid and at least one AAV serotype-2 inverted terminal repeat, (e) a hybrid virus particle comprising an AAV serotype-6 capsid and at least one AAV serotype-2 inverted terminal repeat.

42. A cell comprising a vector comprising: parvovirus cap genes, adeno-associated virus (AAV) rep genes, and a nucleic acid comprising at least one AAV serotype 2 inverted terminal repeat, subject to the proviso that if said parvovirus capgenes are AAV cap genes, said at least one AAV inverted terminal repeat is of a different AAV serotype than said cap genes.

43. The cell of claim 42, wherein said cell is a mammalian cell.

44. A cell comprising parvovirus cap genes and adeno-associated virus (AAV) rep genes stably integrated into the genome of the cell, subject to the proviso that if said parvovirus cap genes are AAV cap genes, the serotypes of said AAV cap genesand said AAV rep genes are different.

45. The cell of claim 44 further comprising a nucleic acid comprising at least one AAV serotype 2 inverted terminal repeat, subject to the proviso that if said parvovirus cap genes are AAV cap genes, the serotypes of said AAV cap genes and saidat least one AAV inverted terminal repeat are different.

46. A method of producing a hybrid virus particle, comprising: providing a cell with adeno-associated virus (AAV) rep genes, parvovirus cap genes, a nucleic acid comprising at least one AAV serotype 2 inverted terminal repeat, and helperfunctions for generating a productive AAV infection; subject to the proviso that if the parvovirus cap genes are AAV cap genes, the serotypes of the AAV cap genes and the at least one AAV inverted terminal repeat are different, and allowing assembly ofthe hybrid virus particles.

47. The method of claim 46, further comprising collecting the hybrid virus particles.

48. The method of claim 46, wherein the nucleic acid comprises at least one heterologous nucleotide sequence.

49. The method of claim 46, wherein the parvovirus cap genes and AAV rep genes are provided by one or more transcomplementing packaging vectors.

50. The method of claim 46, wherein the parvovirus cap genes and AAV rep genes are provided by a plasmid.

51. The method of claim 46, wherein the parvovirus cap genes and AAV rep genes are provided by an adenovirus vector.

52. The method of claim 46, wherein the parvovirus cap genes and AAV rep genes are stably integrated into the genome of the cell.

53. The method of claim 46, wherein the parvovirus cap genes are AAV cap genes.

54. A hybrid virus particle produced by the method of claim 46.



Description:

FIELD OF THE INVENTION

The present invention relates to virus vectors, in particular, modified parvovirus vectors and methods of making and administering the same.

BACKGROUND

Parvoviruses are small, single-stranded, non-enveloped DNA viruses between twenty to thirty nanometers in diameter. The genomes of parvoviruses are approximately 5000 nucleotides long, containing two open reading frames. The left-hand openreading frame codes for the proteins responsible for replication (Rep), while the right-hand open reading frame encodes the structural proteins of the capsid (Cap). All parvoviruses have virions with icosahedral symmetry composed of a major Cap protein,usually the smallest of the Cap proteins, and one or two minor Cap proteins. The Cap proteins are generated from a single gene that initiates translation from

Most parvoviruses have narrow host ranges; the tropism of B19 is for human erythroid cells (Munshi et al., (1993) J. Virology 67:562), while canine parvovirus has a tropism for lymphocytes in adult dogs (Parrish et al., (1988) Virology 166:293;Chang et al., (1992) J. Virology 66:6858). Adeno-associated virus, on the other hand, can replicate well in canine, mouse, chicken, bovine, monkey, as well as numerous human lines, when the appropriate helper virus is present. In the absence of helpervirus, AAV will infect and establish latency in all of these cell types, suggesting that the AAV receptor is common and conserved among species. Several serotypes of AAV have-been identified, including serotypes 1, 2, 3, 4, 5 and 6.

Adeno-associated virus (AAV) is a dependent parvovirus twenty nanometers in size which requires co-infection with another virus (either adenovirus or certain members of the herpes virus group) to undergo a productive infection in cultured cells. In the absence of co-infection with helper virus, the AAV virion binds to a cellular receptor and enters the cell, migrating to the nucleus, and delivers a single-stranded DNA genome that can establish latency by integration into the host chromosome. The interest in AAV as a vector has centered around the biology of this virus. In addition to its unique life-cycle, AAV has a broad host range for infectivity (human, mouse, monkey, dog, etc.), is ubiquitous in humans, and is completely nonpathogenic. The finite packaging capacity of this virus (4.5 kb) has restricted the use of this vector in the past to small genes or cDNAs. To advance the prospects of AAV gene delivery, vectors sufficient to carry larger genes must be developed. In addition,virions that specifically and efficiently target defined cell types without transducing others will be required for clinical application.

The capsid proteins of AAV2 are Vp1, 2, and 3 with molecular weights of 87, 73, and 62 kDa, respectively. Vp3 represents nearly 80% of the total protein in intact virions, while Vp1 and Vp2 represent 10% each (Muzyczka, (1992) Curr. TopicsMicrobiol. Immunol. 158:97; Rolling et al., (1995) Molec. Biotech. 3:9; Wistuba et al. (1997) J. Virology 71:1341). Early studies of AAV2 support that all three capsid subunits are required to extract single stranded genomes from the pool ofreplicating double stranded DNA. These genomes are then sequestered into preformed immature particles that maturate to infectious particles. These particles have a density between 1.32 and 1.41 g/mL in cesium chloride and sediment between 60S and 125Sin sucrose (Myers et al., (1981) J. Biological Chem. 256:567; Myers et al., (1980) J. Virology 35:65).

Previous mutagenesis studies of AAV2 capsids have shown that insertions and deletions in the Vp3 domain completely inhibit the accumulation of single stranded virions and production of infectious particles (Hermonat et al., (1984) J. Virology51:329; Ruffing et al., (1992) J. Virology 66:6922). Yang et al., (1998) Human Gene Therapy 9:1929, have reported the insertion of a sequence encoding the variable region of a single chain antibody against human CD34 at the 5' end of the AAV2 Vp1, Vp2or Vp3 coding regions. These investigators observed extremely low transduction of CD34 expressing KG-1 cells by AAV virions containing the Vp2 fusion protein (1.9 transducing units/ml or less, sentence spanning pages 1934 35). KG-1 cells are reportedlynot permissive to infection by a wild-type rAAV vector. These results with the Vp2 fusion AAV are suspect as transduction of KG-1 cells by this virus was essentially insensitive to an anti-AAV capsid antibody (430 vs. 310 transducing units/ml; Table2), whereas transduction of HeLa cells was markedly reduced by this antibody (63,2000 vs. <200 transducing units/ml; Table 2). No characterization of the putative fusion virions was undertaken to confirm that the particles contained the Vp2 fusionprotein, the antibody was expressed on the capsid surface, or that the particles bound CD34 proteins. In addition, rAAV particles could only be produced if all three wild-type capsid subunits were provided, in addition to the chimeric subunit (Page1934, Col. 2, lines 5 12). Collectively, these results suggest the chimeric subunits were not incorporated into viable AAV particles, and the low level of chimeric protein observed in target cells was, in fact, due to cellular uptake of chimeric capsidprotein or protein aggregates by other mechanisms.

Several studies have demonstrated that parvovirus capsid proteins can be mutated and virion assembly studied. In one study, the coding region for 147 amino acids of the hen egg white lysozyme was substituted for B19 Vp1 unique coding sequence. This modification resulted in purified empty particles that retained lysozyme enzymatic activity (Miyamura et al., (1994) Proc. Nat. Acad. Sci. USA 91:8507). In addition, expression of peptides (9 and 13 residues) in B19 Vp2 resulted in emptyparticles that were immunogenic in mice supporting surface presentation of the insertions (Brown et al., (1994) Virology 198:477). In a more recent study, the CD8+CTL epitope (residues 118 132) against lymphocytic choriomeningitis virus (LCAAV)nucleoprotein was inserted into the Vp2 capsid protein of porcine parvovirus (ppv) (Sedlik et al., (1997) Proc. Nat. Acad. Sci. USA 94:7503). This capsid protein, with the epitope cloned at the N-terminus, self-assembled when expressed in abaculovirus system. This chimeric virus-like particle was then used to immunize mice against a lethal challenge from LCAAV. While these studies evaluated capsid structure and assembly, they did not address the issue of packaging B19 genomes into thealtered capsids.

Recombinant (r)AAV vectors require only the inverted terminal repeat sequences in cis of the 4679 bases to generate virus. All other viral sequences are dispensable and may be supplied in trans (Muzyczka, (1992) Curr. Topics Microbiol. Immunol. 158:97). Attractive characteristics of AAV vectors for gene therapy are the stability, genetic simplicity, and ease of genetic manipulation of this virus. While each of these factors remains valid, some obstacles to the application of rAAVvectors have recently come to light. These include inefficiency of vector transduction and packaging constraints. It is not surprising, given the cryptic nature of this virus, that new insights into its biology have surfaced only after extensiveresearch with rAAV vectors, which are more easily assayed compared with wild-type AAV.

With respect to the efficiency of vector transduction, several recent studies have shown great promise in terms of duration of transgene expression in vivo; however, there has been a shortfall in the efficiency of transduction, which wasunexpected based on previous results in vitro (Flotte et al., (1993) Proc. Nat. Acad. Sci. USA 90:10613). One of the first experiments in rodents to demonstrate the utility of rAAV vectors in vivo was aimed at transduction of brain tissue in rat(Kaplitt et al., (1994) Nature Genet. 7:148). In addition to brain, muscle has been found to be efficiently transduced in vivo by AAV vectors, demonstrating long term gene expression (at least 1.5 years), lack of immune response, and no vector toxicity(Xiao et al., (1996) J. Virol. 70:8098; Clark et al., (1996) Hum. Gene Ther. 8:659; Fisher et at, (1997) Nat Med. 3:306; Monahan et al., (1998) Gene Ther. 5:40). The primary steps that influence efficient vector delivery are virus entry andconversion of second strand synthesis (see Ferrari et al., (1996) J. Virology 70:3227 34).

The overall success of AAV as a general-purpose viral vector depends on the ability to package larger than full-length AAV genomes (5 kb) into rAAV vectors. Studies by Dong et al., (1996) Hum. Gene Ther. 7:2101, have determined the packaginglimitations using rAAV vectors as between 104% and 108%. This packaging restriction precludes the use of a number of important genes currently being tested for human gene therapy (e.g., the dystrophin gene or current mini-dystrophin constructs).

Accordingly, there remains a need in the art for improved virus vectors with greater packaging limits and transduction efficiency than AAV vectors. In addition, there remains a need for virus vectors with altered tropisms as compared with AAVvectors.

SUMMARY OF THE INVENTION

The present invention provides parvovirus vectors for introducing (i.e., delivering) and, preferably, expressing a nucleotide sequence in a cell. The invention is based, in part, on the discovery that parvovirus vectors possessing uniquestructures and characteristics as compared with current vectors may be created by substituting or inserting a foreign sequence (i.e., an exogenous amino acid sequence) into a parvovirus capsid. The invention further provides novel vectors that aregenerated by cross-packaging a parvovirus genome (preferably, an AAV genome) within a different parvovirus capsid. The present invention provides a repertoire of novel parvovirus vectors that may possess unique and advantageous antigenic properties,packaging capabilities, and cellular tropisms as compared with current AAV vectors.

These and other aspects of the invention are set forth in more detail in the description of the invention below.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the insertional mutagenesis strategy for the AAV2 capsid. A cassette containing the Kan.sup.r gene flanked by EcoRV and Nae I sites were cloned into the plasmid pAV2Cap. pAV2Cap, which contains the open reading frame of AAV2capsid, was partially digested with Hae III, Nla IV, and Rsa I separately so that unit length products were isolated. The 43 positions of restriction sites for these enzymes are shown above the diagram of the capsid open reading frame. The position ofthe Kan.sup.r insert was mapped by restriction enzyme digestion and in some cases sequenced. Once the position was determined the Kan.sup.r gene was removed by EcoRV digestion, and the capsid domain subcloned into pACG. This strategy resulted ininserting a 12 base pair fragment, with half Nae I sites flanking a unique Eco RV site, into the respective Hae III, Nla IV, and Rsa I sites. The twelve base pairs code for four amino acids one of which is shown above the diagram of pACG2.

FIG. 2 shows the expression of capsid proteins in cells transfected with wild-type and insertion mutant helper plasmids of pACG2. Cell lysates from 293 cells transfected with 1, H2285; 2, H2634; 3, H2690; 4, N2944; 5, H2944; 6, H3595; 7, H4047;8, wild-type were analyzed by acrylamide gel electrophoresis and immunoblotting with the B1 monoclonal antibody and detected by peroxidase-conjugated secondary antibody. On the left of the Western blot are the positions of the molecular weight standardsand on the right are the positions of the major capsid protein, VP3 and the minor capsid proteins VP2 and VP1.

FIG. 3 shows expression of a Lac Z transgene in cells infected with insertion mutant or wild-type virus. Panel A. Dot blot hybridization to the Lac Z transgene. Cell lysates of adenovirus infected 293 cells transfected with the insertion mutantor wild-type helper plasmids and the Lac Z transgene containing vector were subjected to cesium chloride isopycnic gradient. Fractions from the gradient were treated with DNase and RNase prior to dot blotting to remove unpackaged nucleic acids, fractionnumbers are labeled above the dot blot. Fraction 1 has a density range of 1.377 1.41, fraction 2 has a density range of 1.39 1.435, and fraction 3 has a density range of 1.42 1.45. The .beta.-galactosidase gene was used as the control template, toestimate particle numbers. Estimates of particle number where derived assuming 1 .mu.g of 1000 bp DNA has 9.1.times.10.sup.11 molecules. Panel B. Infection of HeLa cells with 1.75.times.10.sup.8 particles from various insertion mutants and wild-typecapsid containing the Lac Z transgene. Cells expressing the transgene appear blue when stained with X-gal.

FIG. 4 shows characterization of the insertion mutants using electron microscopy. 200 uL samples of each virus from peak fraction of gradient were dialyzed against 1.times.PBS+1 mM MgCl.sub.2 and speed-vac desiccated, then resuspended in 20 uLof distilled H.sub.2O. Samples were negative stained with 2% phosphotungstic acid. Panel A. rAAV2 with wild-type virion. Infectious insertion viruses H2690 (Panel B), and H2591 (Panel C). Non-infectious viruses H2285 (Panel D), H2634 (Panel E) and,H3595 (Panel F). The black bar is 100 nm; the magnification is equivalent in each panel.

FIG. 5 presents analysis of virion composition from wild-type and various insertion mutant viruses isolated from cell lysates by cesium chloride gradient centrifugation. Peak fractions of virus were determined by dot blot hybridization anddialyzed against 1.times.PBS+1 mM MgCl.sub.2. Foreach, viral sample between 1.0.times.10.sup.9 and 2.5.times.10.sup.9 particles were used. Virions from 1. Wild-type rAAV2; 2. H2285; 3. R2349; 4. H2591; 5. H2634; 6. H2690; 7. H3766; and 8. N4160were analyzed by acrylamide gel electrophoresis and immunoblotting with the B1 monoclonal antibody and detected by peroxidase-conjugated secondary antibody. On the left of the Western blot are the positions of the molecular weight standards and on theright are the positions of the major capsid protein, VP3 and the minor capsid proteins VP2 and VP1.

FIG. 6 shows the analysis of wild-type and non-infectious insertion mutant virus batch binding to heparin agarose by dot blot hybridization. Viruses with wild-type virions and insertion in the capsids were dialysed against 0.5.times.PBS and 0.5mM MgCl.sub.2. One hundred microliters of each virus was bound to 100 .mu.l of heparin agarose, at room temperature for one hour. Samples were washed six times with 500 .mu.of wash buffer each, followed by elution with 100 .mu.of 0.5, 1.0 and 1.5M NaCleach, and the supernatant from each wash and elution step was saved. Twenty microliters of supernatant from each step and 20 .mu.l of the agarose pellet were used for dot blot hybridization. Pairs of washes were combined and 1/50 of the total volumefrom each pair was used for dot blot hybridization, while one fifth of the elution supernatant and agarose bed volumes were used. The 100% bound was equivalent to one fifth of the virus added to the heparin agarose. Samples 1. rAAV2 with wild-typevirion; 2. H2285; 3. H2416; 4. H2634; and 5. H3761.

FIG. 7 is schematic representation of the AAV2/4 subunit chimeras.

FIG. 8 is a diagram of the helper plasmid pAAV2/B19p2Cap. The coding region of the B19 major structural protein, Vp2, was seamlessly cloned from pAAV-Vp3 to TAA.

FIG. 9 provides EM analysis of chimeric virus particles produced with pAAV/B19Vp2Cap.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides parvovirus vectors for the delivery of nucleic acids to cells, both in vitro and in vivo. Alternatively, the invention provides novel capsid structures for use, e.g., as vaccines or for delivery of compounds tocells (e.g., as described by U.S. Pat. No. 5,863,541 to Samulski et al., the disclosure of which is incorporated herein by reference in its entirety). The parvovirus vectors of the present invention utilize the advantageous properties of AAV vectors,and may mitigate some of the problems encountered with these vectors. In particular embodiments, the parvovirus vectors may possess different or altered characteristics from AAV vectors, including but not limited to, antigenic properties, packagingcapabilities, and/or cellular tropism.

The term "parvovirus" as used herein encompasses all parvoviruses, including autonomously-replicating parvoviruses and dependoviruses. The autonomous parvoviruses include members of the genera Parvovirus, Erythrovirus, Densovirus, Iteravirus,and Contravirus. Exemplary autonomous parvoviruses include, but are not limited to, mouse minute virus, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, and B19 virus. Otherautonomous parvoviruses are known to those skilled in the art. See, e.g., BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (3d ed., Lippincoff-Raven Publishers).

The genus Dependovirus contains the adeno-associated viruses AAV), including but not limited to, AAV type 1, AAV type 2, AAV type 3, AAV type 4, AAV type 5, AAV type 6, avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV. See, e.g.,BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (3d ed., Lippincott-Raven Publishers).

The parvovirus particles, capsids and genomes of the present invention are preferably from AAV.

The term "tropism" as used herein refers to entry of the virus into the cell, optionally and preferably, followed by expression of sequences carried by the viral genome in the cell, e.g., for a recombinant virus, expression of the heterologousnucleotide sequences(s). Those skilled in the art will appreciate that transcription of a heterologous nucleic acid sequence from the viral genome may not be initiated in the absence of trans-acting factors, e.g., for an inducible promoter or otherwiseregulated nucleic acid sequence. In the case of AAV, gene expression from the viral genome may be from a stably integrated provirus, from a non-integrated episome, as well as any other form in which the virus may take within the cell.

The parvovirus vectors of the present invention are useful for the delivery of nucleic acids to cells both in vitro and in vivo. In particular, the inventive vectors may be advantageously employed to deliver or transfer nucleic acids to animalcells. Nucleic acids of interest include nucleic acids encoding peptides and proteins, preferably therapeutic (e.g., for medical or veterinary uses) or immunogenic (e.g., for vaccines) peptides or proteins.

A "therapeutic" peptide or protein is a peptide or protein that may alleviate or reduce symptoms that result from an absence or defect in a protein in a cell or subject. Alternatively, a "therapeutic" peptide or protein is one that otherwiseconfers a benefit to a subject, e.g., anti-cancer effects. Therapeutic peptides and proteins include, but are not limited to, CFTR (cystic fibrosis transmembrane regulator protein), dystrophin (including the protein product of dystrophin mini-genes,see, e.g, Vincent et al., (1993) Nature Genetics 5:130), utrophin (Tinsley et al., (1996) Nature 384:349), clotting factors (Factor XIII, Factor IX, Factor X, etc.), erythropoietin, the LDL receptor, lipoprotein lipase, ornithine transcarbamylase,.beta.-globin, .alpha.-globin, spectrin, .alpha.-antitrypsin, adenosine deaminase, hypoxanthine guanine phosphoribosyl transferase, .beta.-glucocerebrosidase, sphingomyelinase, lysosomal hexosaminidase, branched-chain keto acid dehydrogenase, hormones,growth factors (e.g., insulin-like growth factors 1 and 2, platelet derived growth factor, epidermal growth factor, nerve growth factor, neurotrophic factor -3 and -4, brain-derived neurotrophic factor, glial derived growth factor, transforming growthfactor-.alpha.and -.beta., and the like), cytokines (e.g., .alpha.-interferon, .beta.-interferon, interferon-.gamma., interleukin-2, interleukin-4, interleukin 12, granulocyte-macrophage colony stimulating factor, lymphotoxin), suicide gene products(e.g., herpes simplex virus thymidine kinase, cytosine deaminase, diphtheria toxin, cytochrome P450, deoxycytidine kinase, and tumor necrosis factor), proteins conferring resistance to a drug used in cancer therapy, tumor suppressor gene products (e.g.,p53, Rb, Wt-1, NF1, VHL, APC, and the like), and any other peptide or protein that has a therapeutic effect in a subject in need thereof.

Further exemplary therapeutic peptides or proteins include those that may used in the treatment of a disease condition including, but not limited to, cystic fibrosis (and other diseases of the lung), hemophilia A, hemophilia B, thalassemia,anemia and other blood disorders, AIDS, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, epilepsy, and other neurological disorders, cancer, diabetes mellitus, muscular dystrophies (e.g., Duchenne, Becker),Gaucher's disease, Hurler's disease, adenosine deaminase deficiency, glycogen storage diseases and other metabolic defects, retinal degenerative diseases (and other diseases of the eye), and diseases of solid organs (e.g., brain, liver, kidney, heart).

The present invention also provides vectors useful as vaccines. The use of parvoviruses as vaccines is known in the art (see, e.g., Miyamura et al., (1994) Proc. Nat. Acad. Sci USA 91:8507; U.S. Pat. No. 5,916,563 to Young et al., 5,905,040to Mazzara et al., U.S. Pat. Nos. 5,882,652, U.S. Pat. No. 5,863,541 to Samulski et al.; the disclosures of which are incorporated herein in their entirety by reference). The antigen may be presented in the parvovirus capsid, as described below forchimeric and modified parvovirus vectors. Alternatively, the antigen may be expressed from a heterologous nucleic acid introduced into a recombinant AAV genome and carried by the inventive parvoviruses. Any immunogen of interest may be provided by theparvovirus vector. Immunogens of interest are well-known in the art and include, but are not limited to, immunogens from human immunodeficiency virus, influenza virus, gag proteins, tumor antigens, cancer antigens, bacterial antigens, viral antigens,and the like.

As a further alternative, the heterologous nucleic acid sequence may encode a reporter peptide or protein (e.g., an enzyme). Reporter proteins are known in the art and include, but are not limited to, Green Fluorescent Protein,.beta.-galactosidase, alkaline phosphatase, chloramphenicol acetyltransferase, and the like.

Alternatively, in particular embodiments of the invention, the nucleic acid of interest may encode an antisense nucleic acid, a ribozyme (e.g., as described in U.S. Pat. No. 5,877,022), RNAs that effect spliceosome-mediated trans-splicing(Puffaraju et al., (1999) Nature Biotech. 17:246), or other non-translated RNAs, such as "guide" RNAs (Gorman et al., (1998) Proc. Nat. Acad. Sci. USA 95:4929; U.S. Pat. No. 5,869,248 to Yuan et al.), and the like.

Except as otherwise indicated, standard methods known to those skilled in the art may be used for the construction of rAAV genomes, transcomplementing packaging vectors, transiently and stably transfected packaging cells according to the presentinvention. Such techniques are known to those skilled in the art. See, e.g., SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed. (Cold Spring Harbor, N.Y., 1989); F. M. AUSUBEL et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (GreenPublishing Associates, Inc. and John Wiley & Sons, Inc., New York).

I. Hybrid Viruses.

The hybrid parvovirus vectors of the present invention may overcome some of the disadvantages of AAV vectors for delivery of nucleic acids or other molecules to cells.

A "hybrid" parvovirus, as used herein, is an AAV genome encapsidated within a different (i.e., another, foreign, exogenous) parvovirus capsid. Alternatively stated, a hybrid parvovirus has a parvovirus genome encapsidated within a differentparvovirus capsid. As used herein, by "different" it is intended that the AAV genome is packaged within another parvovirus capsid, e.g., the parvovirus capsid is from another AAV serotype or from an autonomous parvovirus.

Preferably, the parvovirus genome is an AAV genome (preferably a recombinant AAV genome). It is also preferred that the AAV genome comprises one or more AAV inverted terminal repeat(s) as described below. Typically, as described in more detailbelow, a recombinant AAV (rAAV) genome will retain only those elements required in cis (e.g., one or more AAV ITRs), with the rest of the genome (e.g., the rep/cap genes) being provided in trans.

In particular preferred embodiments the parvovirus capsid is an AAV capsid (i.e., a hybrid AAV vector). According to this embodiment, the AAV capsid packages an AAV genome of a different serotype (and preferably, of a different serotype from theone or more AAV ITRs). For example, a recombinant AAV type 1, 2, 3, 4, 5 or 6 genome may be encapsidated within an AAV type 1, 2, 3, 4, 5 or 6 capsid, provided that the AAV capsid and genome (and preferably, the one or more AAV ITRs) are of differentserotypes.

Illustrative hybrid parvoviruses according to the present invention are an AAV type 2 genome packaged within an AAV type 1, 3, 4, 5 or 6 capsid. In particular preferred embodiments, the hybrid parvovirus comprises an AAV type 3, type 4, or type5 capsid packaging an AAV type 2 genome, more preferably, an AAV type 3 or type 5 capsid packaging a type 2 genome.

In other preferred embodiments, an AAV type 1, 3, 4, 5 or 6 genome is packaged within a different AAV capsid (e.g., a type 1 genome in a type 2, 3, 4, 5, or 6 capsid, and the like).

Also preferred are hybrid B19/AAV parvoviruses in which an AAV genome (e.g., an AAV type 1, 2, 3, 4, 5 or 6 genome) is packaged within a B19 capsid. More preferably, the hybrid parvovirus has a B19 capsid and an AAV type 2 genome.

Further preferred are hybrid parvoviruses in which a mouse minute virus, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, or goose parvovirus capsid packages an AAV genome, more preferablyan AAV type 2 genome.

Specific hybrid viruses include those having the capsid sequence encoded by nucleotides 2123 to 4341 of SEQ ID NO:1. This sequence encodes the AAV2 rep genes and AAV4 capsid in a pBluescript backbone. It is also preferred that the hybridparvovirus having the capsid sequence given by SEQ ID NO:1 is an AAV2 genome. Alternatively, the nucleotide sequence of the AAV4 capsid is substantially homologous to the nucleotide sequence given as nucleotides 2123 to 4341 of SEQ ID NO:1. As afurther alternative, the nucleotide sequence of the AAV4 capsid encodes the amino acid sequence encoded by nucleotides 2123 to 4341 in SEQ ID NO:1. The term "substantially homologous" is as defined hereinbelow.

One of the limitations of current AAV vectors for gene delivery is the prevalence of neutralizing antibodies against AAV within the human population. For example, it is estimated that 80% of adults are seropositive for AAV type 2. In preferredembodiments, the instant invention provides hybrid parvovirus vectors that may be advantageously employed to reduce (e.g., diminish, decrease, mitigate, and the like) an immune response in the subject being treated. Thus, for example, a rAAV type 2vector genome carrying a heterologous nucleic acid sequence or sequences may be packaged within an AAV type 3 capsid and administered to a subject who is seropositive for AAV type 2 and cannot neutralize AAV type 3 virus.

According to this aspect of the invention, a rAAV genome may be packaged within any non-homologous parvovirus capsid for delivery to a cell, in vitro or in vivo. In preferred embodiments, the AAV genome is packaged within an array ofnon-homologous capsids to overcome neutralizing antibodies and/or or to prevent the development of an immune response. In particular preferred embodiments, the rAAV may be delivered within a series of hybrid virus particles, so as to continually presentthe immune system with a new virus vector. This strategy will allow for repeated administration without immune clearance.

A further limitation encountered with AAV vectors concerns the cellular tropism of this virus. The wild-type tropism of AAV is problematic both because AAV infects a wide range of cell types and because it exhibits no infectivity in otherpotential target cells of interest (e.g, erythroid cells). Autonomous parvoviruses, in contrast, have a narrower cellular tropism. The tropisms of particular autonomous parvoviruses are known to those skilled in the art. Illustrative cellular tropismsof autonomous parvoviruses include: B19 virus (erythroid cells), canine parvovirus (gut epithelium), AAVM(p) (fibroblasts); and goose parvovirus (myocardial lining of the heart). Furthermore, autonomous parvoviruses exhibit a wider range of host speciesthan does AAV, which characteristic may be utilized to develop AAV vectors for administration to bovines, canines, felines, geese, ducks, and the like, e.g., for veterinary treatments. Thus, cross-packaging of AAV genomes in autonomous parvoviruscapsids according to the present invention may be utilized to produce a virus vector with a different cellular tropism than AAV.

With respect to AAV/AAV hybrids, all of the AAV serotypes infect a broad host range of cells. However, there are differences in the rates of vector transduction, suggesting that the different serotypes may use different cellular receptors. Inaddition, only limited competition is observed among serotypes in binding experiments, which observation further indicates that the different serotypes have evolved to use distinct receptors (Mizukami et al., (1996) Virology 217:124). Accordingly,hybrid parvoviruses of the present invention that package an AAV genome in an AAV capsid of a different serotype also provide opportunities for delivering AAV vectors to a wider range of cell types than current AAV vectors and/or for directing AAVvectors to specific target cells.

In preferred embodiments, the hybrid parvovirus particle contains a rAAV genome. As used herein, the rAAV genome carries at least one heterologous nucleic acid sequence to be delivered to a cell. Those skilled in the art will appreciate thatthe rAAV genome can encode more than one heterologous nucleic acid sequence (e.g., two, three or more heterologous nucleic acid sequences), generally only limited by the packaging capacity of the virus capsid. Heterologous nucleic acid sequence(s) ofinterest for use according to the present invention are as described above.

As used herein, a recombinant hybrid parvovirus particle encompasses virus particles with hybrid, chimeric, targeted and/or modified parvovirus capsids as described hereinbelow. Moreover, those skilled in the art will understand that theparvovirus capsid may include other modifications or mutations (e.g., deletion, insertion, point and/or missense mutations, and the like). Likewise, the rAAV genome may include modifications or mutations (e.g., deletion, insertion, point and/or missensemutations, and the like). Those skilled in the art will further appreciate that mutations may incidentally be introduced into the rAAV genome or parvovirus capsid as a result of the cloning strategy employed.

The rAAV genome of the hybrid parvovirus preferably encodes at least one AAV inverted terminal repeat (ITR), preferably two AAV ITRs, and more preferably two homologous AAV ITRs, which flank the heterologous nucleic acid sequence(s) to bedelivered to the cell. The AAV ITR(s) may be from any AAV, with types 1, 2, 3, 4, 5 and 6 being preferred, and type 2 being most preferred. The term "inverted terminal repeat" includes synthetic sequences that function as an AAV inverted terminalrepeat, such as the "double-D sequence" as described in U.S. Pat. No. 5,478,745 to Samulski et al., the disclosure of which is incorporated in its entirety herein by reference. It has been demonstrated that only a single 165 bp double-D sequence isrequired in cis for site specific integration, replication, and encapsidation of vector sequences. AAV ITRs according to the present invention need not have a wild-type ITR sequence (e.g., a wild-type sequence may be altered by insertion, deletion,truncation or missense mutations), as long as the ITR functions to mediate virus packaging, replication, integration, and/or provirus rescue, and the like.

In hybrid parvoviruses according to the present invention, the AAV ITR(s) is different from the parvovirus capsid. Moreover, if the capsid is an AAV capsid, the capsid and the ITR(s) are of different AAV serotypes. In preferred embodiments, theAAV ITR(s) is from AAV type 2 and the parvovirus capsid is an AAV type 3, 4 or 5 capsid, more preferably an AAV type 3 or 5 capsid. In alternate preferred embodiments, the hybrid parvovirus has a B19 capsid and the AAV ITR(s) is from AAV type 2.

The rAAV genomes of the invention may additionally contain expression control elements, such as transcription/translation control signals, origins of replication, polyadenylation signals, and internal ribosome entry sites (IRES), promoters,enhancers, and the like, operably associated with the heterologous nucleic acid sequence(s) to be delivered to the cell. Those skilled in the art will appreciate that a variety of promoter/enhancer elements may be used depending on the level andtissue-specific expression desired. The promoter/enhancer may be constitutive or inducible, depending on the pattern of expression desired. The promoter/enhancer may be native or foreign and can be a natural or a synthetic sequence. By foreign, it isintended that the promoter/enhancer region is not found in the wild-type host into which the promoter/enhancer region is introduced.

Promoters/enhancers that are native to the target cell or subject to be treated are most preferred. Also preferred are promoters/enhancers that are native to the heterologous nucleic acid sequence. The promoter/enhancer is chosen so that itwill function in the target cell(s) of interest. Mammalian promoters/enhancers are also preferred.

Inducible expression control elements are preferred in those applications in which it is desirable to provide regulation over expression of the heterologous nucleic acid sequence(s). Inducible promoters/enhancer elements for gene delivery arepreferably tissue-specific promoter/enhancer elements, and include muscle specific (including cardiac, skeletal and/or smooth muscle), neural tissue specific (including brain-specific), liver specific, bone marrow specific, pancreatic specific, spleenspecific, retinal specific, and lung specific promoter/enhancer elements. Other inducible promoter/enhancer elements include hormone-inducible and metal-inducible elements. Exemplary inducible promoters/enhancer elements include, but are not limitedto, a Tet on/off element, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, and a metalothionein promoter.

In embodiments of the invention in which the heterologous nucleic acid sequence(s) will be transcribed and then translated in the target cells, specific initiation signals are generally required for efficient translation of inserted proteincoding sequences. These exogenous translational control sequences, which may include the ATG initiation codon and adjacent sequences, can be of a variety of origins, both natural and synthetic.

The AAV genome of the inventive parvovirus vectors may optionally include the genes that encode the AAV Cap and Rep proteins. In preferred embodiments, the genes encoding at least one of the AAV Cap proteins or at least one of the AAV Repproteins will be deleted from the rAAV genome. According to this embodiment, the Cap and Rep functions may be provided in trans, e.g., from a transcomplementing packaging vector or by a stably-transformed packaging cell line. In more preferredembodiments, the genes encoding all of the AAV Cap proteins or all of the AAV Rep proteins will be deleted from the rAAV genome. Finally, in the most preferred embodiments, all of the AAV cap genes and all of the AAV rep genes are deleted from the AAVvector. This configuration maximizes the size of the heterologous nucleic acid sequence(s) that can be carried by the AAV genome, simplifies cloning procedures, and minimizes recombination between the rAAV genome and the rep/cap packaging sequencesprovided in trans.

In hybrid parvoviruses according to the present invention, the parvovirus cap genes (if present) may encode the Cap proteins from any parvovirus, preferably an AAV. In contrast, the rep genes (if present) will typically and preferably be AAV repgenes. It is further preferred that the rep genes and the AAV inverted terminal repeat(s) carried by the AAV genome are of the same serotype. Moreover, if the cap genes are AAV cap genes, the rep genes will preferably be of a different AAV serotypefrom the AAV cap genes.

The rep genes/proteins of different AAV serotypes may be evaluated for those giving the highest titer vector in connection with particular hybrid parvoviruses without undue experimentation. In particular preferred embodiments, the AAV rep genesencode a temperature-sensitive Rep78 and/or Rep68 protein as described by Gavin et al., (1999) J. Virology 73:9433 (the disclosure of which is incorporated herein by reference in its entirety).

As described above, the Cap proteins of the hybrid parvovirus are different from the AAV genome (i.e., the Cap proteins are either from a different AAV serotype or from an autonomous parvovirus). In addition, as described above, the Cap proteinswill typically and preferably be different from the rep genes (if present).

Accordingly, in particular preferred embodiments, the hybrid parvovirus has an AAV type 3, 4 or 5 capsid and carries an AAV type 2 genome including an AAV type 2 ITR(s). The AAV genome may additionally include the AAV rep genes (preferably type2) and AAV cap genes (preferably, AAV type 3, 4, or 5, respectively). Typically, however, the AAV genome will be a rAAV genome, and the rep and cap genes will be deleted therefrom. In an alternate preferred embodiment, the hybrid parvovirus has a B19capsid and carries an AAV genome, more preferably an AAV type 2 genome, including an AAV ITR(s). The AAV genome may optionally encode the AAV Rep proteins (preferably AAV type 2) and B19 capsid proteins, but preferably is a rAAV genome lacking thesesequences.

The present invention also provides nucleotide sequences and vectors (including cloning and packaging vectors) encoding the inventive AAV genomes and the parvovirus cap gene(s) and the AAV rep gene(s) for producing the inventive hybridparvoviruses. As described above, in preferred embodiments, at least one of the AAV rep genes or one of the AAV cap genes, more preferably all of the AAV rep genes and the AAV cap genes, are deleted from the AAV genome. The Rep and Cap functions may beprovided in trans by packaging vector(s). Multiple packaging vectors (e.g., two, three, etc.) may be employed, but typically and preferably all of the Rep and Cap functions are provided by a single packaging vector.

Cloning and packaging vectors may be any vector known in the art. Illustrative vectors include, but are not limited to, plasmids, naked DNA vectors, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), and viral vectors. Preferred viral vectors include AAV, adenovirus, herpesvirus, Epstein-Barr virus (EBV), baculovirus, and retroviral (e.g., lentiviral) vectors, more preferably, adenovirus and herpesvirus vectors.

The present invention also provides cells containing the inventive vectors. The cell may be any cell known in the art including bacterial, protozoan, yeast, fungus, plant, and animal (e.g., insect, avian, mammalian) cells.

Further provided are stably-transformed packaging cells that express the sequences encoding the parvovirus cap gene(s) and/or the AAV rep gene(s) for producing the inventive hybrid parvoviruses. Any suitable cell known in the art may be employedto express the parvovirus cap and/or rep gene(s). Mammalian cells are preferred (e.g., HeLa cells). Also preferred are trans-complementing packaging cell lines that will provide functions deleted from a replication-defective helper virus, e.g., 293cells or other E1a trans-complementing cells.

In particular preferred embodiments, at least one of the rep genes or at least one of the cap genes, more preferably all of the cap genes or all of the rep genes are stably integrated into the genetic material of the packaging cell and areexpressed therefrom. Typically, and most preferably, all of the parvovirus cap genes and all of the AAV rep genes are stably integrated and expressed by the packaging cell.

The cap and rep genes and proteins are as described above with respect to hybrid AAV genomes. Thus, the packaging vector(s) and/or packaging cell may encode the cap genes from any parvovirus. Preferred are the B19, AAV type 3, AAV type 4 andAAV type 5 cap genes. Likewise, the packaging vector(s) and/or packaging cell may encode the rep genes from any parvovirus. Preferably, however, the rep genes will be AAV genes, more preferably, AAV type 2, AAV type 3, AAV type 4, or AAV type 5 repgenes. Most preferably, the rep genes are AAV type 2 rep genes. In particular preferred embodiments, the AAV rep sequences encode a temperature-sensitive Rep78 or Rep68 protein as described by Gavin et al., (1999) J. Virology 73:9433.

The expression of the cap and rep genes, whether carried by the rAAV genome, a packaging vector, or stably integrated into the genome of a packaging cell may be driven by any promoter or enhancer element known in the art, as described in moredetail above. Preferably, the cap or rep genes (more preferably both) are operably associated with parvovirus promoters. In the most preferred embodiments, the cap genes and rep genes are operably associated with their authentic promoters (i.e., thenative promoter).

A previous report indicates that expression of parvovirus cap genes from a B19/AAV type 2 hybrid helper vector cannot be achieved using authentic promoters. Ponnazhagan et al., (1998) J. Virology 72:5224, attempted to generate a helper vectorfor producing a B19 parvovirus capsid packaging an AAV type 2 genome. These investigators reported that virus could not be packaged when the cap genes on the helper vector were driven by either the authentic AAV p40 or B19 p6 promoters. Packaging ofvirus was only successfully achieved when the CAAV promoter (a strong promoter) was substituted for the authentic promoters. It appears that the natural regulation of the cap genes was disrupted, and cap gene expression was restored only by splitting upthe rep and cap coding regions and using an exogenous promoter to drive cap gene expression.

Likewise, the cloning strategy proposed by U.S. Pat. No. 5,681,731 to Lebkowski et al. for generating hybrid viruses comprising an autonomous parvovirus capsid encapsidating a rAAV genome (col. 15 16) will fail to result in packaged virus.

In contrast, the present invention provides hybrid packaging vectors and packaging cells in which parvovirus promoters, preferably the authentic promoters, may be used to drive expression of the parvovirus cap and rep genes to produce theinventive hybrid parvoviruses. Previous efforts to create hybrid parvovirus cap/rep gene constructs using authentic promoters have not succeeded, at least in part, because these investigators failed to preserve the integrity of the splice sites requiredfor proper processing of the rep genes. The present investigations have utilized a seamless cloning strategy (Stratagene USA) in which the splice sites within the rep genes have been preserved. Alternatively, site-directed mutagenesis (or similartechniques) may be used to restore the splice sites to the hybrid virus constructs.

The present invention further encompasses methods of producing the inventive hybrid parvoviruses. Hybrid parvovirus particles according to the invention may be produced by introducing an AAV genome to be replicated and packaged into a permissiveor packaging cell, as those terms are understood in the art (e.g., a "permissive" cell can be infected or transduced by the virus; a "packaging" cell is a stably transformed cell providing helper functions). Preferably, the AAV genome is a rAAV genomeencoding a heterologous nucleic acid sequence(s) that is flanked by at least one AAV ITR. rAAV genomes, AAV ITRs, and heterologous nucleic acid sequences are all as described in more detail hereinabove. The AAV genome may be provided to the cell by anysuitable vector, as described hereinabove.

Any method of introducing the vector carrying the AAV genome into the permissive cell may be employed, including but not limited to, electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, and liposomes incombination with a nuclear localization signal. In embodiments wherein the AAV genome is provided by a virus vector, standard methods for producing viral infection may be used.

Any suitable permissive or packaging cell known in the art may be employed to produce AAV vectors. Mammalian cells are preferred. Also preferred are trans-complementing packaging cell lines that provide functions deleted from areplication-defective helper virus, e.g., 293 cells or other E1a trans-complementing cells.

The AAV genome may contain some or all of the AAV cap and rep genes, as described herein. Preferably, however, some or all of the cap and rep functions are provided in trans by introducing a packaging vector(s), as described above, into thecell. Alternatively, the cell is a packaging cell that is stably transformed to express the cap and/or rep genes. Packaging vectors and packaging cells are as described hereinabove.

In addition, helper virus functions are provided for the AAV vector to propagate new virus particles. Both adenovirus and herpes simplex virus may serve as helper viruses for AAV. See, e.g., BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter69 (3d ed., Lippincoft-Raven Publishers). Exemplary helper viruses include, but are not limited to, Herpes simplex (HSV) varicella zoster, cytomegalovirus, and Epstein-Barr virus. The multiplicity of infection (MOI) and the duration of the infectionwill depend on the type of virus used and the packaging cell line employed. Any suitable helper vector may be employed. Preferably, the helper vector(s) is a plasmid, for example, as described by Xiao et al., (1998) J. Virology 72:2224. The vector canbe introduced into the packaging cell by any suitable method known in the art, as described above.

AAV vectors can be produced by any suitable method known in the art. The traditional production of rAAV vectors entails co-transfection of a rep/cap vector encoding AAV helper and the AAV vector into human cells infected with adenovirus(Samulski et al., (1989) J. Virology 63:3822). Under optimized conditions, this procedure can yield up to 10.sup.9 infectious units of rAAV per ml. One drawback of this method, however, is that it results in the co-production of contaminating wild-typeadenovirus in rAAV preparations. Since several adenovirus proteins (e.g., fiber, hexon, etc.) are known to produce a cytotoxic T-lymphocyte (CTL) immune response in humans (Yang and Wilson, (1995) J. Immunol. 155:2564; Yang et al., (1995) J. Virology69:2004; Yang et al., (1994) Proc. Nat. Acad. Sci. USA 91:4407), this represents a significant drawback when using these rAAV preparations (Monahan et al., (1998) Gene Therapy 5:40).

AAV vector stocks free of contaminating helper virus may be obtained by any method known in the art. For example, AAV and helper virus may be readily differentiated based on size. AAV may also be separated away from helper virus based onaffinity for a heparin substrate (Zolotukhin et al (1999) Gene Therapy 6:973). Preferably, deleted replication-defective helper viruses are used so that any contaminating helper virus is not replication competent. As a further alternative, anadenovirus helper lacking late gene expression may be employed, as only adenovirus early gene expression is required to mediate packaging of AAV virus. Adenovirus mutants defective for late gene expression are known in the art (e.g., ts100K and ts149adenovirus mutants).

A preferred method for providing helper functions through infectious adenovirus employs a non-infectious adenovirus miniplasmid that carries all of the helper genes required for efficient AAV production (Ferrari et al., (1997) Nature Med. 3:1295; Xiao et al., (1998) J. Virology 72:2224). The rAAV titers obtained with adenovirus miniplasmids are forty-fold higher than those obtained with conventional methods of wild-type adenovirus infection (Xiao et al., (1998) J. Virology 72:2224). This approach obviates the need to perform co-transfections with adenovirus (Holscher et al., (1994), J. Virology 68:7169; Clark et al., (1995) Hum. Gene Ther. 6:1329; Trempe and Yang, (1993), in, Fifth Parvovirus Workshop, Crystal River, Fla.).

Other methods of producing rAAV stocks have been described, including but not limited to, methods that split the rep and cap genes onto separate expression cassettes to prevent the generation of replication-competent AAV (see, e.g., Allen et al.,(1997) J. Virol. 71:6816), methods employing packaging cell lines (see, e.g., Gao et al., (1998) Human Gene Therapy 9:2353; Inoue et al., (1998) J. Virol. 72:7024), and other helper virus free systems (see, e.g., U.S. Pat. No. 5,945,335 to Colosi).

Accordingly, the AAV genome to be packaged, parvovirus cap genes, AAV rep genes, and helper functions are provided to a cell (e.g., a permissive or packaging cell) to produce AAV particles carrying the AAV genome. The combined expression of therep and cap genes encoded by the AAV genome and/or the packaging vector(s) and/or the stably transformed packaging cell results in the production of a hybrid parvovirus in which a parvovirus capsid encapsidates an AAV genome. The hybrid parvovirusparticles are allowed to assemble within the cell, and are then recovered by any method known by those of skill in the art.

The reagents and methods disclosed herein may be employed to produce high-titer stocks of the inventive parvovirus vectors. Preferably, the parvovirus stock has a titer of at least about 10.sup.5 transducing units (tu)/ml, more preferably atleast about 10.sup.6 tu/ml, more preferably at least about 10.sup.7 tu/ml, yet more preferably at least about 10.sup.8 tu/ml, yet more preferably at least about 10.sup.9 tu/ml, still yet more preferably at least about 10.sup.10 tu/ml, still morepreferably at least about 10.sup.11 tu/ml, or more.

Alternatively stated, the parvovirus stock preferably has a titer of at least about 1 tu/cell, more preferably at least about 5 tu/cell, still more preferably at least about 20 tu/cell, yet more preferably at least about 50 tu/cell, still morepreferably at least about 100 tu/cell, more preferably still at least about 250 tu/cell, most preferably at least about 500 tu/cell, or even more.

It is also preferred that the parvovirus is produced at essentially wild-type titers.

Those skilled in the art will appreciate that the instant invention also encompasses hybrid parvovirus vectors that contain chimeric capsids and/or capsids that have been modified by insertion of an amino acid sequence(s) into the capsid toconfer altered tropisms or other characteristics, each as discussed in more detail below. The virus capsids may also include other modifications, e.g., deletion, insertion, point and/or missense mutations, and the like.

Those skilled in the art will further appreciate that mutations may incidentally be introduced into the cap and/or rep genes as a result of the particular cloning strategy employed. For example, the construction of sequences encoding hybridparvovirus genomes as described above may result in chimeric rep genes (and proteins) because of the overlap of the rep and cap sequences (e.g., the cap genes and 3' end of the rep genes may be AAV type 3, and the remainder of the rep genes may be AAVtype 2). As described above, chimeric AAV rep genes in which the 3' region is derived from an autonomous parvovirus will generally not function as the splicing signals are not conserved among AAV and the autonomous parvoviruses, unless site-directedmutagenesis, or a similar technique, is employed to restore the splice sites to the hybrid virus constructs.

II. Chimeric Viruses.

The present invention further provides the discovery that chimeric parvoviruses may be constructed that possess unique capsid structures and characteristics. The strategy described above focused on altering AAV virus structure and function bycross-packaging AAV genomes within different parvovirus capsids. Further diversity in virus particles may be achieved by substituting a portion of the parvovirus capsid with a portion of a capsid(s) from a different (i.e., another or foreign)parvovirus(es). Alternatively, a portion of a different parvovirus capsid(s) may be inserted (i.e., rather than substituted) into the parvovirus capsid to create a chimeric parvovirus capsid. Also disclosed are vectors, packaging cells, and methods forconstructing chimeric parvovirus particles. The chimeric parvoviruses disclosed herein may possess new antigenic properties, packaging capabilities, and/or cellular tropisms. The chimeric capsids and virus particles of the invention are also useful forraising chimera-specific antibodies against the novel capsid structures.

Parvoviruses, AAV, and rAAV genomes are as described above with respect to hybrid parvoviruses.

As used herein, a "chimeric" parvovirus is a parvovirus in which a foreign (i.e., exogenous) capsid region(s) from a different parvovirus(s) is inserted or substituted into the parvovirus capsid. Preferably the foreign capsid region issubstituted for one of the native parvovirus capsid regions. In particular embodiments, the foreign capsid region is swapped for the homologous capsid region within the parvovirus capsid. It is also preferred that the parvovirus capsid is an AAVcapsid. According to this embodiment, the AAV capsid may be of any AAV serotype (e.g., type 1, type 2, type 3, type 4, type 5, type 6, etc., as described above). More preferably, the AAV capsid is an AAV type 2, type 3, type 4, or type 5 capsid, mostpreferably an AAV type 2 capsid.

Those skilled in the art will appreciate that the chimeric parvovirus may additionally be a hybrid parvovirus (as described above) or may be a targeted, or otherwise modified, parvovirus (as described below). Those skilled in the art willfurther appreciate that due to the overlap in the sequences encoding the parvovirus capsid proteins, a single insertion or substitution may affect more than one capsid subunit.

The foreign parvovirus capsid region may be from any parvovirus (i.e., an autonomous parvovirus or dependovirus) as described above. Preferably, the foreign capsid region is from the human B19 parvovirus or from AAV type 3, type 4, or type 5.

The foreign parvovirus capsid region may constitute all or substantially all of a capsid subunit(s) (i.e., domain, for example the Vp1, Vp2 and Vp3 subunits of AAV or the Vp1 and Vp2 subunits of B 19 virus) or a portion of a capsid subunit. Conversely, more than one foreign capsid subunit may be inserted or substituted into the parvovirus capsid. Likewise, a portion of a parvovirus capsid subunit or one or more parvovirus capsid subunits may be replaced with one or more foreign capsidsubunits, or a portion thereof. Furthermore, the chimeric parvovirus capsid may contain insertions and/or substitutions at more than one site within the capsid. According to this embodiment, the multiple insertions/substitutions may be derived frommore than one parvovirus (e.g., two, three, four, five or more). Generally, it is preferred that at least one subunit from the parvovirus capsid is retained in the chimeric capsid, although this is not required.

In particular embodiments of the invention, the foreign parvovirus capsid region that is inserted or substituted into the native parvovirus capsid is at least about 2, 5, 10, 12, 15, 20, 30, 50, or 100 amino acids in length.

The inventive chimeric parvoviruses may contain any parvovirus genome, preferably an AAV genome, more preferably a recombinant AAV genome. Embodiments wherein the AAV genome is packaged within a chimeric AAV capsid of the same serotype is alsopreferred. AAV type 2 genomes are most preferred regardless of the composition of the chimeric parvovirus capsid.

In preferred embodiments of the invention, the chimeric parvovirus comprises an AAV capsid, more preferably an AAV type 2 capsid, in which a capsid region from a B19 parvovirus has been substituted for one of the AAV capsid domains. In otherpreferred embodiments, the chimeric parvovirus comprises an AAV capsid (more preferably, an AAV type 2 capsid) in which the Vp3 subunit of the AAV capsid has been replaced by the B19 Vp2 subunit.

In alternative preferred embodiments, the chimeric parvovirus comprises an AAV capsid (preferably type 2) in which the Vp1 and Vp2 subunits are replaced by the Vp1 subunit of a B19 parvovirus.

In other preferred embodiments, the chimeric parvovirus comprises an AAV type 2 capsid in which the type 2 Vp1 subunit has been replaced by the Vp1 subunit from an AAV type 1, 3, 4, 5, or 6 capsid, preferably a type 3, 4, or 5 capsid. Alternatively, the chimeric parvovirus has an AAV type 2 capsid in which the type 2 Vp2 subunit has been replaced by the Vp2 subunit from an AAV type 1, 3, 4, 5, or 6 capsid, preferably a type 3, 4, or 5 capsid. Likewise, chimeric parvoviruses in whichthe Vp3 subunit from an AAV type 1, 3, 4, 5 or 6 (more preferably, type 3, 4 or 5) is substituted for the Vp3 subunit of an AAV type 2 capsid are preferred. As a further alternative, chimeric parvoviruses in which two of the AAV type 2 subunits arereplaced by the subunits from an AAV of a different serotype (e.g., AAV type 1, 3, 4, 5 or 6) are preferred. In exemplary chimeric parvoviruses according to this embodiment, the Vp1 and Vp2, or Vp1 and Vp3, or Vp2 and Vp3 subunits of an AAV type 2capsid are replaced by the corresponding subunits of an AAV of a different serotype (e.g., AAV type 1, 3, 4, 5 or 6). Likewise, in other preferred embodiments, the chimeric parvovirus has an AAV type 1, 3, 4, 5 or 6 capsid (preferably the type 2, 3 or 5capsid) in which one or two subunits have been replaced with those from an AAV of a different serotype, as described above for AAV type 2.

In still other preferred embodiments, the minor subunit of one parvovirus may be substituted with any minor subunit of another parvovirus (e.g., Vp2 of AAV type 2 may be replaced with Vp1 from AAV type 3; Vp1 of B19 may substitute for Vp1 and/orVP2 of AAV). Likewise, the major capsid subunit of one parvovirus may be replaced with the major capsid subunit of another parvovirus.

The nucleotide sequences encoding specific chimeric capsids include the sequence given as nucleotides 2133 to 4315 of SEQ ID NO:2. This sequence contains the AAV2 rep coding sequences, most of the AAV2 Vp1 and Vp3 coding sequences, and theentire AAV4 Vp2 coding sequences and some of the AAV4 Vp1 and Vp3 coding sequences in a pBluescript backbone. Preferably, the chimeric parvoviruses having the capsid encoded by the helper given in SEQ ID NO:2 carry an AAV2 genome.

Alternatively, the nucleotide sequence of the chimeric capsid is substantially homologous to the capsid coding sequence given as nucleotides 2133 to 4315 of SEQ ID NO:2. As a further alternative, the nucleotide sequence of the chimeric capsidencodes the same amino acid sequence as nucleotides 2133 to 4315 of SEQ ID NO:2. The term "substantially homologous" is as defined hereinbelow.

The present invention also provides the discovery that chimeric parvoviruses may generate unique capsid structures that do not resemble the constituent parvovirus capsids. For example, the present investigations have discovered that B19/AAV type2 chimeras, in which the Vp3 subunit of AAV type 2 has been replaced by the Vp2 subunit of a human B19 virus, results in the expected 23 28 nm particle (typical for wt AAV) and a novel 33 38 nm particle. The larger particles were present at the samedensity as the 23 28 nm particles in a cesium isopycnic gradient.

While not wishing to be held to any particular theory of the invention, these results suggest that this particle is formed by changing the triangulation number from T=1 to T=3, to yield a larger particle containing 180 copies of the major capsidcomponent instead of 60. This novel,particle may package larger than wild-type genomes due to its increased size. In particular preferred embodiments, the B19/AAV type 2 chimeric parvovirus capsid (B19 Vp2 swapped for AAV2 Vp3) has the amino acidsequence given as SEQ ID NO. 4.

The present invention further provides B19/AAV chimeric capsids and parvoviruses having larger than wild-type capsid structures (e.g., larger than about 28 nm, 30 nm, 32 nm, 34 nm, 36 nm, 38 nm, 40 nm or more in diameter). Alternatively stated,the present invention provides B19/AAV chimeric capsids and parvoviruses with capsid structures containing more than the wild-type number of capsid subunits (e.g., greater than about 60 capsid subunits, greater than about 90 capsid subunits, greater thanabout 120 capsid subunits, greater than about 180 capsid subunits). As a further alternative statement, the present invention provides B19/AAV capsids and parvoviruses that efficiently package greater than wild-type genomes (e.g., greater than about 4.8kb, 5.0 kb, 5.2 kb, 5.4 kb, 5.6 kb, 5.8 kb, 6.0 kb, 6.2 kb, 6.4 kb, 6.6 kb, 6.8 kb or more). Preferably, the larger genomes are efficiently packaged to produce viral stocks having the titers described hereinabove.

It is also preferred that the B19/AAV chimeras have altered antigenic properties. In particular, it is preferred that the B19/AAV chimeras may be administered to a subject that has antibodies against the serotype of the AAV without immuneclearance, i.e., the chimera is not recognized by the AAV serotype-specific antibodies.

In other preferred embodiment of the invention, the nucleotide sequence of the B19/AAV chimeric capsid is substantially homologous to the sequence given as SEQ ID NO:3 and encodes a chimeric parvovirus capsid. This definition is intended toinclude AAV of other serotypes and non-human B19 viruses. As used herein, sequences that are "substantially homologous" are at least 75%, and more preferably are 80%, 85%, 90%, 95%, or even 99% homologous or more.

High stringency hybridization conditions that permit homologous nucleotide sequences to hybridize are well known in the art. For example, hybridization of homologous nucleotide sequences to hybridize to the sequence given SEQ ID NO:3 may becarried out in 25% formamide, 5.times.SSC, 5.times. Denhardt's solution, with 100 .mu.g/ml of single stranded DNA and 5% dextran sulfate at 42.degree. C., with wash conditions of 25% formamide, 5.times.SSC, 0.1% SDS at 42.degree. C. for 15 minutes, toallow hybridization of sequences of about 60% homology. More stringent conditions are represented by a wash stringency of 0.3M NaCl, 0.03 M sodium citrate, 0.1% SDS at 600 or even 70.degree. C. using a standard in situ hybridization assay. (SeeSAMBROOK ET AL., MOLECULAR CLONING, A LABORATORY MANUAL (2d ed. 1989)).

In other preferred embodiments, the chimeric B19/AAV capsid has the amino acid sequence encoded by the sequence given in SEQ ID NO:3 (SEQ ID NO:4).

In other particular preferred embodiments, a non-conserved region(s) of a parvovirus capsid is inserted or substituted, preferably substituted, into another parvovirus capsid. Preferably a non-conserved region(s) is substituted for the same(i.e., homologous) region from a different parvovirus. Parvovirus specific (including AAV serotype specific) characteristics are likely associated with such non-conserved regions. It is also likely that non-conserved regions can, best toleratealterations. In particular embodiments, the looped-out regions of the parvovirus major capsid subunits are swapped between two parvoviruses, more preferably an AAV and a parvovirus, still more preferably between two AAV of different serotypes.

With particular respect to AAV type 2, although the crystal structure of this virus has not been solved, structural correlations have been made based on sequence information. The structural correlations suggest that the Vp3 subunit of AAV type 2has eight P-barrel motifs, and that these motifs are separated by looped out regions (Chapman et al., Virology 194:419). Recently, the sequence of AAV type 3 has been determined by Muramatsu et al., (1996) Virology 221:208. The amino acid homologybetween Vp3 of AAV type 2 and AAV type 3 is 89%, with the region defined as loop 3/4 having 70% homology (Id.). Additionally, AAV type 3 does not bind to the same receptor as AAV type 2 (Mizukami et al., Virology 217:124). The divergent amino acidsequences in loops 3 and 4 may explain the differences in cellular receptors used by AAV type 2 and AAV type 3, and the resulting disparities in cellular tropism. Accordingly, in preferred embodiments of the instant invention, chimeric AAV particles areconstructed in which loop 3/4, or a portion thereof, of AAV type 2 is swapped for the AAV type 3 loop 3/4, or vice versa.

In other embodiments, the chimeric parvovirus comprises an AAV type 2 capsid in which loop 1, 2, 3, and/or 4 of the Vp3 subunit have been replaced by the corresponding loop region(s) of an AAV of a different serotype (e.g., type 1, 3, 4, 5 or 6). In illustrative embodiments, the loop 2 4 region of the AAV type 2 Vp3 subunit is replaced by the loop 2 4 region of a type 3 or type 4 virus.

Likewise, in other preferred embodiments, the chimeric parvovirus comprises an AAV type 1, 3, 4, 5 or 6 capsid in which the loop 1, 2, 3 and/or 4 region of the Vp3 subunit is replaced by the corresponding region of a different AAV serotype. Exemplary embodiments include, but are not limited to, a chimeric parvovirus comprising an AAV type 3 or type 4 capsid in which the loop 2 4 region of the Vp3 subunit is replaced by the AAV type 2 loop 2 4 region.

The present invention further provides chimeric parvoviruses comprising an AAV capsid in which a loop region(s) in the major Vp3 subunit is replaced by a loop region (s) (preferably, a corresponding loop region(s)) from the major subunit of anautonomous parvovirus. In particular, the loop region 1, 2, 3 and/or 4 from an AAV type 1, 2, 3, 4, 5, or 6 Vp3 subunit is replaced with a loop region from the major subunit of an autonomous parvovirus.

The nucleotide sequence of specific chimeric capsids include the sequence give as nucleotides 2133 to 4342 of SEQ ID NO:5. This sequence contains the AAV2 rep coding sequences, most of the AAV2 capsid coding sequences, with the exception thatloops 2 4 from the AAV2 Vp3 subunit were replaced with the corresponding region from AAV3, in a pBluescript backbone.

Alternatively, the nucleotide sequence of the chimeric capsid is substantially homologous to the sequence given as nucleotides 2133 to 4342 of SEQ ID NO:5. As a further alternative, the nucleotide sequence of the chimeric capsid has the sameamino acid sequence as the capsid encoded by nucleotides 2133 to 4342 of SEQ ID NO:5. The term "substantially homologous" is as defined hereinabove.

Chimeric parvoviruses may be constructed as taught herein or by other standard methods known in the art. Likewise, those skilled in the art may evaluate the chimeric parvoviruses thus generated for assembly, packaging, cellular tropism, and thelike, as described herein or by other standard methods known in the art, without undue experimentation.

Another aspect of the present invention is a chimeric parvovirus capsid protein (preferably an AAV Vp1, Vp2 or Vp3 capsid protein) with at least one capsid region from another parvovirus(es) inserted or substituted therein (preferably,substituted). The introduction of the foreign capsid protein into a parvovirus capsid provides altered characteristics (e.g., immunogenic, tropism, etc.) to a virus capsid or particle (preferably a parvovirus capsid or particle) incorporating thechimeric parvovirus capsid protein. Alternatively, the chimeric parvovirus capsid protein may facilitate detection or purification of a virus capsid or particle (preferably parvovirus capsid or particle) incorporating the chimeric parvovirus capsidprotein. In particular preferred embodiments, the antigenic properties of an AAV capsid or particle of a particular serotype may be altered (e.g., changed or modified) or diminished (e.g., reduced or mitigated) by incorporation of the chimericparvovirus capsid region for the native capsid region. According to this embodiment, chimeric capsid proteins may be used to obviate or reduce immune clearance in subjects that have immunity against the serotype of the AAV capsid or particle (e.g., topermit multiple virus administrations). Changes or reductions in antigenic properties may be assessed, e.g., in comparison to an AAV capsid or particle that is identical except for the presence of the chimeric parvovirus capsid protein.

The present invention also encompasses empty chimeric parvovirus capsid structures. Empty capsids may be used for presentation or delivery of peptides or proteins (e.g., antigens to produce an immune response), nucleic acids, or other compounds(see, e.g., Miyamura et al., (1994) Proc. Nat. Acad. Sci USA 91:8507; U.S. Pat. No. 5,916,563 to Young et al., U.S. Pat. No. 5,905,040 to Mazzara et al., U.S. Pat. Nos. 5,882,652, 5,863,541 to Samulski et al.; the disclosures of which areincorporated herein in their entirety by reference). Empty capsids may be produced by any method known in the art. (see, e.g., id.).

The chimeric parvoviruses and capsids of the invention further find use in raising antibodies against the novel capsid structures. Antibodies may be produced by methods that are known to those skilled in the art.

The present invention also provides cloning vectors, transcomplementing packaging vectors, packaging cells, and methods for producing the inventive chimeric parvovirus particles disclosed herein. In general, vectors, packaging cells, and methodsfor producing chimeric parvoviruses are as described above with respect to hybrid parvoviruses. In addition, at least one of the cap genes (encoded by the rAAV genome, a packaging vector(s), or the packaging cell) has inserted therein at least onenucleic acid sequence encoding a foreign amino acid sequence from a non-homolgous parvovirus (as described above).

III. Targeted Parvoviruses.

A further aspect of the present invention are parvovirus vectors comprising a parvovirus capsid and a recombinant AAV genome, wherein an exogenous targeting sequence has been inserted or substituted into the parvovirus capsid. The parvovirusvector is preferably targeted (i.e., directed to a particular cell type or types) by the substitution or insertion of the exogenous targeting sequence into the parvovirus capsid. Alternatively stated, the exogenous targeting sequence preferably confersan altered tropism upon the parvovirus. As yet a further alternative statement, the targeting sequence increases the efficiency of delivery of the targeted vector to a cell.

As, is described in more detail below, the exogenous targeting sequence may be a virus capsid sequence (e.g., an autonomous parvovirus capsid sequence, AAV capsid sequence, or any other viral capsid sequence) that directs infection of theparvovirus to a particular cell type(s). As an alternative, the exogenous amino acid sequence may encode any peptide or protein that directs entry of the parvovirus vectors into a cell(s). In preferred embodiments, the parvovirus capsid is an AAVcapsid, more preferably, an AAV type 2 capsid.

An "altered" tropism, as used herein, includes reductions or enhancements in infectivity with respect to a particular cell type(s) as compared with the native parvovirus lacking the targeting sequence(s). An "altered" tropism also encompassesthe creation of a new tropism (i.e., the parvovirus would not infect a particular cell type(s) to a significant or, alternatively, a detectable extent in the absence of the exogenous amino acid sequence). Alternatively, an "altered tropism" may refer toa more directed targeting of the parvovirus vector to a particular cell type(s) as compared with the native parvovirus, but the target cells may typically be infected by the native parvovirus as well (e.g., a narrowed tropism). As a further alternative,an "altered" tropism refers to a more efficient delivery of a targeted parvovirus as compared with the native parvovirus (e.g., a reduced Multiplicity of Infection, "MOI").

The term "reduction in infectivity", as used herein, is intended to encompass both an abolishment of the wild-type tropism as well as a diminishment in the wild-type tropism or infectivity toward a particular cell type(s). The diminishedinfectivity may be a 25%, 50%, 75%, 90%, 95%, 99%, or more decrease in infectivity with respect to the wild-type level of infectivity. By "enhancement in infectivity", it is meant that the infectivity with respect to a particular cell type(s) isincreased above that observed with the wild-type parvovirus, e.g., by at least 25%, 50%, 75%, 100%, 150%, 200%, 300%, or 500%, or more.

The exogenous targeting sequence(s) may replace or substitute part or all of a capsid subunit, alternatively, more than one capsid subunit. As a further alternative, more than one exogenous targeting sequence (e.g., two, three, four, five ormore sequences) may be introduced into the parvovirus capsid. In alternative embodiments, insertions and substitutions within the minor capsid subunits (e.g., Vp1 and Vp2 of AAV) are preferred. For AAV capsids, insertions or substitutions in Vp2 or Vp3are also preferred.

Those skilled in the art will appreciate that due to the overlap in the sequences encoding the parvovirus capsid proteins, a single insertion or substitution may affect more than one capsid subunit.

As described above, in particular embodiments, the present invention provides chimeric parvovirus particles with unique structures and properties. The substitution and/or insertion of one or more parvovirus capsid region(s) for another to createa chimeric parvovirus capsid may result in the loss of the wild-type parvovirus tropism and/or the development of a new tropism associated with the exogenous capsid region(s). Accordingly, targeted parvoviruses may also be chimeric parvoviruses as isdescribed in more detail hereinabove. In particular, targeted chimeric parvoviruses are provided in which a capsid subunit(s) or a loop region(s) from the major capsid subunit has been replaced with a capsid subunit(s) or loop region from anotherparvovirus.

Accordingly, in particular embodiments of the instant invention, chimeric parvovirus particles are constructed in which the capsid domains that encode the wild-type parvovirus tropism are swapped with capsid regions or subunits from a differentparvovirus sequence, thereby diminishing or even completely abolishing the wild-type tropism. These infection-negative parvoviruses find use as templates for creating parvoviruses with targeted tropisms. In this manner, a parvovirus with a new ordirected tropism, but lacking the wild-type tropism, may be generated.

In another preferred embodiment, a parvovirus capsid region that directs the native or wild-type tropism is swapped with a capsid domain that directs the tropism of another parvovirus, thereby diminishing or ablating the native tropism andconcurrently conferring a new tropism to the chimeric parvovirus. In other embodiments, the foreign capsid region is substituted or inserted into the parvovirus capsid without reducing or extinguishing the wild-type tropism. As a further alternative,more than one foreign parvovirus capsid region (e.g., two, three, four, five, or more) is swapped into the parvovirus capsid. For example, a first foreign capsid region may replace the native capsid region directing the wild-type tropism. Additionalforeign capsid regions provide the chimeric capsid with a new tropism(s).

Heparan sulfate (HS) has recently been identified as a primary receptor for AAV (Summerford and Samulski, (1998) J. Virology 72:1438). Thus, the capsid structure may be modified to facilitate or enhance binding of AAV to the cellular receptor orto inhibit or prevent binding thereto. To illustrate, the tropism of the AAV may be altered by swapping out the HS binding domain for the AAV capsid, for example, with sequences from other parvoviruses that do contain this HS binding domain or any othersequences.

Several consensus sequences have been identified among ligands that bind to HS receptors. In general, HS appears to bind to sequences including clusters of basic amino acids. Illustrative consensus sequences include but are not limited to BBXB,BBBXXB, and RX.sub.7FRXKKXXXK, where B is a basic amino acid, and X is any amino acid. Three sequences containing clusters of basic amino acids are present in the first 170 amino acid residues of the VP1 capsid protein of AAV type 2 as follows:RX.sub.5KKR at amino acids 116 to 124, KX.sub.4KKR at amino acids 137 to 144, and KX.sub.6RKR at amino acids 161 to 170 (AAV type 2 sequence and numbering as described by Srivastava et al., (1983) J. Virology 45:555, as modified by Ruffing et al., (1994)J. Gen. Virology 75:3385, Muzyczka, (1992) Curr. Topics Microbiol. Immunol. 158:97, and Cassinofti et al., (1988) Virology 167:176). In addition, the consensus sequence (RX.sub.7FRPKRLNFK) is found in the VP1 capsid subunit of AAV type 2 at aminoacids 299 to 315.

It appears that AAV serotypes 4 and 5 do not bind to cellular HS receptors, or do so with a low efficiency. Accordingly, in particular embodiments, the HS binding domain of AAV serotypes 1, 2, 3, or 6 may be replaced with the correspondingregion of AAV serotype 4 or 5 to reduce or abolish HS binding. Likewise, HS binding may be conferred upon AAV serotype 4 or 5 by inserting or substituting in the HS binding domain from AAV 1, 2, 3 or 6.

The HS consensus sequences are marked by an abundance of basic amino acids. There is a high density of positively charged amino acids within the first 170 residues of the AAV type 2 Vp1 Cap protein, including three strings of basic amino acids,which may be involved in an ionic interaction with the cell surface. Accordingly, in one particular embodiment of the invention, the affinity of an AAV capsid for HS receptors is reduced or eliminated by creating a targeted parvovirus in which some orall of the basic sequences are substituted by other sequences, e.g., from another parvovirus that does not contain the HS binding domain.

Alternatively, the respiratory syncytial virus heparin binding domain may be inserted or substituted into a virus that does not typically bind HS receptors (e.g., AAV 4, AAV5, B19) to confer heparin binding to the resulting mutant.

B19 infects primary erythroid progenitor cells using globoside as its receptor(Brown et al., (1993) Science 262:114). The structure of B19 has been determined to 8 .ANG. resolution (Agbandje-McKenna et al., (1994) Virology 203:106). The regionof the B19 capsid that binds to globoside has been mapped between amino acids 399 406 (Chapman et al., (1993) Virology 194:419), a looped out region between .beta.-barrel structures E and F (Chipman et al., (1996) Proc. Nat Acad. Sci. USA 93:7502). Accordingly, the globoside receptor binding domain of the B19 capsid may be inserted/substituted into other parvovirus capsids (preferably an AAV capsid, more preferably, the AAV type 2 capsid) to target the resulting chimeric parvovirus to erythroidcells.

In more preferred embodiments, the exogenous targeting sequence may be any amino acid sequence encoding a peptide or protein, which is inserted or substituted into the parvovirus capsid to alter the tropism of the parvovirus. The nativeparvovirus tropism may be reduced or abolished by insertion or substitution of the amino acid sequence. Alternatively, the insertion or substitution of the exogenous amino acid sequence may target the parvovirus to a particular cell type(s). In yetfurther preferred embodiments, an exogenous targeting sequence is substituted or inserted into the parvovirus capsid to concurrently ablate the wild type tropism and to introduce a new tropism. For example, a targeting peptide may be inserted directlyinto a targeting region of the AAV capsid to simultaneously disrupt the native tropism (e.g., by interfering with binding to-cellular heparan sulfate receptors) and to direct the targeted AAV vector to particular cells.

Those skilled in the art will appreciate that the native tropism of a parvovirus may be reduced or abolished without substituting or inserting an exogenous targeting sequence directly into those regions of the parvovirus capsid responsible forthe receptor binding. Mutants that have lost the wild-type tropism are useful as templates for the creation of parvoviruses with novel tropisms as taught herein. It is preferred that substitutions or insertions that result in the loss of wild-typetropism act at the level of receptor binding and/or entry into the cell. In other words, it is preferred that the altered parvovirus is otherwise capable of infecting a cell if entry into the cell is provided by other means, e.g., by a bispecificantibody, by targeting peptide or protein as disclosed herein, or by any other means known in the art.

The exogenous targeting sequence may be any amino acid sequence encoding a protein or peptide that alters the tropism of the parvovirus. In particular embodiments, the targeting peptide or protein may be naturally occurring or, alternately,completely or partially synthetic. Exemplary peptides and proteins include ligands and other peptides that bind to cell surface receptors and glycoproteins, such as RGD peptide sequences, bradykinin, hormones, peptide growth factors (e.g., epidermalgrowth factor, nerve growth factor, fibroblast growth factor, platelet-derived growth factor, insulin-like growth factors I and II, etc.), cytokines, melanocyte stimulating hormone (e.g., .alpha., .beta. or .gamma.), neuropeptides and endorphins, andthe like, and fragments thereof that retain the ability to target cells to their cognate receptors. Other illustrative peptides and proteins include substance P, keratinocyte growth factor, neuropeptide Y, gastrin releasing peptide, interleukin 2, henegg white lysozyme, erythropoietin, gonadoliberin, corticostatin, .beta.-endorphin, leu-enkephalin rimorphin, .alpha.-neo-enkephalin, angiotensin, pneumadin, vasoactive intestinal peptide, neurotensin, motilin, and fragments thereof as described above. As a further alternative, the targeting peptide or protein may be an antibody or Fab fragment that recognizes, e.g., a cell-surface epitope, such as an anti-receptor antibody. As yet a further alternative, the binding domain from a toxin (e.g., tetanustoxin or snake toxins, such as .alpha.-bungarotoxin, and the like) can be used to target the inventive parvovirus vectors to particular target cells of interest. In a yet further preferred embodiment the parvovirus vectors may be delivered to a cellusing a "nonclassical" importexport signal peptide (e.g., fibroblast growth factor-1 and -2, interleukin 1, HIV-1 Tat protein, herpes virus VP22 protein, and the like) as described by Cleves, (1997) Current Biology 7:R318. Also encompassed are peptidemotifs that direct uptake by specific cells, e.g., a FVFLP peptide motif triggers uptake by liver cells. Phage display techniques, as well as other techniques known in the art, may be used to identify peptides that recognize, preferably specifically,any cell type of interest.

The term "antibody" as used herein refers to all types of immunoglobulins, including IgG, IgM, IgA, IgD, and IgE. The antibodies may be monoclonal or polyclonal and may be of any species of origin, including (for example) mouse, rat, rabbit,horse, or human, or may be chimeric antibodies. Also encompassed by the term "antibody" are bispecific or "bridging" antibodies as known by those skilled in the art.

Antibody fragments within the scope of the present invention include, for example, Fab, F(ab)2, and Fc fragments, and the corresponding fragments obtained from antibodies other than IgG. Such fragments may be produced by known techniques.

The targeting sequence may alternatively encode any peptide or protein that targets the parvovirus particle to a cell surface binding site, including receptors (e.g., protein, carbohydrate, glycoprotein or proteoglycan), as well as any oppositelycharged molecule (as compared with the targeting sequence or the parvovirus capsid), or other molecule with which the targeting sequence or targeted parvovirus interact to bind to the cell, and thereby promote cell entry. Examples of cell surfacebinding sites include, but are not limited to, heparan sulfate, chondroitin sulfate, and other glycosaminoglycans, sialic acid moieties found on mucins, glycoproteins, and gangliosides, MHCl glycoproteins, carbohydrate components found on membraneglycoproteins, including, mannose, N-acetyl-galactosamine, N-acetyl-glucosamine, fucose, galactose, and the like.

As yet a further alternative, the targeting sequence may be a peptide or protein that may be used for chemical coupling (e.g., through amino acid side groups of arginine or lysine residues) to another molecule that directs entry of the parvovirusinto a cell.

In other embodiments, the exogenous targeting sequence is substituted or inserted into the capsid to disrupt binding to cellular receptors (e.g., HS receptor) and/or entry into the cell. For example, the exogenous amino acid sequence may besubstituted or inserted into the region(s) of the AAV capsid that binds to cellular receptors and/or otherwise mediates entry of the virus into the cell. Preferably, the exogenous targeting sequence is inserted into the capsid region(s) that interactwith cellular HS receptors (as described above). One illustrative insertion mutant that forms intact AAV virions yet fails to bind heparin agarose or infect Hela cells is an AAV type 2 mutant generated by insertion of an amino acid sequence at bp 3761of the AAV type 2 genome (within the Vp3 cap gene region).

In a further alternative embodiment, the exogenous amino acid sequence inserted into the parvovirus capsid may be one that facilitates purification of the parvovirus. According to this aspect of the invention, it is not necessary that theexogenous amino acid sequence also alters the tropism of the modified parvovirus. For example, the exogenous amino acid sequence may include a poly-histidine sequence that is useful for purifying the parvovirus over a nickel column, as is known to thoseskilled in the art. Alternatively, the region of the AAV capsid that interacts with heparin and/or heparan sulfate may be substituted or inserted into a parvovirus capsid so that the parvovirus may be purified by binding to heparin, e.g., as describedby Zolotukhin et al., (1999) Gene Therapy 6:973, the disclosure of which is incorporated herein in its entirety by reference.

In other embodiments, the amino acid sequence encodes an antigenic peptide or protein that may be employed to purify the AAV by standard immunopurification techniques. Alternatively, the amino acid sequence may encode a receptor ligand or anyother peptide or protein that may be used to purify the modified parvovirus by affinity purification or any other techniques known in the art (e.g., purification techniques based on differential size, density, charge, or isoelectric point, ion-exchangechromatography, or peptide chromatography).

In yet other embodiments of the invention, an amino acid sequence may be inserted or substituted into a parvovirus particle to facilitate detection thereof (e.g., with a antibody or any other detection reagent, as is known in the art). Forexample, the "flag" epitope may be inserted into the parvovirus capsid and detected using commercially-available antibodies (Eastman-Kodak, Rochester, N.Y.). Detectable viruses find use, e.g., for tracing the presence and/or persistence of virus in acell, tissue or subject.

In still a further embodiment, an exogenous amino acid sequence encoding any antigenic protein may be expressed in the modified capsid (e.g., for use in a vaccine).

As described below and in Table 1, the present investigations have used insertional mutagenesis of the capsid coding sequence of AAV serotype 2 in order to determine positions within the capsid that tolerate peptide insertions. Viable mutantswere identified with insertions throughout each of the capsid subunits. These insertion mutants find use for any purpose in which it is desirable to insert a peptide or protein sequence into an AAV capsid, e.g., for purifying and/or detecting virus, orfor inserting an antigenic peptide or protein into the capsid. The nucleotide positions indicated in Table 1 (see Examples) are the positions at which the restriction sites were made, e.g., the new sequences start at the next nucleotide. For example,for an insertion mutant indicated in Table 1 as having an insertion at nucleotide 2285, the new insertion sequence would begin at nucleotide 2286.

It is preferred to insert the exogenous amino acid sequence within the parvovirus minor Cap subunits, e.g., within the AAV Vp1 and Vp2 subunits. Alternately, insertions in Vp2 or Vp3 are preferred. Also preferred are insertion mutations atnucleotide 2285, 2356, 2364, 2416, 2591, 2634, 2690, 2747, 2944, 3317, 3391, 3561, 3595, 3761, 4046, 4047, and/or 4160 within the AAV type 2 cap genes, preferably, to generate an AAV type 2 vector with an altered tropism as described herein (AAV type 2numbering used herein is as described by Srivastava et al., (1983) J. Virology 45:555, as modified by Ruffing et al., (1994) J. Gen. Virology 75:3385, Muzyczka, (1992) Curr. Topics Microbiol. Immunol. 158:97, and Cassinofti et al., (1988) Virology167:176).

Insertions at these nucleotide positions for AAV2 will give rise to amino acid insertions following amino acid 28 (nu 2285), 51 (nu 2356), 54 (nu 2364), 71 (nu 2416), 130 (nu 2591), 144 (nu 2634), 163 (nu 2690), 182 (nu 2747), 247 (nu 2944), 372(nu 3317), 396 (nu 3391), 452 (nu 3561), 464 (nu 3595), 520 (nu 3761), 521 (nu 3766), 615 (nu 4046 and 4047), and 653 (nu 4160) within the AAV2 capsid coding region (using the starting methionine residue for Vp1 as amino acid 1), or the correspondingregions of AAV of other serotypes as known by those skilled in the art. Those skilled in the art will appreciate that due to the overlap in the AAV capsid coding regions, these insertions may give rise to insertions within more than one of the capsidproteins (Table 2).

TABLE-US-00001 TABLE 2 Insertion Positions in AAV2 CaDsid.sup.1, 2 Insertion site Vp1 Vp2 Vp3 (nucleotide) (amino acid) (amino acid) (amino acid) 2285 28 -- -- 2356 51 -- -- 2364 54 -- -- 2416 71 -- -- 2591 130 -- -- 2634 144 7 -- 2690 163 26 --2747 182 45 -- 2944 247 110 45 3317 372 235 170 3391 396 259 194 3561 452 315 250 3595 464 327 262 3753 517 380 315 3761 520 383 318 3766 521 384 319 3789 529 392 327 3858 552 415 350 3960 586 449 384 3961 586 449 384 3987 595 458 393 4046 615 478 4134047 615 478 413 4160 653 516 451 .sup.1The indicated nucleotide or amino acid refers to the nucleotide or amino acid immediately preceding the inserted sequence. .sup.2Vp1 start at nucleotide 2203

Alternatively, the exogenous amino acid sequence is inserted at the homologous sites to those described above in AAV capsids of other serotypes as known by those skilled in the art (see, e.g., Chiorini et al., (1999) J. Virology 73:1309). Theamino acid positions within the AAV capsid appear to be highly, or even completely, conserved among AAV serotypes. Accordingly, in particular embodiments, the exogenous amino acid sequence is substituted at the amino acid positions indicated in Table 2(new sequence starting at the next amino acid) in AAV other than serotype 2 (e.g., serotype 1, 3, 4, 5 or 6).

As further alternatives, an exogenous amino acid sequence may be inserted into the AAV capsid at the positions described above to facilitate purification and/or detection of the modified parvovirus or for the purposes of antigen presentation, asdescribed above.

One particular AAV type 2 mutant is produced by inserting an amino acid sequence at nucleotide position 2634 of the genome (within the Vp2 cap gene region; AAV2 numbering as described above). This mutant forms AAV type 2 virions with normalmorphology by electron microscopy analysis in the absence of detectable expression of the Vp1 and Vp2 subunits. Moreover, this mutant protects the viral genome and retains binding to a heparin-agarose matrix, although it does not demonstrate infectivityin HeLa cells. This mutant is useful for administration to subjects to avoid an immune response against the Vp1 and Vp2 subunits. It further finds use for insertion of large peptides or proteins into the AAV capsid structure. As one illustrativeexample, the adenovirus knob protein is inserted into this mutant to target the virus to the Coxsackie adenovirus receptor (CAR).

Another particular AAV type 2 insertion mutant is produced by insertion of an exogenous amino acid sequence at bp 3761 of the genome (within the Vp3 capsid coding region). This mutant protects the viral genome and forms morphologically normalcapsid structures, but does not bind heparin-agarose and fails to infect HeLa cells. This mutant is particularly useful as a reagent for creating AAV vectors lacking the native tropism. For example, a new targeting region may be introduced into thismutant at bp 3761 or at another site. As shown in Table 1, the present investigations have discovered a variety of positions within the AAV capsid that tolerate insertion of exogenous peptides and retain infectivity (e.g., at bp 2356, 2591, 2690, 2944,3595, and/or 4160 of the AAV type 2 genome).

In other preferred embodiments, AAV vectors with multiple insertions and/or substitutions are created to provide AAV vectors exhibiting a desired pattern of infectivity, e.g., a non-infectious insertion/substitution mutation and an infectiousmutation (e.g., as shown in Table 1) may be combined in a single AAV vector. As one illustrative example, a peptide insertion may be made at bp 3761 of the AAV type 2 genome (within the Vp3 subunit) to create a non-infectious heparin binding negativemutant. A second peptide insertion may be made at bp 2356 (alternatively, bp 2591, 2690, 2944, 3595 or 4160) to target the vector. The inserted peptide may be one that directs the AAV type 2 vector to target cells of interests. In particularembodiments, bradykinin may be inserted at any of the foregoing sites to target the vector to lung epithelial cells (e.g., for the treatment of cystic fibrosis or other lung disorders) or the adenovirus knob protein may be inserted at the foregoing sitesto target the vector to cells expressing CAR receptors. Alternatively, this vector may be employed for antigen presentation to produce an immune response.

In other embodiments, the substitution or insertion (preferably insertion) is made at nucleotides 3789 or 3961 of the AAV2 genome (e.g., new sequence would start at nu 3790 and 3962, respectively), or the corresponding site of other AAV serotypesas known by those skilled in the art. These positions correspond to insertions following amino acid 529 and 586, respectively, of the AAV2 capsid (Met #1 of Vp1 as amino acid 1; Table 2). In particular embodiments, there will be missense mutation atnucleotides 3790 3792 (Glu.fwdarw.Ile) or at nucleotides 3960 3961 (Gly.fwdarw.Val), respectively, due to the creation of a restriction site as part of the cloning strategy. In preferred embodiments of the invention, a targeting insertion at nu 3789 or3961 is combined with the 3761 mutation, which results in loss of heparin binding, to create a targeted capsid or parvovirus.

In other preferred embodiments an insertion or substitution (preferably, insertion) is made in the AAV2 capsid at nucleotides 3753, 3858, 3960, or 3987 (new sequence beginning at the next nucleotide), or the corresponding sites in AAV of otherserotypes. These sites correspond to insertions or substitutions following amino acids 517, 552, 586, or 595, respectively, of the AAV2 capsid (Met #1 of Vp1 as amino acid 1; Table 2), or the corresponding sites in AAV capsids of other serotypes asknown by those skilled in the art.

In other preferred embodiments, the insertion or substitution is made following amino acid 517, 529, 552, 586 or 595 of AAV capsids of other serotypes, e.g. (1, 2, 3, 5 or 6).

There is no particular lower or upper limit to the length of the amino acid sequence that may be inserted or substituted into the virus capsid, as long as the targeted or modified parvovirus capsid retains the desired properties (e.g., assembly,packaging, infectivity). The exogenous amino acid sequence may be as short as 100, 50, 20,16, 12, 8, 4 or 2 amino acids in length. Similarly, the exogenous amino acid sequence to be inserted/substituted into the parvovirus capsid may be as long as 2,5, 10, 12, 15, 20, 50, 100, 200, 300 or more amino acids. In particular embodiments, the exogenous amino acid sequence encodes an entire protein. Preferably, the exogenous amino acid sequence that is inserted/substituted into the parvovirus capsid isexpressed on the outside surface of the modified parvovirus capsid.

The present invention further provides targeted parvovirus capsid proteins, whereby a targeting sequence(s) is inserted or substituted into a parvovirus capsid protein, as described above. The targeted parvovirus capsid protein confers analtered tropism upon a virus vector or virus capsid (preferably, a parvovirus vector or capsid) incorporating the targeted parvovirus capsid protein therein as compared with the tropism of the native virus vector or virus capsid in the absence of thetargeted parvovirus capsid protein. Likewise, modified capsid proteins (modifications as described above for parvoviruses) are another aspect of the invention. The modified capsid protein may be incorporated into a parvovirus capsid or particle, e.g.,to facilitate purification and/or detection thereof or for the purposes of antigen presentation.

Further provided are targeted and/or modified parvovirus capsids as described in more detail above in connection with chimeric parvovirus capsids. In particular embodiments, the present invention provides targeted parvovirus "capsid vehicles",as has been described for AAV capsids, e.g., U.S. Pat. No. 5,863,541.

Molecules that may be packaged by the inventive parvovirus capsids and transferred into a cell include recombinant AAV genomes, which may advantageously may then integrate into the target cell genome, and other heterologous DNA molecules. RNA,proteins and peptides, or small organic molecules, or combinations of the same. Heterologous molecules are defined as those that are not naturally found in an parvovirus infection, i.e., those not encoded by the parvovirus genome. In a preferredembodiment of the present invention, a DNA sequence to be encapsidated may be linked to an AAV ITR sequence that contains the viral packaging signals, which may increase the efficiency of encapsidation and/or targeted integration into the genome.

The invention is further directed to the association of therapeutically useful molecules with the outside of the inventive parvovirus capsids for transfer of the molecules into host target cells. Such associated molecules may include DNA, RNA,carbohydrates, lipids, proteins or peptides. In one embodiment of the invention the therapeutically useful molecules is covalently linked (i.e., conjugated or chemically coupled) to the capsid proteins. Methods of covalently linking molecules are knownby those skilled in the art.

The targeted and/or modified parvovirus capsid proteins, capsids, and virus particles of the invention find use for raising antibodies against these novel capsid structures. Alternatively, an exogenous amino acid sequence may be inserted intothe parvovirus capsid for antigen presentation to a cell, e.g. for administration to a subject to produce an immune response to the exogenous amino acid sequence. According to this latter embodiment, it is not necessary that the exogenous amino acidsequence also alter the tropism of the parvovirus.

It will be appreciated by those skilled in the art that modified/targeted viruses and capsids as described above may also be chimeric and/or hybrid parvoviruses as described in the preceding sections. Those skilled in the art will furtherappreciate that the insertion mutants described herein include parvoviruses with other modifications, e.g., deletion, insertion or missense mutations. In addition, the mutations may incidentally be introduced into the parvovirus capsid or rAAV genome asa result of the particular cloning strategy employed.

Parvoviruses, AAV, and rAAV genomes are as described above with respect to hybrid parvoviruses. The present invention also provides cloning vectors, transcomplementing packaging vectors, packaging cells, and methods for producing the modifiedand/or targeted rAAV particles described above. In general, helpers, packaging cells, and methods for producing the targeted or modified parvoviruses are as described above with respect to hybrid and chimeric viruses. In addition, at least one of thecap genes (encoded by the rAAV genome, a packaging vector, or the packaging cell) has inserted or substituted therein at least one nucleic acid sequence encoding an exogenous targeting sequence (as described above) or an exogenous amino acid sequence (asdescribed above, e.g., for purification, detection or antigen presentation).

IV. Gene Transfer Technology.

The methods of the present invention provide a means for delivering heterologous nucleic acid sequences into a broad range of host cells, including both dividing and non-dividing cells. The vectors and other reagents, methods and pharmaceuticalformulations of the present invention are additionally useful in a method of administering a protein or peptide to a subject in need thereof, as a method of treatment or otherwise. In this manner, the protein or peptide may thus be produced in vivo inthe subject. The subject may be in need of the protein or peptide because the subject has a deficiency of the protein or peptide, or because the production of the protein or peptide in the subject may impart some therapeutic effect, as a method oftreatment or otherwise, and as explained further below.

In general, the present invention may be employed to deliver any foreign nucleic acid with a biological effect to treat or ameliorate the symptoms associated with any disorder related to gene expression. Illustrative disease states include, butare not limited to: cystic fibrosis (and other diseases of the lung), hemophilia A, hemophilia B, thalassemia, anemia and other blood disorders, AIDs, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis,epilepsy, and other neurological disorders, cancer, diabetes mellitus, muscular dystrophies (e.g., Duchenne, Becker), Gaucher's disease, Hurler's disease, adenosine deaminase deficiency, glycogen storage diseases and other metabolic defects, retinaldegenerative diseases (and other diseases of the eye), diseases of solid organs (e.g., brain, liver, kidney, heart), and the like.

Gene transfer has substantial potential use in understanding and providing therapy for disease states. There are a number of inherited diseases in which defective genes are known and have been cloned. In some cases, the function of these clonedgenes is known. In general, the above disease states fall into two classes: deficiency states, usually of enzymes, which are generally inherited in a recessive manner, and unbalanced states, at least sometimes involving regulatory or structuralproteins, which are inherited in a dominant manner. For deficiency state diseases, gene transfer could be used to bring a normal gene into affected tissues for replacement therapy, as well as to create animal models for the disease using antisensemutations. For unbalanced disease states, gene transfer could be used to create a disease state in a model system, which could then be used in efforts to counteract the disease state. Thus the methods of the present invention permit the treatment ofgenetic diseases. As used herein, a disease state is treated by partially or wholly remedying the deficiency or imbalance that causes the disease or makes it more severe. The use of site-specific integration of nucleic sequences to cause mutations orto correct defects is also possible.

The instant invention may also be employed to provide an antisense nucleic acid to a cell in vitro or in vivo. Expression of the antisense nucleic acid in the target cell diminishes expression of a particular protein by the cell. Accordingly,antisense nucleic acids may be administered to decrease expression of a particular protein in a subject in need thereof. Antisense nucleic acids may also be administered to cells in vitro to regulate cell physiology, e.g., to optimize cell or tissueculture systems. The present invention is also useful to deliver other non-translated RNAs, e.g., ribozymes (e.g., as described in U.S. Pat. No. 5,877,022), RNAs that effect spliceosome-mediated trans-splicing (Puttaraju et al., (1999) Nature Biotech. 17:246), or "guide" RNAs (see, e.g., Gorman et al., (1998) Proc. Nat. Acad. Sci. USA 95:4929; U.S. Pat. No. 5,869,248 to Yuan et al.) to a target cell.

Finally, the instant invention finds further use in diagnostic and screening methods, whereby a gene of interest is transiently or stably expressed in a cell culture system, or alternatively, a transgenic animal model.

V. Subjects, Pharmaceutical Formulations, Vaccines, and Modes of Administration.

The present invention finds use in both veterinary and medical applications. Suitable subjects include both avians and mammals, with mammals being preferred. The term "avian" as used herein includes, but is not limited to, chickens, ducks,geese, quail, turkeys and pheasants. The term "mammal" as used herein includes, but is not limited to, humans, bovines, ovines, caprines, equines, felines, canines, lagomorphs, etc. Human subjects are the most preferred. Human subjects include fetal,neonatal, infant, juvenile and adult subjects.

In particular embodiments, the present invention provides a pharmaceutical composition comprising a virus particle of the invention in a pharmaceutically-acceptable carrier or other medicinal agents, pharmaceutical agents, carriers, adjuvants,diluents, etc. For injection, the carrier will typically be a liquid. For other methods of administration, the carrier may be either solid or liquid, such as sterile, pyrogen-free water or sterile pyrogen-free phosphate-buffered saline solution. Forinhalation administration, the carrier will be respirable, and will preferably be in solid or liquid particulate form. As an injection medium, it is preferred to use water that contains the additives usual for injection solutions, such as stabilizingagents, salts or saline, and/or buffers.

In other embodiments, the present invention provides a pharmaceutical composition comprising a cell in which an AAV provirus is integrated into the genome in a pharmaceutically-acceptable carrier or other medicinal agents, pharmaceutical agents,carriers, adjuvants, diluents, etc.

By "pharmaceutically acceptable" it is meant a material that is not biologically or otherwise undesirable, e.g., the material may be administered to a subject without causing any undesirable biological effects. Thus, such a pharmaceuticalcomposition may be used, for example, in transfection of a cell ex vivo or in administering a viral particle or cell directly to a subject.

The parvovirus vectors of the invention maybe administered to elicit an immunogenic response (e.g., as a vaccine). Typically, vaccines of the present invention comprise an immunogenic amount of infectious virus particles as disclosed herein incombination with a pharmaceutically-acceptable carrier. An "immunogenic amount" is an amount of the infectious virus particles that is sufficient to evoke an immune response in the subject to which the pharmaceutical formulation is administered. Typically, an amount of about 10.sup.3 to about 10.sup.15 virus particles, preferably about 10.sup.4 to about 10.sup.10, and more preferably about 10.sup.4 to 10.sup.6 virus particles per dose is suitable, depending upon the age and species of thesubject being treated, and the immunogen against which the immune response is desired. Subjects and immunogens are as described above.

The present invention further provides a method of delivering a nucleic acid to a cell. For in vitro methods, the virus -may be administered to the cell by standard viral transduction methods, as are known in the art. Preferably, the virusparticles are added to the cells at the appropriate multiplicity of infection according to standard transduction methods appropriate for the particular target cells. Titers of virus to administer can vary, depending upon the target cell type and theparticular virus vector, and may be determined by those of skill in the art without undue experimentation. Alternatively, administration of a parvovirus vector of the present invention can be accomplished by any other means known in the art.

Recombinant virus vectors are preferably administered to the cell in a biologically-effective amount. A "biologically-effective" amount of the virus vector is an amount that is sufficient to result in infection (or transduction) and expressionof the heterologous nucleic acid sequence in the cell. If the virus is administered to a cell in vivo (e.g., the virus is administered to a subject as described below), a "biologically-effective" amount of the virus vector is an amount that issufficient to result in transduction and expression of the heterologous nucleic acid sequence in a target cell.

The cell to be administered the inventive virus vector may be of any type, including but not limited to neural cells (including cells of the peripheral and central nervous systems, in particular, brain cells), lung cells, retinal cells,epithelial cells (e.g., gut and respiratory epithelial cells), muscle cells, pancreatic cells (including islet cells), hepatic cells, myocardial cells, bone cells (e.g., bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes,fibroblasts, endothelial cells, prostate cells, germ cells, and the like. Alternatively, the cell may be any progenitor cell. As a further alternative, the cell can be a stem cell (e.g., neural stem cell, liver stem cell). Moreover, the cells can befrom any species of origin, as indicated above.

In particular embodiments of the invention, cells are removed from a subject, the parvovirus vector is introduced therein, and the cells are then replaced back into the subject. Methods of removing cells from subject for treatment ex vivo,followed by introduction back into the subject are known in the art. Alternatively, the rAAV vector is introduced into cells from another subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to asubject in need thereof.

Suitable cells for ex vivo gene therapy include, but are not limited to, liver cells, neural cells (including cells of the central and peripheral nervous systems, in particular, brain cells), pancreas cells, spleen cells, fibroblasts (e.g., skinfibroblasts), keratinocytes, endothelial cells, epithelial cells, myoblasts, hematopoietic cells, bone marrow stromal cells, progenitor cells, and stem cells.

Dosages of the cells to administer to a subject will vary upon the age, condition and species of the subject, the type of cell, the nucleic acid being expressed by the cell, the mode of administration, and the like. Typically, at least about10.sup.2 to about 10.sup.8, preferably about 10.sup.3 to about 10.sup.6 cells, will be administered per dose. Preferably, the cells will be administered in a "therapeutically-effective amount".

A "therapeutically-effective" amount as used herein is an amount of that is sufficient to alleviate (e.g., mitigate, decrease, reduce) at least one of the symptoms associated with a disease state. Alternatively stated, a"therapeutically-effective" amount is an amount that is sufficient to provide some improvement in the condition of the subject.

A further aspect of the invention is a method of treating subjects in vivo with the inventive virus particles. Administration of the parvovirus particles of the present invention to a human subject or an animal in need thereof can be by anymeans known in the art for administering virus vectors.

Exemplary modes of administration include oral, rectal, transmucosal, topical, transdermal, inhalation, parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular, and intraarticular) administration, and the like, as well as directtissue or organ injection, alternatively, intrathecal, direct intramuscular, intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections. Injectables can be prepared in conventional forms, either as liquid solutions orsupenisions, soild forms suitable for solution or suspenions in liquid prior to injection, or as emulsions. Alternatively, one may administer the virus in a local rather than systemic manner, for example in a depot or sustained-release formation.

In particularly preformed embodiments of the invention, the nucleotide sequence of interest is delivered to the liver of the subject. Administration to the liver may be achieved by any method known in art, including, but not limited tointravenous administration, intraportal administration, intrabilary administration, intra-arterial administration, and direct injection into the liver paraenchyma.

Preferably, the cells (e.g., liver cells) are infected by a recombiant parvovirus vector encoding a peptide or protein, the cells express the encoded peptide or protein and secrete it into the circulatory system in a therapeutically-effectiveamount (as defined above). Alternatively, the vector is delivered to and expressed by another cell or tissue, including but not limited to, brain, pancreas, spleen or muscle.

In other preferred embodiments, the inventive parovirus particles are administered intramuscularly, more preferably by intramuscular injection or by local administration (as defined above). In other preferred embodiments, the parovirus particlesof the present invention are administered to the lungs.

The parovirus vector disclosed herein may be administered to the lungs of a subject by any suitable means, but are preferably administered by adminsitering an aresol suspension of respirable particles comprised of the inventive parovirus vectors,which the subject inhales. The respirable particles may be liquid or solid. Aerosols of liquid particles comprising the inventive parovirus vectors may be produced by any suitable means, such as with a pressure-driven aerosol nebulizer or an ultrasonicnebulizer, as is known to those of skill in art. See, e.g. U.S. Pat. No. 4,501,729. Aerosols of solid particles comprising the inventive virus vectors may likewise be produced with any solid particulate medicament aerosol generator, by techniquesknown in the pharmaceutical art.

Dosages of the inventive parvovirus particles will depend upon the mode of administration, the disease or condition to be treated, the individual subject's condition, the particular virus vector, and the gene to be delivered and can be determinedin a routine manner. Exemplary doses for achieving therapeutic effects are virus titers of at least about 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11, 10.sup.12, 10.sup.13, 10.sup.14, 10.sup.15 transducting units or more,preferably about 10.sup.8 10.sup.13 transducting units, yet more preferably 10.sup.12 transducing units.

In particular embodiments of the invention, more than one administration (e.g., two, three, four, or more administrations) may be employed to achieve therapeutic levels of gene expression. According to this embodiment and as described above, itis preferred to use parvovirus vectors having different entigenic properties for each administration to obviate the effects of neutralizing antibodies. As described above, in particular embodiments of the invention, the hybrid and chimeric parvovirusesof the present invention are administered to circumvent neutralizing antibodies in the subject to be treated or to prevent the development of an immune response in the subject. The subject may be presented with seemingly new virus vectors by packagingthe rAAV genome within an array of hybrid or chimeric parvovirus capsids.

The foregoing discussion also pertains to pharmaceutical formulations containing parvovirus capsids and other reagents of the invention as well as methods of administering the same.

In summary, the parvovirus vectors, reagents, and methods of the present invention can be used to direct a nucleic acid to either dividing or non-dividing cells, and to stably express the heterologous nucleic acid therein. Using this vectorsystem, it is now possible to introduce into cells, in vitro or in vivo, genes that encode proteins that affect cell physiology. The vectors of the present invention can thus be useful in gene therapy for disease states or for experimental modificationof cell physiology.

Having now described the invention, the same will be illustrated with reference to certain examples, which are included herein for illustration purposes only, and which are not intended to be limiting of the invention.

EXAMPLE 1

AAV Vectors

All production of AAV vectors used in these investigations utilized the vector production scheme as described in Ferrari et al., (1997) Nature Med. 3:1295 and Xiao et al., (1998) J. Virology 72:2224. Utilizing a transient transfectionprocedure, rAAV devoid of adenovirus has been generated. Id. This protocol utilizes an adenovirus DNA genome that has been incapacitated for viral replication and late gene expression. The mini Ad plasmid while unable to replicate and produce progeny,is still viable for adenovirus gene expression in 293 cells. Using this construct, the AAV packaging strategy involving new AAV helper plasmid (pAAV/Ad ACG) and AAV vector DNA (sub 201) has been successfully complemented (Samulski et al., (1989) J ofVirology 63:3822). This new construct typically generates rAAV of 10.sup.7 10.sup.9/10 cm dish of 293 cells (Xiao et al., (1998) J. Virology, 72:2224). Efficient gene delivery is observed in muscle, brain and liver with these vectors in the completeabsence of Ad.

EXAMPLE 2

Cells and Viruses

Human 293 and HeLa cells were maintained at 37.degree. C. with 5% CO.sub.2saturation in 10% fetal bovine serum (Hyclone) in Dulbecco's modified Eagles medium (Gibco BRL), with streptomycin and penicillin (Lineberger Comprehensive Cancer Center,Chapel Hill, N.C.) Four.times.10.sup.6 293 cells were plated the day before transfection onto a 10 cm plate. Cells were transfected by both calcium phosphate (Gibco BRL) or Superfection (Qiagene) according to manufacturers specifications. Theinsertional mutant packaging plasmids, described below, were transfected along with pAB11 containing the CMV driven Lac Z gene with a nuclear localization signal. For each transfection the same amount of packaging plasmid (12 .mu.g) and pAB11 (8 .mu.g)were used for each 10 cm plate. For each transfection an additional plate was used containing the transgene plasmid only to assess transformation efficiencies. After transfection the cells were infected with helper virus Ad5 dl309 at an MOI of 5, and48 hours later the cells were lysed and the virus purified.

Recombinant virus was purified using cesium chloride isopycnic or iodixanol gradients. In both cases cells were centrifuged at 1500 rpms (Sorvall RT 6000B) for ten minutes at 4.degree. C. Proteins were precipitated from the supernatant usingammonium sulfate (30% w/v) and resuspended in 1.times. Phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na.sub.2HPO.sub.47H.sub.2O, 1.4 mM KH.sub.2PO.sub.4). The cell pellet was resuspended in 1.times.PBS containing 0.1 mg/ml DNase I(Boehringer Mannheim) lysed by three freeze-thaw cycles, combined with the protein portion of the supernatant, and incubated at 37.degree. C. for 30 minutes. This material was subjected to sonication (Branson Sonifer 250, VWR Scientific), 25 bursts at50% duty, output control 2. Cell debris was removed by centrifugation (Sorvall RT 6000B). To each milliliter of supernatant 0.6 g of cesium chloride (CsCl) was added and the solution was centrifuged for 12 18 hours (Beckman Optima TLX ultracentrifuge)in a TLS 55 rotor at 55,000 rpms. Alternatively, the supernatant was layered on top of an Iodixanol (OptiPrep--Nycomed Pharma As, Oslo, Norway) gradient of 60%, 45%, 30% and 15%. This gradient was centrifuged in a Beckman Optima TLX ultracentrifugeusing a TLN 100 rotor at 100,000 rpm for one hour. Fractions were recovered from these gradients and 10 .mu.l from each fraction were utilized for dot blot hybridization to determine which fraction contained the peack protected viron (see Example 5).

EXAMPLE 3

Construction of AAV Packaging Plasmids

The capsid domain of pAAV/Ad was cloned into pBS+ (Stratagene) using Hind III, resulting in pAV2Cap. Partial digestion of pAV2Cap using the restriction enzymes Hae III, Nla IV, and Rsa I and gel purification of the unit length DNA fragmentresulted in the isolation of the starting material for cloning. The aminoglycoside 3'-phosphotranferase gene, conferring kanamycin resistance (kan.sup.r), from pUC4K (Pharmacia) digested with Sal I was flanked by linkers containing Nae I and Eco RVsites, a Sal I overhang at one end and an Eco RI overhang at the other end (top 5'-AATTCGCCGGCGATATC-3', SEQ ID NO:6, bottom 5'-TCGAGATATCGCCGGC-3'SEQ ID NO:7). This fragment was cloned into the Eco RI site of pBluescript SK+ (Stratagene). Digestionwith Nae I released the kan.sup.r gene, and this fragment was ligated into the pAV2Cap partials. The resulting plasmids were screened for insertion into the capsid domain and, then digested with Eco RV to remove the kan.sup.r gene leaving the twelvebase pair insertion 5'-GGCGATATCGCC-3'(SEQ ID NO: 8) within the capsid domain. Multiple enzyme digests and DNA sequencing were used to determine the position of the 12 bp insertion within the capsid coding domain. The enzyme digests include Eco RV/BanII, Eco RV/Bst NI, Eco RV/Pst II and Eco RV/Hind III. The capsid domain of the resulting plasmids were digested with Asp718 and subcloned into the pACG2 packaging plasmid (Li et al., 1997 J. Virology 71:5236), with the exception of one NlaIV clone thatoverlapped the 3'-Asp718 site. This insertion mutant was cloned into pAAV/Ad using a Hind III/Nsi I digestion.

EXAMPLE 4

Western Blotting

Cell lysates after freeze thaw lysis and sonication was centrifuged to remove large cell debris. Twenty microliters of supernatant was immediately added to 20 .mu.l of 2.times.SDS gel-loading buffer containing dithiothreitol and boiled for fiveminutes. Proteins were analyzed by SDS polyacrylamide gel electrophoresis and transferred to nitrocellulose electrophoretically. The nitrocellulose membranes were immunoblotted using the anti-Vp3 monoclonal antibody B1 (a generous gift from Jurgen A.Kleinschmidt). Each of the insertion mutants was tested at least twice by Western blot analysis. The secondary anti-mouse Horseradish Peroxidase IgG was used to indirectly visualize the protein by enhanced chemiluminescence (ECL-Amersham). The Westernblots were scanning from enhanced chemiluminescence exposed BioMax film (Kodak) into Adobe PhotoShop and analyzed by ImageQuaNT software (Molecular Dynamics Inc.).

Viral proteins were visualized by Western blotting followed by immunoblotting as described above. Between 1.0.times.10.sup.9 and 2.5.times.10.sup.9 viral particles were used for each sample. The virus was isolated from the peak cesium gradientfraction as determined by dot blot, and dialysed against 0.5.times. PBS containing 0.5 mM MgCl.sub.2 prior to polyacrylamide gel electophoresis.

EXAMPLE 5

Titration of Recombinant Virus

Fractions from CsCl gradients were obtained by needle aspiration. The refractive index was obtained using a refractometer (Leica Mark II), and the index was used to determine the density of fractions. Aliquots of 10 .mu.l from fractions between1.36 g/ml and 1.45 g/ml were tested for the presence of protected particles by dot blot hybridization. The aliquots were diluted 1:40 in viral dilution buffer (50 mM Tris HCl, 1 mM MgCl.sub.2, 1 mM CaCl.sub.2 10 .mu.g/ml RNase, 10 .mu.g/ml DNase) andincubated at 37.degree. C. for 30 minutes. To the samples Sarcosine (final concentration 0.5%) and EDTA (final 10 mM) were added and incubated at 70.degree. C. for 10 minutes. Proteinase K (Boehringer Mannheim) was added to a final concentration of 1mg/ml and the samples were incubated at 37.degree. C. for two hours. Following this incubation the samples were denatured in NaOH (350 mM final) and EDTA (25 mM final). The samples were applied to equilibrated nytran (Gene Screen Plus, NEN LifeScience Products) using a dot blot manifold (Minifold I, Schleicher and Schuell). The membrane was probed with a random primed (Boehringer Mannheim) .sup.32P-dCTP labeled Lac Z DNA fragment. The membranes were exposed to film (BioMax MR, Kodak) or tophosphor imagining screens (Molecular Dynamics) and intensity estimates were done using ImageQuant software (Molecular Dynamics). Peak fraction of virus were then dialysed in 1.times.PBS for transducing filter.

Transductions titers were determined by histochemical staining for Lac Z activity. HeLa cells had been infected with Ad dl309 at a multiplicity of infection of five for one hour. The cells were then washed with 1.times.PBS and fresh medium wasadded. Aliquots of virus from peak fractions, equivalent to 1.75.times.10.sup.8 particles were used to infect Hela cells. Twenty to twenty-four hours later cells were washed with 1.times.PBS, fixed (2% formaldehyde 0.2% gluteraldehyde in 1.times.PBS),washed, and stained with 5'-Bromo-4-chloro-3-indoly-.beta.-D-galactophyranoside (Gold Bio Technology) dissolved in N,N-dimethylformamide (Sigma) diluted to 1 mg/ml in 1.times.PBS pH7.8, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mMMgCl.sub.2 at 37.degree. C. for 12 24 hours. Stained HeLa cells were counted in ten 400.times. microscope fields. The transducing number was determined by averaging the number of stained cells in ten fields and multiplying by the number of fields onthe plate and dividing that number by the number of nanograms of protected template.

EXAMPLE 6

Electron Microscopy

Peak fractions of rAAV with wildtype viron or mutagenized virions were dialysed in 0.5.times.PBS containing 0.5 mM MgCl.sub.2. The virus was placed on a 400 mesh glow discharged carbon grid by inverting on a 10 .mu.l drop of virus for tenminutes at room temperature. Followed by three 1.times.PBS washes for one minute each. The virus was stained in 1% Phosphotungstic acid for one minute. Specimens were visualized using a Zeiss EM 910 electron microscope.

EXAMPLE 7

Heparin Agarose Binding Assay

Recombinant virus containing wild-type capsids or insertion in the capsids were dialysed against 0.5.times.PBS containing 0.5 mM MgCl.sub.2. One hundred microliters of each virus was bound to 100 .mu.l of heparin agarose type 1 (H-6508 Sigma,preequilibrated in twenty volumes of 0.5.times.PBS containing 0.5 mM MgCl.sub.2) at room temperature for one hour in a 1.5 ml microfuge tube. After each step, binding washes and elutions samples were centrifuged at 2000 rpm (Sorvall MC 12V) for twominutes to collect supernatant. Samples were washed six times with 0.5 ml of 0.5.times.PBS containing 0.5 mM MgCl.sub.2, and the supernatant collected. Samples were eluted in three steps of 100 .mu.l volumes containing 0.5, 1.0 and 1.5 M NaCl in0.5.times.PBS containing 0.5 mM MgCl.sub.2 and the supernatant collected. For each sample 20 .mu.l of supernatant from each step was used for dot blot hybridization. The 100% bound control was an internal standard equivalent to one fifth of each inputvirus used in the dot blot. The heparin agarose viral mixtures were washed six times with 0.5.times.PBS 0.5 mM MgCl.sub.2 in volumes that resulted in a 1:15625 dilution.

EXAMPLE 8

Construction of Insertional Mutations in rAAV2

In order to evaluate the role of AAV structural proteins in assembly and infectivity, we generated a collection of capsid linker insertion mutants. A 2.8 kb Hind III fragment of pAAV/Ad (Samulski et al., (1989) J. Virology 63:3822) containingthe sequences coding for the capsid domain of AAV2 was subcloned into pBS+. This plasmid, pAV2Cap, was used for partial digestion with Hae III, Nla IV, and Rsa I to generate a substrate for capsid specific insertions (FIG. 1). These three DNArestriction enzymes constitute 43 sites that span across the AAV-2 capsid coding sequence of which only 4 overlap. To efficiently identify clones that contain insertions, a kanamycin resistance gene (Kan.sup.r) flanked by a novel oligo (Nae I/EcoR V)was ligated with partially digested, full-length, linearized pAV2Cap (see Example 3 and FIG. 1). Using ampicillin and kanamycin selection in E. coli, insertion mutants were identified and the Kan.sup.r gene was shuttled out of the capsid coding regionby digesting and religation with the nested pair of Eco RV sites (see Example 3). This resulted in a specific linker insertion of 12 base pair (bp) carrying a single copy of the unique Eco RV site in the capsid coding sequences. The exact positions ofthe linker insertion were further refined by restriction enzyme digestions, and in six cases sequencing (data not shown). The position of insertion mutants are identified by the first letter of the enzyme used in the partial digestion followed by thenucleotide position of the restriction site in the AAV2 genome, for example Nla IV 4160 would be N4160.

The capsid coding sequence from these mapped insertion mutants were subcloned into the helper vectors pACG2 or pAAV/Ad for biological characterization in vivo (FIG. 1) (Li et al., (1997) J. Virology 71:5236; Samulski et al., (1989) J. Virology63:3822). Sequence analysis predicts that this 12 base pair insertion cannot result in a termination codon for any of the 43 insertion sites (Table 1). Owing to the random nature of the cut site for the enzymes (Hae III, Nla IV, and Rsa I) with respectto codon frame usage and the degeneracy of the Nla IV recognition sequence, the 12 bp linker resulted in the insertion of the amino acids GDIA in frame 1 and AISP in frame 3 for all three enzymes, while insertions in frame 2 resulted in WRYRH for Rsa I.GRYRP for Hae III, and both GRYRP and GRYRH for Nla IV. The bolded amino acid in these examples represents missense mutation (Table 1). The mutant helper constructs, pACG2.sup.IN, were individually transfected into 293 cells along with an AAV reportervector, containing the .beta.-galactosidase gene in Adenovirus dl309 (MOI=5) infected cells (Li et al., (1997) J. Virology 71:5236). The transfected cells were then assayed for capsid expression and recombinant virus production (see Example 5; Li etal., (1997) J. Virology 71:5236).

TABLE-US-00002 TABLE 1 Physical Structure and Phenotype of AAV2 Capsid Insertion Mutants Position.sup.1 Capsid Heparin Electron inserted subunit Frame.sup.2 Dot blot.sup.3 Infectious.sup.4 Agarose.sup.5 Microscope Phenotype Amino Acid.sup.6H2285 VP1 3 2.8 .times. 10.sup.7 - + normal Class II AISP R2356 VP1 2 1.4 .times. 10.sup.8 + + N.D. Class III WRYRH N2364 VP1 1 -- - N.D. N.D. Class I GDIA H2416 VP1 2 1.4 .times. 10.sup.7 - + N.D. Class II GRYRP H2591 VP1 3 1.4 .times. 10.sup.7+ + normal Class III AISP H2634 VP2 1 2.8 .times. 10.sup.7 - + normal Class II GDIA H2690 VP2 3 7.0 .times. 10.sup.6 + + normal Class III AISP R2747 VP2 3 -- - N.D. N.D. Class I AISP H/N2944 VP3 2 1.4 .times. 10.sup.6 +* N.D. N.D. Class II/IIIGRYRP N3317 VP3 3 1.4 .times. 10.sup.5 - N.D. N.D. Class II AISP R3391 VP3 2 -- - N.D. N.D. Class I WRYRH N3561 VP3 1 -- - N.D. N.D. Class I GDIA H3595 VP3 2 1.4 .times. 10.sup.6 +* N.D. abnormal Class II/III GRYRP H/N3761 VP3 3 1.4 .times. 10.sup.7 - - normal Class II AISP H3766 VP3 2 2.8 .times. 10.sup.7 - N.D. N.D. Class II GRYRP N4046 VP3 3 -- - N.D. N.D. Class I AISP H/N4047 VP3 1 -- - N.D. N.D. Class I GDIA N/R4160 VP3 3 1.4 .times. 10.sup.7 + + normal Class III AISP .sup.1Theletter refers to the restriction enzyme used in the partial digestion and the number refers to nucleotide of the restriction site in the AAV2 sequence. .sup.2Reading frame of the restriction site. .sup.3The particle number per microliter of sample. (-) = < 10.sup.5 genomes. .sup.4Infections were done using 1.75 .times. 10.sup.8 particles of rAAV insertion mutants in adenovirus infected HeLa cells. .sup.5By batch binding and assayed by infection of HeLa cells (Class III) or by dot blot (ClassII). .sup.6Amino acids differ depending on the frame of the insertion. The bolded amino acid is a missense mutation.

EXAMPLE 9

Analysis of Capsid Proteins

Before assaying for vector production using mutant capsid constructs in complementation assays, each insertion mutant was tested for expression of capsid subunits in 293 cells after transfection. The ability to produce Vp1, Vp2, and Vp3 atnormal stoichiometry would suggest that linker insertions did not alter capsid protein expression, or stability. Since the linker did not introduce stop codons, it was expected that each insert would produce all three capsids. Forty-eight hours aftertransfection, cell lysates were analyzed by Western blot for AAV capsids. The Western blot analysis in FIG. 2 is a representation of insertion mutant capsid expression in cell lysates. With the exception of H2634 (FIG. 2 lane 2), the stoichiometry ofthe three capsid subunits does not appear significantly different than that of wild-type controls (FIG. 2 compare lanes 1,3 7 to lane 8). By this assay, insertion mutant H2634 appears to only produce Vp3 subunits (FIG. 2; lane 2). In longer exposures,the minor capsid subunits in FIG. 4 lanes 4 and 5 were apparent (data not shown).

EXAMPLE 10

Mutant Capsid Ability to Produce Stable Virions

To test for the production of stable virions that protect a vector genome from DNase digestion, we subjected the cell lysates to cesium chloride (CsCl) gradient centrifugation. Virus densities were measured by refractometry, and aliquots fromappropriate fractions were subjected to dot blot hybridization (FIG. 3a). Based on this analysis, particles that package intact recombinant genomes should display a buoyant density similar to wild-type and be resistant to DNase treatment, with theexception of H2944 which has a buoyant density slightly higher than wild type. Results for this assay separated insertion mutants into two classes. Class I mutants were negative for protecting the viral genome, while class II mutants appeared normalfor packaging and protecting the vector substrate (Table I).

All class II mutants had a buoyant density within the range of wild-type AAV2 capsids (FIG. 3a). By dot blot analysis, N2944 packaged the recombinant genome but migrated to a position of slightly greater density than wild type in isopycnicgradients (FIG. 3a, N2944 lane 3). A number of insertion mutants (7) did not package DNA by this assay which had a sensitivity of <1.times.10.sup.5 particles/.mu.l (see methods for quantitation) (Table 1). Whether these mutants were defective inpackaging or unstable during purification remains to be determined.

EXAMPLE 11

Infectivity of Class II Insertion Mutants

Virions generated by insertion mutants in the complementation assay were tested for infectivity by monitoring transduction of LacZ reporter gene in human cells. Using viral titers derived from dot blot hybridization, HeLa cells were infectedwith mutant virus stocks at equivalent particle numbers.

Twenty-four hour post infection, expression of the transgene was detected by X-gal staining. A representative figure of this analysis is shown (FIG. 3b) and all mutanta assayed are presented in Table 1. In this assay, wild-type virionstransduced 5.6.times.10.sup.5 HeLa cells/1.75.times.10.sup.8 protected particles (FIG. 3b). Based on the sensivity of this assay, the range of infection efficiency for class II insertion mutant viruses was from 0 to 1.6.times.10.sup.6 transducingunits/1.75.times.10.sup.8 protected particles. Results from this analysis further subdivided the capsid insertion mutants from class II (normal for packaging and protecting the vector substrate) into a class III phenotype (normal for packaging andprotecting the vector substrate and infectious virions). Two insertion mutants negative for infectivity and initially identified as class II mutants (N2944, H3595) based on CsCl purification and DNase protection, tested positive for viral transductionafter purification using an iodixanol step gradient (Table 1). This virus purification technique is not as harsh as CsCl and has been shown to increase virus recovery by ten-fold (Zolotukhin et al., (1999) Gene Therapy 6:973). However, other class IImutants remained non-infectious after purification using an iodixanol step gradient (data not shown). Although we determined that insertion mutant viruses N2944 and H3595 were infectious using the Lac Z transduction assay, it should be noted that thesemutants resulted in low infectious titers (1.times.10.sup.2 transducing units/ng) similar to previously published lip mutants (Hermonat et al., (1984) J. Virology 51:329).

EXAMPLE 12

Electron Microscopy of Class II and Class III Mutants

To further characterize class II and III rAAV2 insertion mutants for biological differences, we visualized mutant particles by electron microscopy (EM). The EM analysis revealed only gross morphology of the infectious class III viruses, whichwere indistinguishable from wild-type virions (Compare FIG. 4a, and 4b,c). Whereas distinct differences were observed between class II/III mutant virus H3595 when compared to wild-type virions (FIG. 4a, and 4f-bottom four panels). EM images of H3595revealed a slightly larger roughly pentagonal outline, while wild-type virus appeared uniformed in size and was hexagonal. Interestingly, class II mutant H2634, which was negative for Vp1 or Vp2 by Western blot (FIG. 2 lane 2), appeared normal inmorphology by EM analysis (FIG. 4d). Based on this analysis, virion morphology alone is not sufficient to distinguish class II mutants from class III since small insertions within the capsids can result in either non-detectable (FIG. 4b,c,d,e) ornoticeable alterations in virion structure (FIG. 4f-bottom four panels). However, this approach was able to provide additional data to our characterization of these linker insertion mutants (FIG. 4, compare a to f).

EXAMPLE 13

Capsid Ratio of Class II and Class III Virions

Rose et al., (1971) established that AAV2 particles are composed of Vp1, Vp2, and Vp3 at a 1:1:20 ratio (Rose et al., (1971) J. Virology 8:766). In an effort to determine if class II and class III mutant virions maintained this ratio, Westernblots were performed on the cesium chloride purified virus. Purified viruses analyzed by Western blot showed similar amounts of Vp3 in all mutants sampled (FIG. 5, Vp3 arrow), between 1.times.10.sup.9 and 2.5.times.10.sup.9 viral particles were used foreach sample. The amounts of Vp2 and Vp1 are also nearly equivalent in all test samples except H2634 where no minor capsid components were observed (FIG. 5, lane 5). The lack of minor capsid components for H2634 is consistent with the Western resultsfrom cell lysate (FIG. 2). At the limit of detection in this assay, the class II insertion mutant H2634 appears to assemble AAV virions without Vp1 and Vp2, even though EM analysis suggest this mutant has normal morphology (FIG. 4d).

EXAMPLE 14

Heparin Binding of Class II and Class III Mutants

Recently our lab established that AAV-2 uses a heparan sulfate proteoglycan as a primary receptor for infectivity (Summerford and Samulski, (1998) J. Virology 72:1438). To determine what role heparin binding may have in class II particlesinability to infect cells as well as the ability of class III virus to bind heparin agarose, heparin batch binding experiments were performed. Not surprisingly, all class III mutants were positive for heparin binding, with the majority of virus elutingin the 1M NaCl.sub.2 step (data not shown). To determine if loss of infectivity of class II mutant viruses was related to a lack of heparin binding, batch binding experiments were analyzed by dot blot hybridization (FIG. 6). For each of the viralsamples tested, an internal control to determine 100% bound was spotted on the filter independent of heparin binding (FIG. 6; 100% bound). This allowed us to determine percent virus retained, at each step of heparin purification. After binding toheparin agarose, samples were washed then eluted using increasing salt concentrations (see Example 7). Recombinant AAV2 with wild-type virion shells demonstrated 90% binding with 10% released in the wash followed by 60% recovered in the elution buffer,and 20% remaining bound to heparin agarose (FIG. 6, lane 1). Class II mutants H2285, H2416, and H2634 demonstrated similar binding and elution profiles (FIG. 6, lanes 2 4). However, class II mutant H3761 was distinct in its heparin agarose bindingprofile with the majority of the virion in the binding buffer and the washes (FIG. 6, lane 5). Further analysis is required to determine the reason for lack of Heparin binding in this batch assay.

Interestingly, H2634 binds heparin agarose under these conditions, which by Western blot does not carry detectable Vp1 or Vp2 subunits (FIG. 5, lane 4). The lack of Vp1 and Vp2 in H2634 along with its ability to bind heparin agarose suggest thatthe heparin binding domain may be located in Vp3 capsid proteins.

EXAMPLE 15

Linker Insertion Mutants

Insertion sequences encoding poly-lysine, poly-histidine, an RGD motif, or bradykinin were inserted into the linker mutants described in Table 1. We developed a PCR-based method of identifying insertions of different linkers into the codingdomain of AAV2 capsid gene. Briefly, one primer was used outside of the capsid coding region and one that corresponds exactly to the linker. If the linker is in the correct orientation, then the PCR product is of a size that is dependent on theinsertion mutant's position.

After transformation of the ligation reactions, bacterial colonies were picked with a pipet tip and dipped 4 5 times into a well of a 96-well plate containing LB-medium with antibiotic. The pipet tip was then placed in a well of a 96-well platecontaining PCR reaction buffer. The PCR products were run out on an agarose gel, and positive clones were identified. This information indicated the orientation and the position of the insertion mutant with respect to the outside primer.

The LB-medium that is in the corresponding well was used as the PCR positives, and this material was grown in a larger (5 mL) volume. After an overnight growth phase, the plasmid DNA was islolated and digested with an enzyme that restricts theDNA 15 times (Bst NI). These digestion products were separated on a 5 6% acrylamide gel. Depending upon the size of the linker insertion and the size of the corresponding uninserted fragment, the number of inserts is determined. This, within two daysof ligating the linker into the insertion site, we know the orientation and number of linker insertion, and we have sufficient DNA to transfect a 10 cm plate for virus production.

pACG2 (Li et al., 1997 J. Virology 71:5236) without any insertion when digested with Bst N1 yields fragments of:

3900 bp

1121 bp

1112 bp

445 bp-H2944 shifts

347 bp-H2634, H2690 shifts

253 bp-H3595 shifts

215 bp-R2356, H2416 shifts

121 bp

111 bp

64 bp

63 bp-H2285 shifts

33 bp-H2591 shifts

13 bp

9 bp

The band shifts with the different insertion mutants are also indicated.

pACG2 without any insertion when digested with Ban I yields fragments of:

2009 bp

1421 bp

168 bp

843 bp-H4047 shifts

835 bp

734 bp-H2634 shifts

464 bp

223 bp

218 bp

211 bp

50 bp

Each of the inserts contains the original 12 base pairs of the Eco RV site. In addition, each of the linkers adds additional base pairs: RGD=36 bp+12=48 bp for a single insertion. Bradykinin (BRDY)=69 bp+12=81 bp for a single insertion. Note:The BRDY insert contains a BstNI site. Histidine (8HIS)=51 bp+12=63 bp for a single insertion. Poly Lysine (PLY)=63 bp+12=75 bp for a single insertion.

The outside primer is near the Hind III site and is called AAV2/4 5'. This primer can be used to amplify AAV serotypes 2 and 4.

Primer sequences used to produce epitope linkers into the original insertion mutants are given below. Note: Because there are three frames for the insertion mutants there are three primer pairs for each primer set.

Histidine primer pairs:

TABLE-US-00003 Frame 1: Top primer a 48mer: 5'-GCT AGC GGC GGA CAC CAT CAC CAC (SEQ ID NO:9) CAC CAT CAC CAC GGC GGA AGC GCT-3' Bottom primer a 48mer: 5'-AGC GCT TCC GCC GTG GTG ATG GTG (SEQ ID NO:10) GTG GTG ATG GTG TCC GCC GCT AGC-3' Frame 2:Top primer a 51mer: 5'-AC GCT AGC GGC GGA CAC CAT CAC (SEQ ID NO:11) CAC CAC CAT CAC CAC GGC GGA AGC GCT T-3' Bottom primer a 51mer: 5'-A AGC GCT TCC GCC GTG GTG ATG (SEQ ID NO:12) GTG GTG GTG ATG GTG TCC GCC GCT AGC GT-3' Frame 3: Top primer a 51mer:5'-G GGT TCC GGA GGG CAC CAC CAT (SEQ ID NO:13) CAC CAC CAC CAT CAC GGA GGC GCC AGC GA-3' Bottom primer a 51mer: 5'-TC GCT GGC GCC TCC GTG ATG GTG (SEQ ID NO:14) GTG GTG ATG GTG GTG CCC TCC GGA ACC C-3' Bradykinin primer pairs: Frame 1: Top primer a60mer: 5'-GCC GGA TCC GGC GGC GGC TCC AGA (SEQ ID NO:15) CCC CCC GGC TTC AGC CCC TTC AGA TCC GGC GGC GCC-3' Bottom primer a 60mer: 5'-GGC GCC GCC GGA TCT GAA GGG GCT (SEQ ID NO:16) GAA GCC GGG GGG TCT GGA GCC GCC GCC GGA TCC GGC-3' Frame 2: Top primer a69mer: 5'-GA GGT TCA TGT GAC TGC GGG GGA (SEQ ID NO:17) AGA CCC CCT GGC TTC AGC CCA TTC AGA GGT GGC TGC TTC TGT GGC G-3' Bottom primer a 69mer: 5'-C GCC ACA GAA GCA GCC ACC TCT (SEQ ID NO:18) GAA TGG GCT GAA GCC AGG GGG TCT TCC CCC GCA GTC ACA TGA ACCTC-3' Frame 3: Top primer a 60mer: 5'-A GGT TCA TGT GAC TGC GGG GGA (SEQ ID NO:19) AGA CCC CCT GGC TTC AGC CCA TTC AGA GGT GGC TGC TTC TGT GGC GG-3' Bottom primer a 60mer: 5'-CC GCC AGA GAA GCA GCC ACC TCT (SEQ ID NO:20) GAA TGG GCT GAA GCC AGG GGG TCTTCC CCC GCA GTC ACA TGA ACC T-3' RGD primer pairs: Frame 1: Top primer a 36mer: 5'-GGA TCC TGC GAC TGC AGG GGC GAT (SEQ ID NO:21) TGT TTC TGC GGC-3' Bottom primer a 36mer: 5'-GCC GCA GAA ACA ATC GCC CCT GCA (SEQ ID NO:22) GTC GCA GGA TCC-3' Frame 2: Topprimer a 36mer: 5'-GA TCC TCG GAC TGC AGG GGC GAT (SEQ ID NO:23) TGT TTC TGC GGC G-3' Bottom primer a 36mer: 5'-C GCC GCA GAA ACA ATC GCC CCT (SEQ ID NO:24) GCA GTC GCA GGA TC-3' Frame 3: Top primer a 36mer: 5'-A GGA TCC TGC GAC TGC AGG GGC (SEQ IDNO:25) GAT TGT TTC TGC GG-3' Bottom primer a 36mer: 5'-CC GCA GAA ACA ATC GCC CCT GCA (SEQ ID NO:26) GTC GCA GGA TCC T-3' Polylysine primer pair: Note: only the frame three primer pair was made. Frame 3: Top primer a 63mer: 5'-A GGT TCA TGT GAC TGC GGGGGA (SEQ ID NO:27) AAG AAG AAG AAG AAG AAG AAG GGC GGC TGC TTC TGT GGC GG-3' Bottom primer a 63mer: 5'-CC GCC ACA GAA GCA GCC GCC CTT (SEQ ID NO:28) CTT CTT CTT CTT CTT CTT TCC CCC GCA GTC ACA TGA ACC T-3' Outside primer AAV 2/4 5' top primer: 5'-TGC CGAGCC ATC GAC GTC AGA (SEQ ID NO:29) CGC G-3'

The RGD linker was inserted into the H2285, R2356, H2591, H2634, H2690, H/N3761, and H/N4047 mutants from Table 1.

The bradykinin linker was inserted into the H2285, H2416, H2591, H2634, H2690, H/N2944, and H/N3761 mutants from Table 1.

The poly-Lys linker was inserted into the H2285, H2591, H2690, and H/N3761 mutants from Table 1.

The poly-His linker was inserted into the H2285, H2416, H2591, H2634, H2690, H/N2944, H3561, H3766, and H/N4047 mutants from Table 1.

EXAMPLE 16

Characterization of Insertion Mutants

The insertion mutants at site H2690 all have titers similar to the original 12 bp insert. Using the ELISA assay and the anti-histidine antibody polyHis insertions into this site were shown to be displayed on the surface of the virion.

The polyHis epitope was also shown to be on the surface when inserted into site H2634. Interestingly, the Western blot analysis of the 12 bp insertion at H2634 did not show any VP1 or VP2 subunits being formed. It has been determined that thisinsertion in VP2 is near the nuclear localization signal for the VP1 And VP2 subunits. It is possible that this domain was disrupted by the original insertion, and with the addition of the 8-histidines the domain was repaired. Although the dot blot ofthis 8His virus showed the presence of viral particles, these particles were not infectious.

The insertion site H2591 is in VP1. Insertion of linker epitopes into this site do not affect the titer any more than did the original 12 bp insertion at this site (Table 1).

The insertion at site N4160 is in VP3 near the carboxy terminus. This insertion mutant is of interest because the original 12 bp insertion infects cell at an equivalent level as wild-type (Table 1).

Mutant R3317, which as been previously described in Table 1, appeared not to protect virions by dot blot analysis. Repeating this experiment with a LacZ transgene, the same results were observed, i.e., no protected particles. However, whenusing an independent clone and the GFP transgene (.about.1000 bp smaller than LacZ) protected particles were observed. In addition, the GFP-expression virion transduced HeLa cells at high levels, equivalent to wild-type. It is unclear why disparateresults were observed with different transgenes.

In addition, a linker encoding the respiratory syncitial virus heparin binding domain is inserted into the H2690 mutant at a site that tolerates inserts without loss of viability (Table 1) to restore heparin binding to this mutant.

EXAMPLE 17

Unique Restriction Site Mutants

Unique restriction sites within the capsid of AAV type 2 were made to facilitate the generation of insertional mutants. The sites were chosen so that the mutations introduced into the nucleotide sequence of the capsid were conservative, i.e.,were not missense mutations or result in stop codons. Amino acid positions 586, 529, 595, 552, and 517 (VP1 methionine as amino acid #1) were chosen. For all of these positions, except 529, unique Hpa I sites were engineered. For the site at aminoacid 529, a unique Eco RV site was engineered. Each of these unique restriction sites results in an in-frame blunt ended digestion product. So frame 1 linkers were used to insert into these sites. Overlapping primers were used to generate the uniquesites, and outside primers were used to generate the right and left fragments of the insertion.

The right fragment was then digested with Nsi I and either Eco RV or Hpa I, and the left fragment with Hind III and either Eco RV or Hpa I. We cloned these digestion products into the pACG vector that had already digested with Hind III and Nsi I.The resulting plasmid was then digested with Xcm I and Bsi WI. These enzymes result in an .about.750 bp fragment around the engineered unique restriction site. This strategy will result in the accumulation of fewer errors because the PCR generatedsequences are smaller.

The primers:

TABLE-US-00004 595 top primer 5'-GCA GAT GTT AAC ACA CAA GGC GTT (SEQ ID NO:30) CTT CCA-3': 595 bottom primer 5'-TTG TGT GTT AAC ATC TGC GGT AGC (SEQ ID NO:31) TGC TTG-3': 586 top primer 5'-CAG AGA GTT AAC AGA CAA GCA GCT (SEQ ID NO:32) ACCGC-3': 586 bottom primer 5'-GTC TGT TAA CTC TCT GGA GGT TGG (SEQ ID NO:33) TAG ATA-3': Note: This construct results in a missense mutation Glycine to Valine 552 top primer 5'-ACA AAT GTT AAC ATT GAA AAG GTC (SEQ ID NO:34) ATG ATT-3': 552 bottom primer5'-TTC AAT GTT AAC ATT TGT TTT CTC (SEQ ID NO:35) TGA GCC-3': 529 top primer 5'-GGA CGA TAT CGA AAA GTT TTT TCC (SEQ ID NO:36) TCA G-3': 529 bottom primer 5'-ACT TTT CGA TAT CGT CCT TGT GGC (SEQ ID NO:37) TTG C-3': Note: This construct results in amissense mutation Glutamic acid to Isoleucine 517 top primer 5'-TCT CTG GTT AAC CCG GGC CCG GGC (SEQ ID NO:38) ATG GCA-3': 517 bottom primer 5'-GGC CGG GTT AAC CAG AGA GTC TCT (SEQ ID NO:39) GCC ATT-3': The outside primers were: 5'primer 5'-TGC GCA GCCATC GAC GTC AGA (SEQ ID NO:40) CGC G-3': 3'primer 5'-CAT GAT GCA TCA AAG TTC AAC TGA (SEQ ID NO:41) AAC GAA T-3':

Four clones were also generated with the RGD and 8His linkers (Example 15) inserted into the 529 Eco RV site. Five 8His linkers and one RGD linker insertion mutants were generated into the 586 Hpa I site.

The unique restriction site messense mutations at 3790 3792 (amino acid 529; EcoRV) did infect HeLa cells, although at relatively low efficiency (.about. 1/100 to .about. 1/1000 of wild-type). When the 8His epitome insert was inserted at thissite, the resulting virus had a lip phenotype (i.e., a low infectious particle).

Insertions into the unique missense restriction site at 3690 3961 (amino acid 586; Hpa I) both 8His and RGD were both very infectious, transducing HeLa cells at least as well as wild-type virus.

EXAMPLE 18

Double Mutants

Double mutants were generated using the single mutant H3761 (Table 1) as a template. The H3761 insertion mutant does not bind heparin sulfate as assessed by both batch and column binding experiments. This mutant is interesting because it doesnot infect any of the cell lines so far tested, although electron microscopy analysis suggests that this virus forms normal parvovirus shells, and by dot blot hybridization this virus packages the viral genome efficiently.

The region of the capsid coding the sequence that contains the H3761 insertion was subcloned into other insertion mutants to create double-mutants. The H2690 (AA# 163) insertion mutant was chosen because it has been shown to display a poly-Hisinsertion epitopes on the viral surface (as assessed by using the conformational specific antibody to bind the virus to an ELISA plate and an anti-histidine antibody preconjugated to horse radish peroxidase to detect the virus containing histidines).

the H2690 insertion mutant helper plasmid (pACG H2690 BRDY) containing the bradykinin insertion (Example 15) and the pACG H3761 insertion mutant were both digested with Hind III and Bsi WI. The Hind III site is in the rep gene, while the Bsi WIsite is between 2690 and 3761. The small fragment contains pACG H2690 BRDY while the large fragment contains pACG H3761.

A double mutant H2690 BRDY H3761, with the bradykinin insert inserted at the H2690 site, demonstrated a five-fold increase in infectivity of A9 cells expressing the bradykinin receptor as compared with the parental A9 cells alone. These resultsindicate (1) the defect in binding of the H3761 is likely at the point of binding to cellular HS receptors, but this virus retains infectivity if directed into cells by another route, and (2) the bradykinin double-mutant targeted entry of the virus intobradykinin-receptor expressing cells.

The H3761 insertion mutant has also been cloned into the unique restriction site missense mutations (Example 17), AA# 586 (Hpa I) and AA# 529 (EcoRV). The restriction enzyme NcoI lies between the H3761 and the 529 (Glu.fwdarw.Ile) and 586(Gly.fwdarw.Val) missense mutations, and this enzyme cuts within the rep gene. By digesting the pACG2 helper plasmid contain the H3761 and the 586 and 529 unique sites with Nco I, the small Nco I fragment (3142 bps) containing the H3761 insertionmutation and the large Nco I fragment (5034 bps) containing the 586 and 529 unique sites were isolated. After ligation, the constructs with the correct orientation were established, and these clones were used to make virus.

the unique restriction site missense mutations that containing the RGD motif (Example 15) were also used in this cloning strategy. Thus, there are double mutants containing no inserts at the unique sites and double mutants containing RGDepitopes at those sites.

The H3761 mutant does not transduce HeLa or CHO-K1 cells. In contrast, the 586-RGD double mutants exhibited transduction of both of these cell types. These results strongly suggest that the transduction was mediated by the RGD motif introducedinto the 586 unique restriction site.

The double mutants with the unique restriction sites, but no inserts, and the 529-RGD double mutant did not exhibit efficient transduction of HeLa or CHO-K1 cells.

EXAMPLE 19

MSH-Targeted AAV Vector

In one embodiment of the invention, melanocyte stimulating hormone (MSH) is used for targeting of AAV vectors to cells expressing MSH receptors. Studies have shown that this peptide will direct ligand-associated complexes specifically intomelanocyte NEL-M1 cells (Murphy et al., (1986) Proc. Nat. Acad. Sci USA 83:8258), providing a convenient test system. For example, diphtheria toxin tethered to a 12-residue peptide encoding the MSH ligand was efficient in killing only MSH receptorexpressing cells (Morandini et al., (1994) Internat. J. Ca. 56: 129) Cell death was attributed to receptor mediated endocylosis of the specific ligand delivery.

MSH is inserted into loop 3 of the AAV type 2 capsid. In the first step, an AAV type 2 deletion mutant is made with a 12-amino acid deletion when the Bgl II--SpH I fragment is removed from the sequence encoding loop 3. The sequence encoding theMSH peptide is then inserted into the deleted region.

The primer sequences to make the loop3 and loop4 insertion mutations are as follows: Loop 3 5' top primer (SEQ ID NO:42):

5-'GATACCTTAAGATCTAGTGGAACCACCACGCACTCAAGGCTT-3'

The cttaag is an Afl II site, the agatct is a Bgl II site. These two sites overlap by two base pairs. The homology with the AAV sequence starts at position 3556 and ends at 3583. Loop 3 3' bottom primer (SEQ ID NO:43):

5'CTAGCTTAAGCATGCATACAGGTACTGGTCGATGAGAGGATT-3'

The gcatgc is a SphI site, and the cttaag is an Afl II site. These two sites overlap by one base pair. The homology with the AAV sequence starts at position 3505 and ends at 3531 (note that this is the bottom strand).

These primers remove 24 bp (i.e., 8 amino acids) of AAV type 2 sequences from 3532 to 3555. The deleted amino acid sequence is Tyr Leu Ser Arg Thr Asn Thr Pro from at amino acid 444 to 451 (VP1-Met being amino acid #1).

The 5'Sph I Afl II Bgl II 3' sites in the sequence: 5'-GCATGCTTAAGATCT-3' result in the addition of 5 amino acids Ala Cys Leu Arg Ser.

Virus is produced by standard packaging methods. The MSH-tagged AAV type 2 vector is evaluated for transduction in HeLa cells and cells with MSH receptors (e.g., melanocytes).

EXAMPLE 20

Chimeric AAV2/4 Virus--Capsid Protein Substitutions

The virions of the AAV serotypes are made up of three protein subunits VP1 VP2 and VP3. VP3 is the most abundant subunit, it represents between 80 90% of the 60 subunits that make up the virion, with VP1 and VP2 making up 5 10% each of thevirion. The subunits are translated from an overlapping transcript, so that VP3 sequences are within both VP2 and VP1, and VP2 sequences are within VP1.

We have designed primers that enabled us to substitute entire subunits and unique domains of subunits between AAV2 and AAV4. AAV4 has properties that are significantly different from AAV2. Thus, defining the domains that account for thesedistinct properties would be of value, e.g., for designing gene therapy vectors.

We have chosen a seamless cloning strategy to clone the subunits or unique domains of subunits between these two serotypes.

TABLE-US-00005 AAV2 and AAV4 top primer 5'-TGC CGA GCC ATC GAC GTC AGA CGC (SEQ ID NO:44) G-3': AAV2 and AAV4 bottom primer 5'-CAT GAT GCA TCA AAG TTC AAC TGA (SEQ ID NO:45) AAC GAA T-3': AAV2 VP3 top primer 5'-CGA GCT CTT CGA TGG CTA GAG GCA(SEQ ID NO:46) GTG GCG GAC-3': AAV2 VP3 bottom primer 5'-AGC GCT CTT CCC ATC GTA TTA GTT (SEQ ID NO:47) CCC AGA CCA GAG-3': AAV2 VP2 top primer 5'-CGA GCT CTT CGA CGG CTC CGG GAA (SEQ ID NO:48) AAA AGA GGC-3': AAV2 VP2 bottom primer 5'-AGC GCT CTT CCCGTC TTA ACA GGT (SEQ ID NO:49) TCC TCA ACC AGG-3': AAV4 VP3 top primer 5'-CGA GCT CTT CGA TGC GTG CAG CAG (SEQ ID NO:50) CTG GAG GAG CTG-3': AAV4 VP3 bottom primer 5'-AGC GCT CTT CGC ATC TCA CTG TCA (SEQ ID NO:51) TCA GAC GAG TCG-3': AAV4 VP2 top primer5'-CGA GCT CTT CGA CGG CTC CTG GAA (SEQ ID NO:52) AGA AGA GAC-3': AAV4 VP2 bottom primer 5'-AGC GCT CTT CCC GTC TCA CCC GCT (SEQ ID NO:53) TGC TCA ACC AGA- 3':

These primers will result in the subunit swaps that are shown in FIG. 7. A representative coding sequence of a chimeric AAV2 capsid in which the AAV4 Vp2 was substituted is shown in SEQ ID NO:2. This sequence contains the AAV2 rep codingsequences, most of the AAV2 Vp1 and Vp3 coding sequences, and the entire AAV4 Vp2 coding sequences and some of the AAV4 Vp1 and Vp3 coding sequences in a pBluescript backbone.

The Rep68/78 coding sequence begins at nu 251 of SEQ ID NO:2, and the Rep52/40 coding sequence begins at nu 923. The Rep78/52 stop signal ends at nu 2114, and the stop for Rep68/40 is at nu 2180. The capsid coding sequence starts at nu 2133 andthe end at nu 4315 (Vp1 start at nu 2133, Vp2 start at nu 2544, Vp3 start at 2724).

The AAV2 sequences from the second XhoI site at bp 2420 in Vp1 to

the Bsi WI site at bp 3255 in Vp3 in the AAV2 cap genes was replaced with the corresponding region from AAV4 (corresponding to nu 2350 3149 in the plasmid sequence). Briefly, the AAV2 helper plasmid pACG2 was partially digested with XhoI and BsiWI releasing the 835 bp fragment. The same digest in AAV4 resulted in a 799 bp fragment that was ligated into the deleted AAV2 sequence to produce the helper virus encoding the chimeric AAV2/4 capsid.

Virions are produced carrying a recombinant AAV genome, preferably a recombinant AAV2 genome, typically expressing a reporter gene (e.g., GFP). These mutant viral vectors are characterized for virion formation, morphology, genome protection,heparin binding, and infectivity as described in Example 15.

EXAMPLE 21

Construction of B19/AAV-2 Chimeric Vectors

Studies by Dong et al., (1996) Human Gene Therapy 7:2101, have determined the packaging limitations using rAAV vectors. Using recombinant AAV DNA templates with increasing insertions of stuffer DNA, Dong et al. determined that the packagingcapacity of rAAV vectors declined dramatically between 104% and 108% of wt (4883 vs. 5083 nucleotides, respectively). This packaging restriction precludes the use of important genes, including mini muscular dystrophy genes as well as promoter regulatedcystic fibrosis sequences.

Accordingly, the present investigations set out to develop a B19/AAV-2 derived gene therapy vector that maintains the packaging capacity of B19, the tropism of AAV-2, as well as function as a substrate for targeting vectors. The human parvovirusB19 (packaging capacity of 5.6 kb) was chosen to utilize the major structural protein Vp2 in the generation of a chimeric AAV vector for packaging larger vector genomes. B19 is composed of only two overlapping structural proteins (Vp1 & 2). B19 infectsprimary erythroid progenitor cells using globoside as its receptor (Brown et al., (1993) Science 262:114). The structure of B19 has been determined to 8.DELTA. resolution (Agbandje-McKenna et al., (1994) Virology 203:106).

A chimeric AAV particle was constructed by swapping the AAV major structural protein Vp3 for B19's Vp2. Seamless cloning (Stratagene USA) was utilized to generate an AAV helper construct that would express all of the AAV proteins (Rep 78, 68,52, 40 and Vp 1 and Vp2) with B19 substituted for the Vp3 major Cap protein (FIG. 8; nucleotide sequence in SEQ ID NO:3; amino acid sequence in SEQ ID NO:4).

The starting material for the chimeric vector was pAAV-Ad and pYT103c. pYT103c contains the entire B19 coding domain without terminal repeats. HindIII digestion of pAAV-Ad released a 2727 bp fragment which contained the entire AAV2 capsidcoding region and some flanking regions. This fragment was subcloned into Hind III digested pBS+(Stratagene), resulting in pBS+AAVCap. Polymerase chain reaction was used to amplify the Vp2 coding region from pYT103c. The primers were5'-AGTTACTCTTCCATGACTTCAGTTAATTCTGCAGAA 3'(SEQ ID NO:54) in the 5' direction and 5'-AGTTACTCTTCTTTACMTGGGTGCACACGGCTTTT 3' (SEQ ID NO:55) in the 3' direction. Primers to pBS+AAVCap were used to amplify around Vp3 of AAV2. The primers were5'AGTTACTCTTCTTMTCGTGGACTTACCGTGGATAC 3' (SEQ ID NO:56) in the 5' direction and 5'-AGTTACTCTTCCCATCGTATTAGTTCCCAGACCAGA 3 (SEQ ID NO:57), in the 3' direction. Six nucleotides from the 5' end of each primer is an Eam 1104 I site, this site digestsdownstream from its recognition site in this case the overlap is an ATG and its compliment and a TAA and its compliment. This site is utilized during the seamless cloning strategy (Stratagene). Digestion of B19-Vp2 and AAV2 PCR products with Eam 1104-Iand cloning resulted in a subclone of pBS+AAVCap with Vp2 of B19 substituted for AAV2 Vp3. This vector was digested with Hind III and cloned back into pAAV-Ad and orientation determined resulting in pAAV/B19-Ad (SEQ ID NO:3). This sequence encodes theAAV2 Vp1 region (start at nt 1), followed by the AAV2 Vp2 region (start at nt 412), and then the B19 Vp2 region (start at nt 607).

EXAMPLE 22

Production of Chimeric Virus

The pAAV/B19 helper construct was used in a transient packaging system as described in Example 1. Briefly, the helper plasmids pAAV/B19-Ad and pAB11 (which contains AAV2 terminal repeats and the .beta.-galactosidase gene under the control of theCMV early promoter) were co-transfected into 293 cells by calcium phosphate. Twelve hours after transfection the medium was changed and adenovirus dl309 (MOI-5) was added. Forty-eight hours later the cells were centrifuged and the supernatant wasdiscarded. A fraction of the cell pellet was used in a HIRT assay. The cell pellet was lysed in cesium chloride (1.39 g/ml), sonicated and centrifuged at 41,000 rpm for 72 hours. Fractions from the cesium gradient were recovered and samples from eachwere used in dot blot hybridization to test particle number of virus. The dot blots were probed with .beta.-galactosidase gene, and particle numbers were determined by control amounts of the .beta.-galactosidase gene. Peak fractions containing viruswere dialysed against PBS, 20% glycerol.

EXAMPLE 23

Infection of Cells with Chimeric Virus

Forty-eight hours post-transfection, cell lysates were generated and tested for transduction into various target cells. A transducing titer of 2.times.10.sup.6 was generated. Various volumes of virus were added to 293, RT-2 rat glioma, U-87glioma, as well as to two primary human glioblastoma cell lines in small volumes of medium. Virus was also added to UT7 megakaryoctye cells that had been incubated in the presence of erythropoeitin (EPO) for several weeks. Exposure of UT7 cells to EPOis known to render these cells permissive for B19 infection.

Adenovirus was also added to the cells at an MOI of 5. Two hours after infection the virus was washed off and fresh medium was added. Twenty-four hours post infection the cells were washed with PBS, fixed in formaldehyde/gluteraldehyde, andstained with X-gal. Twelve to twenty-four hours later the number of blue cells was determined by counting ten fields.

Transduction was obtained in the glioma and primary human glioblastoma cells. Efficient transduction was not observed in 293 cells (a cell type typically infected with AAV). Interestingly, transduction was seen with the UT7 cells. Theseresults suggest that the chimera has lost the native AAV tropism and has acquired the B19 tropism for erythroid cells. This virus is characterized to determine whether it has retained the antigenic properties associated with the AAV2 serotype.

The B19 globoside binding region (loop 4 between amino acids 399 406 of the Vp2 subunit; Brown et al. (1993) Science 262:114 virus of this is chimeric virus is deleted, modified or swapped out to reduce or completely eliminate the B19 tropism forerythroid cells.

EXAMPLE 24

Characterization of B19/AAV Chimera

The results from Example 23 indicate that a transducing chimeric virus was successfully generated. The chimeric virus was further evaluated for total particle yield and integrity. The remainder of the vector preparation was gradient purified,and the chimeric virus was analyzed by dot blot analysis to determine a particle titer of 1.times.10.sup.8 and EM analysis (see Example 6) to determine if a correct icosahedral structure was formed (FIG. 9). From this analysis, it was confirmed that thechimeric virion that was generated retained the typical parvovirus structure and was stable to physical purification step such as sonication and CsCl.sub.2 gradient centrifugation. This is an important observation since most parvovirus are heat stable(resistant up to 65 degrees), resistant to detergents (0.5% SDS) and can tolerate extreme pH changes (viable between pH 2.0 11).

In addition, EM analysis yielded unexpected results (FIG. 9). Virion particles of two different sizes were observed (a 23 28 nm particle, typical for wt AAV, and a 33 38 nm particle, never before identified). Further analysis suggested that theAAV 33 38 nm particle was formed by changing the triangulation number from T=1 to T=3, resulting in larger particles containing 180 copies of the major capsid component instead of 60. These surprising results indicate that a virion structure larger thanwt AAV has been generated. This virion may have the potential for carrying larger than wt vector templates. The larger 33 38 nm particle will be useful in increasing packaging limits above the 6 kb range (the B19 25 nm particle packages 6 kb of DNA).

EXAMPLE 25

Packaging Capacity of B19/AAV-2 Chimera

To quantitate the packaging capacity of the chimeric virus from Example 21, a series of vectors developed by Dong and coworkers, (1996) Human Gene Therapy 7:2101, is utilized with genomes of progressively increased sizes having inserts between745 and 1811 bases (for a maximum total genome size of 6.4 kb). Small-scale production of chimeric recombinant virus is used to assay packaging efficiency by testing the DNA content of the virus using Hirt assay, and by chloramphenicol acetyltransferase(CAT) reporter assay.

EXAMPLE 26

Construction of Other B19/AAV Chimeras

Other chimeric B19/AAV capsids are generated as in Example 21 (e.g., swapping AAV Vp1 or Vp2 with B19 Vp1) and are characterized as described in Examples 22 25 above. In particular, both B19 Vp1 and Vp2 are substituted into an AAV Vp1 chimera togenerate a novel chimeric capsid containing AAV Vp1 and B19 Vp1 and Vp2.

These chimeras are assayed in 293 (typically infected by AAV) and erythroid cells (the cell type typically infected by B19) for transduction efficiency and are assayed for packaging recombinant AAV vectors with increasing sized inserts asdescribed above.

If desired, the B19 globoside binding region (loop 4 of Vp2 between amino acids 399 406; Brown et al. (1993) Science 262:114) of these vectors can be deleted, modified or swapped out to remove the B19 tropism.

EXAMPLE 27

Loop Swaps Between AAV Serotypes

The capsid gene of AAV2, in the helper vector pACG2, was digested with the enzymes Asp718 and Bsi WI. Bsi WI has a unique site in the AAV2 genome at position 3254 bp, and Asp718 digests the genome twice at 1906 and 4158 bps (AAV2 sequencenumbers). The capsid coding domain of AAV2 was partially digested with Asp718 and the full length (single cut) fragment was isolated. This fragment was then digested with Bsi WI and the 7272 bp fragment isolated. This fragment removed the 904 bpfragment the contains the coding region of the VP3 loop 2, 3, and 4 domains.

The capsid gene of AAV4 was digested with Asp718 and Bsi WI to completion and a 928 bp fragment from 3284 bp (BsiWI) to 4212 bps (Asp718) was isolated (AAV4 sequence numbers). This AAV4 fragment codes for a region in VP3 that contains loops 2, 3and 4. The 928 bp AAV4 fragment and the 7272 bp fragment from pACG2 were ligated and clones were identified.

These clones were used to make a chimeric virus that contained mostly AAV2 and part of the VP3 domain of AAV4. This virus did not infect HeLa cells as determined by blue stained cells (viral infected cells expressing the LacZ marker gene). However, like AAV4 these cells infected COS7 cells at a low titer of 1.times.10.sup.5 transducing units/mL. These virions are not recognized by the AAV2 monoclonal antibody B1

Chimeric virus was also made in which Vp3 Loops 2 4 from AAV2 were substituted into the homologous region of the AAV4 capsid.

The AAV3 capsid coding region containing the VP3 loops 2 4 domains were cloned into pACG2 in the same manner as described above for AAV2/4 loop swaps. These chimeric AAV2/3 virions bind heparin agarose and infect HeLa and 293 cells. Furthermore, these virions are recognized by the B1 monoclonal antibody.

Likewise, using the techniques taught above, Vp3 loops 2 4 from AAV5 are substituted for loops 2 4 of AAV2.

Furthermore, single loops (e.g., loop 2, 3 or 4, or loops 2 3 or 3 4) are substituted from AAV3, 4 or 5 into AAV2 or vice versa.

These mutant viral vectors are characterized for virion formation, morphology, genome protection, heparin binding, and infectivity as described in Example 4 7.

A representative helper plasmid encoding a chimeric AAV2/3 capsid is given in SEQ ID:5. This sequence contains the AAV2 rep coding sequences, most of the AAV2 capsid coding sequences, with the exception that loops 2 4 from the AAV2 Vp3 subunitwere replaced with the corresponding region from AAV3, in a pBluescript backbone. The Rep 68/78 coding sequence starts at nu 251, and the Rep52/40 coding sequence starts at nu 923. The rep coding sequences end at nu 2114 for Rep78/52 and at nu 2180 forRep68/40. The cap coding region starts at nu 2133 and ends at nu 4342 (Vp1 start at nu 2133, Vp2 start at nu 2544, Vp3 start at nu 2739).

Briefly, both AAV2 (pACG2) and AAV3 helper plasmids were digested with Bsi WI and Asp 718. This removes a 904 bp fragment in the AAV2 genome from nu 3255 to 4159. In the AAV3 genome, the same digestion removed 907 bp from nu 3261 4168. This904 bp fragment was ligated into the deleted AAV2 helper to result in the helper given in SEQ ID NO:5 (AAV3 sequences at nu 3184 4092 of the plasmid).

EXAMPLE 28

Hybrid Viruses

Primers were made to create a unique Hind III site in the AAV4 rep gene that overlapped the Hind III site in AAV2. In addition, at the 3' end of the rep coding sequence, a unique Not I site was created 3' of the polyadenylation site. A viruspurchased from American Type Culture Collection (ATCC) as the template for the PCR.

The 5' portion of the AAV2 rep gene from the Xba I site to the Hind III site was subcloned into pBluescript. The Hind III-Not I PCR digestion product was then cloned into the pBluescript containing the 5' rep gene digested with Not I and HindIII.

TABLE-US-00006 Primers: AAV4 3'Not I primer 5'-AAG CGC CGC GGC CGC TGC TTA TGT (SEQ ID NO:58): ACG CA-3' AAV4 5'Hind III primer 5'-GAC GCG GAA GCT TCG GTG GAC TAC (SEQ ID NO:59): GCG-3'

This cloning strategy resulted in a helper plasmid that is a hybrid for AAV2 and AAV4 rep genes and contains the AAV4 cap genes. This helper contains the AAV2 rep gene up to the Hind III site and from this past the polyadenylation site thesequences are derived from AAV4.

This virus packaged a recombinant AAV2 genome with AAV2 ITRs. This hybrid AAV2/4 virus exhibits the binding characteristics of AAV4, e.g., it does not bind HS and transduces AAV4 target cells that are not typically permissive to AAV2transduction.

The hybrid AAV 2/4 helper plasmid is as given in SEQ ID NO:1. This sequence encodes the AAV2 rep genes and AAV4 capsid in a pBluescript backbone. The Rep 68/78 coding sequence starts at nu 251, and the Rep52/40 coding sequence starts at nu 923. The rep coding sequences end at nu 2120 for Rep78/52 and at nu 2183 for Rep68/40. The cap coding region starts at nu 2123 and ends at nu 4341 (Vp1 start at nu 2123, Vp2 start at nu 2547, Vp3 start at nu 2727).

Using the same techniques, a hybrid AAV2/3 virus in which a recombinant AAV2 genome (with AAV2 ITRs) is packaged. The resulting hybrid virus is viable and efficiently transduces AAV3 permissive cells.

In addition, in contrast to a recent report (Chiorini et al., 1999) J. Virology 73:1309), the techniques described above have been used to produce a hybrid AAV2/5 virus in which a recombinant AAV2 genome (with AAV2 ITRs) is packaged within a AAVType 5 capsid. This virus is packaged relatively inefficiently, but the resulting particles demonstrated transduction of cells.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications may be practiced within the scope of theappended claims and equivalents thereof.

>

59 DNA Adeno-associated virus misc_feature (2/4 helper plasmid gcgcc ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga 6acact tgccagcgccctagcgcccg ctcctttcgc tttcttccct tcctttctcg cgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat gtgcttt acggcacctc gaccccaaaa aacttgatta gggtgatggt tcacgtagtg 24tcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata3actctt gttccaaact ggaacaacac tcaaccctat ctcggtctat tcttttgatt 36gggat tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat 42gcgaa ttttaacaaa atattaacgc ttacaatttc cattcgccat tcaggctgcg 48gttgg gaagggcgat cggtgcgggcctcttcgcta ttacgccagc tggcgaaagg 54gtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 6acgacg gccagtgagc gcgcgtaata cgactcacta tagggcgaat tggagctcca 66gtggc ggccgctgct tatgtacgca gtagccatgg aaacgagata agataagaag 72ggaga ccaaagttca actgaaacga ataaaccggt ttattgatta acaggttatt 78tggtg ggtgaggtag cgggtaccga tagccctagg ctcagtgtat ttcccagccg 84ggagc ccacaacaga gagttttgct gtccgtagtt ggaggtaaac tggacctcgg 9ccagcg tttggaccgc tccttctgga tctcccagtcaatctgcacc gacacctggc 96ctgta ctgagtaatg aaggagttta ccggagtaga gctgaaggtc gttgcaggat gcaggtac cggggtgttc ttgataaaaa tttgaggagg cgggtgtttc agcccaaacc ccaatcag cggtgagggg tgaaagtgtc catcggtatg aggaatcttg gcccaaatgg ccctggtagtaaatgtct ctgttttgcc agaccattcc aggcacggct cccaaggctg agtctgtc cacggtcggc aggttgctgt tgctctggtc accgccaggt aggttgcccc atgtccgt atcggtggcg ttggtggctg ccagctcctc ctcagaggtg aagatcagag ccgggtac ggtggccgtg ttgccgttct gtttaggccccgcaaagatg agctggctgt ctgaactt gctgtccgca ggtccagccg tggccattgg aggtccgggg gtcagggcac catcttcc gtccagagtg ctgtgcgtct cgtatttgat gagactgtct gacccggtgg gggatctt gtagttttga ttggcagtct ttgagaagcc ctgctgcttg attgaaggcc ggcagccagttcttttta aagttggaaa agttggtagg ccgcagcttg gtaaagttgg gtggcagt cccggcattc agggtggttc cggtggtggt cgattgcagt ccccacaggt tggtcgat gagagggttc atcagccggt ccaggctctg gctgtgcgcg tacatcgagt aaaggcac cttctcaaaa ctgtacgtaa tttcaaagttgttgccagtc cgcagcatct gaaggaaa gtactccagg cagtagaagg catttctgtc agtctgttgc tgcgaagtgt ccggtcac cagtccacag tagccgtact ggggcaccat aaagacgtcg ttgggaaaag ggcaggct gccctcttga cccgcatcca tcacgtacgg cagttcgtac gacgagtccg aagatctgaaccgtgctg gtaaggttat tagccaccgt tgtctcgccg ttcgacgtcg 2cctcctt gacctggatg ttgaagattt tgacccgcat ggctttgggt cgcatgcccc 2tgttgtt gatgagtcgc tgccagtcac gtggtgagaa gtggcagtgg aagcggttga 2caaagta tccccagggg gtggagaatc cgttgtaggtgttggactgc aggctctctc 222cgctt gtagaggtgg ttgttgtagg tgggcaagac ccaggttctg gtgctggtgg 228acgtg gccctcagac caggtggaat cgcaatgcca atcacccgag gcattaccca 234tcggc accttgtccg ccctcgactg cagctccgcc agctgctgca cgcatctcac 24atcagacatggctccg gaagttgatc cctcaggggg tccgtcgcct gctccagttt 246tcgaa aacgagcttc tttttagccg gctgcttgcc ttttttgccg atacccgtgg 252tcggg ctgctggggg gattcaatca acggtctctt ctttccagga gccgtctcac 258tgctc aaccagacca agaggttcaa gaaccctctttttggcctgg aagactgctc 264aggtt gcccccaaac gatgtgtcgc cctgaagccg ctgctggaac tccgcgtcgg 27gttgta cttgaggtag gggttgtcac cggccttgag ctgctggtcg taggccttgt 276tcgag ggctgccgcg tccgctgcgt tgacgggttc ccccttgtcg agtccgttgc 282ccgaggtatttgtaa cccggaagca caagaccccg agcgttgtcc tgatgttgtt 288gcctt gggtttaggg gctccaggtt gcagcgccca ccactctcga acgccttcag 294ttgtc ctctagccaa tctggaaggt aaccgtcagt catatctggt ttgagtcatt 3tgttcca tgtcacagtc atccaagtcc acattggccagttcgcaggc cgagcaggcc 3tcgggcg ccctccccat gatgtgatga atcggacaca gtttctgata cgtccgcttt 3acgacag acacgggttg agattctgac acggggaagc actcggcaca gtccatgacc 3tgcgtga agcaaatgtc cacattctga ttcattctct cgcattgccg gcagggaaaa 324cagattcatacccac gtgacgagaa catttgtttt ggtacctgtc cgcgtagtcc 33aagctt ccgcgtctga cgtcgatggc tgcgcaactg actcgcgcac ccgtttgggc 336tatat ctgcgtcact gggggcgggt cttttcttgg ctccaccctt tttgacgtag 342atgct ccacctcaac cacgtgatcc tttgcccaccggaaaaagtc tttgacttcc 348ggtga ccttcccaaa gtcatgatcc agacggcggg tgagttcaaa tttgaacatc 354ttgca acggctgctg gtgttcgaag gtcgttgagt tcccgtcaat cacggcgcac 36tggtgt tggaggtgac gatcacggga gtcgggtcta tctgggccga ggacttgcat 366gtccacgcgcacctt gcttcctccg agaatggctt tggccgactc cacgaccttg 372catct tcccctcctc ccaccagatc accatcttgt cgacacagtc gttgaaggga 378ctcat tggtccagtt tacgcacccg tagaagggca cagtgtgggc tatggcctcc 384gttgg tcttcccggt agttgcaggc ccaaacagccagatggtgtt cctcttgccg 39ttttcg tggcccatcc cagaaagacg gaagccgcat attggggatc gtacccgttt 396caaaa ttttataaat ccgattgctg gaaatgtcct ccacgggctg ctggcccacc 4tagtcgg gggcggtttt agtcaggctc ataatctttc ccgcattgtc caaggcagcc 4atttgggaccgcgagtt ggaggccgca ttgaaggaga tgtatgaggc ctggtcctcc 4atccact gcttctccga ggtaatcccc ttgtccacga gccacccgac cagctccatg 42tggctg aagtttttga tctgatcacc ggcgcatcag aattgggatt ctgattctct 426ctgct cctgcgtctg cgacacgtgc gtcagatgctgcgccaccaa ccgtttacgc 432gagat tcaaacaggc gcttaaatac tgttccatat tagtccacgc ccactggagc 438ctggg ttttggggag caagtaattg gggatgtagc actcatccac caccttgttc 444tccgg cgccatttct ggtctttgtg accgcgaacc agtttggcaa agtcggctcg 45cgcggtaaattctctg aatcagtttt tcgcgaatct gactcaggaa acgtcccaaa 456ggatt tcaccccggt ggtttccacg agcacgtgca tgtggaagta gctctctccc 462aaatt gcacaaagaa aagggcctcc ggggccttac tcacacggcg ccattccgtc 468gtcgc gctgcagctt ctcggccacg gtcaggggtgcctgctcaat cagattcaga 474gtcag aatctggcgg caactcccat tccttctcgg ccacccagtt cacaaagctg 48aaatgc cgggcagatg cccgtcaagg tcgctgggga ccttaatcac aatctcgtaa 486cggca tggcggctgc gcgttcaaac ctcccgcttc aaaatggaga ccctgcgtgc 492cgggcttaaataccc agcgtgacca catggtgtcg caaaatgtcg caaaacactc 498acctc taatacagga ctctagcggt acccagcttt tgttcccttt agtgagggtt 5tgcgcgc ttggcgtaat catggtcata gctgtttcct gtgtgaaatt gttatccgct 5aattcca cacaacatac gagccggaag cataaagtgtaaagcctggg gtgcctaatg 5gagctaa ctcacattaa ttgcgttgcg ctcactgccc gctttccagt cgggaaacct 522gccag ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg 528cttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc 534cagctcactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg 54aacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct 546ttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca 552ggcga aacccgacag gactataaag ataccaggcgtttccccctg gaagctccct 558gctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc 564gcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt 57tccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc 576actatcgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc 582gtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg 588ctaac tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc 594ccttc ggaaaaagag ttggtagctc ttgatccggcaaacaaacca ccgctggtag 6tggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga 6tttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat 6ggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag 6taaatcaatctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat 624aggca cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc 63gtgtag ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat 636gagac ccacgctcac cggctccaga tttatcagcaataaaccagc cagccggaag 642agcgc agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg 648aagct agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc 654gcatc gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca 66tcaaggcgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg 666cgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc 672ataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta 678ccaag tcattctgag aatagtgtat gcggcgaccgagttgctctt gcccggcgtc 684gggat aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg 69tcgggg cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc 696gtgca cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc 7aacaggaaggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat 7catactc ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag 7atacata tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc 72aaagtg ccac 725deno-associatedvirus misc_feature (5/4 helper plasmid 2 aattcccatc atcaataata taccttattt tggattgaag ccaatatgat aatgaggggg 6tttgt gacgtggcgc ggggcgtggg aacggggcgg gtgacgtagt agtctctaga ctgtatt agaggtcacg tgagtgtttt gcgacatttt gcgacaccatgtggtcacgc gtattta agcccgagtg agcacgcagg gtctccattt tgaagcggga ggtttgaacg 24ccgcc atgccggggt tttacgagat tgtgattaag gtccccagcg accttgacgg 3ctgccc ggcatttctg acagctttgt gaactgggtg gccgagaagg aatgggagtt 36cagat tctgacatggatctgaatct gattgagcag gcacccctga ccgtggccga 42tgcag cgcgactttc tgacggaatg gcgccgtgtg agtaaggccc cggaggccct 48ttgtg caatttgaga agggagagag ctacttccac atgcacgtgc tcgtggaaac 54gggtg aaatccatgg ttttgggacg tttcctgagt cagattcgcg aaaaactgat6agaatt taccgcggga tcgagccgac tttgccaaac tggttcgcgg tcacaaagac 66atggc gccggaggcg ggaacaaggt ggtggatgag tgctacatcc ccaattactt 72ccaaa acccagcctg agctccagtg ggcgtggact aatatggaac agtatttaag 78gtttg aatctcacgg agcgtaaacggttggtggcg cagcatctga cgcacgtgtc 84cgcag gagcagaaca aagagaatca gaatcccaat tctgatgcgc cggtgatcag 9aaaact tcagccaggt acatggagct ggtcgggtgg ctcgtggaca aggggattac 96agaag cagtggatcc aggaggacca ggcctcatac atctccttca atgcggcctc actcgcgg tcccaaatca aggctgcctt ggacaatgcg ggaaagatta tgagcctgac aaaccgcc cccgactacc tggtgggcca gcagcccgtg gaggacattt ccagcaatcg tttataaa attttggaac taaacgggta cgatccccaa tatgcggctt ccgtctttct gatgggcc acgaaaaagt tcggcaagaggaacaccatc tggctgtttg ggcctgcaac ccgggaag accaacatcg cggaggccat agcccacact gtgcccttct acgggtgcgt actggacc aatgagaact ttcccttcaa cgactgtgtc gacaagatgg tgatctggtg aggagggg aagatgaccg ccaaggtcgt ggagtcggcc aaagccattc tcggaggaag aggtgcgc gtggaccaga aatgcaagtc ctcggcccag atagacccga ctcccgtgat tcacctcc aacaccaaca tgtgcgccgt gattgacggg aactcaacga ccttcgaaca agcagccg ttgcaagacc ggatgttcaa atttgaactc acccgccgtc tggatcatga ttgggaag gtcaccaagc aggaagtcaaagactttttc cggtgggcaa aggatcacgt ttgaggtg gagcatgaat tctacgtcaa aaagggtgga gccaagaaaa gacccgcccc gtgacgca gatataagtg agcccaaacg ggtgcgcgag tcagttgcgc agccatcgac cagacgcg gaagcttcga tcaactacgc agacaggtac caaaacaaat gttctcgtca tgggcatg aatctgatgc tgtttccctg cagacaatgc gagagaatga atcagaattc atatctgc ttcactcacg gacagaaaga ctgtttagag tgctttcccg tgtcagaatc aacccgtt tctgtcgtca aaaaggcgta tcagaaactg tgctacattc atcatatcat 2aaaggtg ccagacgctt gcactgcctgcgatctggtc aatgtggatt tggatgactg 2ctttgaa caataaatga tttaaatcag gtatggctgc cgatggttat cttccagatt 2tcgagga cactctctct gaaggaataa gacagtggtg gaagctcaaa cctggcccac 222ccaaa gcccgcagag cggcataagg acgacagcag gggtcttgtg cttcctgggt 228tacct cggacccttc aacggactcg acaagggaga gccggtcaac gaggcagacg 234gccct cgagcacgac aaggcctacg accagcagct caaggccggt gacaacccct 24caagta caaccacgcc gacgcggagt tccagcagcg gcttcagggc gacacatcgt 246ggcaa cctcggcaga gcagtcttccaggccaaaaa gagggttctt gaacctcttg 252gttga gcaagcgggt gagacggctc ctggaaagaa gagaccgttg attgaatccc 258cagcc cgactcctcc acgggtatcg gcaaaaaagg caagcagccg gctaaaaaga 264gtttt cgaagacgaa actggagcag gcgacggacc ccctgaggga tcaacttccg 27catgtc tgatgacagt gagatgcgtg cagcagctgg cggagctgca gtcgagggcg 276ggtgc cgatggagtg ggtaatgcct cgggtgattg gcattgcgat tccacctggt 282ggcca cgtcacgacc accagcacca gaacctgggt cttgcccacc tacaacaacc 288tacaa gcgactcgga gagagcctgcagtccaacac ctacaacgga ttctccaccc 294ggata ctttgacttc aaccgcttcc actgccactt ctcaccacgt gactggcagc 3tcatcaa caacaactgg ggcatgcgac ccaaagccat gcgggtcaaa atcttcaaca 3aggtcaa ggaggtcacg acgtcgaacg gcgagacaac ggtggctaat aaccttacca 3cggttca gatctttgcg gactcgtcgt acgaactgcc gtacgtcctc ggctcggcgc 3aaggatg cctcccgccg ttcccagcag acgtcttcat ggtgccacag tatggatacc 324ctgaa caacgggagt caggcagtag gacgctcttc attttactgc ctggagtact 33ttctca gatgctgcgt accggaaacaactttacctt cagctacact tttgaggacg 336ttcca cagcagctac gctcacagcc agagtctgga ccgtctcatg aatcctctca 342cagta cctgtattac ttgagcagaa caaacactcc aagtggaacc accacgcagt 348cttca gttttctcag gccggagcga gtgacattcg ggaccagtct aggaactggc 354ggacc ctgttaccgc cagcagcgag tatcaaagac atctgcggat aacaacaaca 36atactc gtggactgga gctaccaagt accacctcaa tggcagagac tctctggtga 366ggccc ggccatggca agccacaagg acgatgaaga aaagtttttt cctcagagcg 372ctcat ctttgggaag caaggctcagagaaaacaaa tgtgaacatt gaaaaggtca 378acaga cgaagaggaa atcggaacaa ccaatcccgt ggctacggag cagtatggtt 384tctac caacctccag agaggcaaca gacaagcagc taccgcagat gtcaacacac 39cgttct tccaggcatg gtctggcagg acagagatgt gtaccttcag gggcccatct 396aagat tccacacacg gacggacatt ttcacccctc tcccctcatg ggtggattcg 4ttaaaca ccctcctcca cagattctca tcaagaacac cccggtacct gcgaatcctt 4ccacctt cagtgcggca aagtttgctt ccttcatcac acagtactcc acgggacagg 4gcgtgga gatcgagtgg gagctgcagaaggaaaacag caaacgctgg aatcccgaaa 42gtacac ttccaactac aacaagtctg ttaatcgtgg acttaccgtg gatactaatg 426tattc agagcctcgc cccattggca ccagatacct gactcgtaat ctgtaattgc 432aatca ataaaccgtt taattcgttt cagttgaact ttggtctctg cgtatttctt 438tctag tttccatgct ctagactact acgtcacccg ccccgttccc acgccccgcg 444tcaca aactccaccc cctcattatc atattggctt caatccaaaa taaggtatat 45gatgat gcatcgctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac 456cgcag cctgaatggc gaatggaattccagacgatt gagcgtcaaa atgtaggtat 462tgagc gtttttcctg ttgcaatggc tggcggtaat attgttctgg atattaccag 468ccgat agtttgagtt cttctactca ggcaagtgat gttattacta atcaaagaag 474cgaca acggttaatt tgcgtgatgg acagactctt ttactcggtg gcctcactga 48aaaaac acttctcagg attctggcgt accgttcctg tctaaaatcc ctttaatcgg 486tgttt agctcccgct ctgattctaa cgaggaaagc acgttatacg tgctcgtcaa 492ccata gtacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc 498gtgac cgctacactt gccagcgccctagcgcccgc tcctttcgct ttcttccctt 5ttctcgc cacgttcgcc ggctttcccc gtcaagctct aaatcggggg ctccctttag 5tccgatt tagtgcttta cggcacctcg accccaaaaa acttgattag ggtgatggtt 5gtagtgg gccatcgccc tgatagacgg tttttcgccc tttgacgttg gagtccacgt 522aatag tggactcttg ttccaaactg gaacaacact caaccctatc tcggtctatt 528gattt ataagggatt ttgccgattt cggcctattg gttaaaaaat gagctgattt 534aaatt taacgcgaat tttaacaaaa tattaacgtt tacaatttaa atatttgctt 54aatctt cctgtttttg gggcttttctgattatcaac cggggtacat atgattgaca 546gtttt acgattaccg ttcatcgatt ctcttgtttg ctccagactc tcaggcaatg 552atagc ctttgtagag acctctcaaa aatagctacc ctctccggca tgaatttatc 558gaacg gttgaatatc atattgatgg tgatttgact gtctccggcc tttctcaccc 564aatct ttacctacac attactcagg cattgcattt aaaatatatg agggttctaa 57ttttat ccttgcgttg aaataaaggc ttctcccgca aaagtattac agggtcataa 576ttggt acaaccgatt tagctttatg ctctgaggct ttattgctta attttgctaa 582tgcct tgcctgtatg atttattggatgttggaatt cctgatgcgg tattttctcc 588catct gtgcggtatt tcacaccgca tatggtgcac tctcagtaca atctgctctg 594gcata gttaagccag ccccgacacc cgccaacacc cgctgacgcg ccctgacggg 6gtctgct cccggcatcc gcttacagac aagctgtgac cgtctccggg agctgcatgt 6agaggtt ttcaccgtca tcaccgaaac gcgcgagacg aaagggcctc gtgatacgcc 6ttttata ggttaatgtc atgataataa tggtttctta gacgtcaggt ggcacttttc 6gaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc 624atgag acaataaccc tgataaatgcttcaataata ttgaaaaagg aagagtatga 63tcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt 636caccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg ggtgcacgag 642tacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt cgccccgaag 648tttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgta 654gccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat gacttggttg 66ctcacc agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatgca 666gccat aaccatgagt gataacactgcggccaactt acttctgaca acgatcggag 672aagga gctaaccgct tttttgcaca acatggggga tcatgtaact cgccttgatc 678gaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc acgatgcctg 684atggc aacaacgttg cgcaaactat taactggcga actacttact ctagcttccc 69acaatt aatagactgg atggaggcgg ataaagttgc aggaccactt ctgcgctcgg 696ccggc tggctggttt attgctgata aatctggagc cggtgagcgt gggtctcgcg 7tcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt atctacacga 7ggagtca ggcaactatg gatgaacgaaatagacagat cgctgagata ggtgcctcac 7ttaagca ttggtaactg tcagaccaag tttactcata tatactttag attgatttaa 72tcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat ctcatgacca 726cctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag 732tcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac 738ccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa 744ttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg tagttaggcc 75cttcaa gaactctgta gcaccgcctacatacctcgc tctgctaatc ctgttaccag 756gctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac 762aaggc gcagcggtcg ggctgaacgg

ggggttcgtg cacacagccc agcttggagc 768accta caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc 774gggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca 78ggagct tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc786cttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg 792aacgc ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct 798gcgtt atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata 8ctcgccg cagccgaacg accgagcgcagcgagtcagt gagcgaggaa gcggaagagc 8caatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc a 827deno-associated virus misc_feature (7AAV chimeric capsid coding sequence 3 atg gct gcc gat ggt tat ctt cca gat tgg ctc gag gacact ctc tct 48 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser gga ata aga cag tgg tgg aag ctc aaa cct ggc cca cca cca cca 96 Glu Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro 2 aag ccc gca gag cgg cataag gac gac agc agg ggt ctt gtg ctt cct Pro Ala Glu Arg His Lys Asp Asp Ser Arg Gly Leu Val Leu Pro 35 4g tac aag tac ctc gga ccc ttc aac gga ctc gac aag gga gag ccg Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 5 gtc aac gag gca gac gcc gcg gcc ctc gag cac gac aaa gcc tac gac 24sn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 7 cgg cag ctc gac agc gga gac aac ccg tac ctc aag tac aac cac gcc 288 Arg Gln Leu Asp Ser Gly Asp Asn Pro TyrLeu Lys Tyr Asn His Ala 85 9c gcg gag ttt cag gag cgc ctt aaa gaa gat acg tct ttt ggg ggc 336 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly ctc gga cga gca gtc ttc cag gcg aaa aag agg gtt ctt gaa cct 384 Asn LeuGly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro ggc ctg gtt gag gaa cct gtt aag acg gct ccg gga aaa aag agg 432 Leu Gly Leu Val Glu Glu Pro Val Lys Thr Ala Pro Gly Lys Lys Arg gta gag cac tct cct gtg gag cca gactcc tcc tcg gga acc gga 48al Glu His Ser Pro Val Glu Pro Asp Ser Ser Ser Gly Thr Gly aag gcg ggc cag cag cct gca aga aaa aga ttg aat ttt ggt cag act 528 Lys Ala Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln Thr gac gca gac tca gta cct gac ccc cag cct ctc gga cag cca cca 576 Gly Asp Ala Asp Ser Val Pro Asp Pro Gln Pro Leu Gly Gln Pro Pro gcc ccc tct ggt ctg gga act aat acg atg act tca gtt aat tct 624 Ala Ala Pro Ser Gly Leu Gly Thr Asn ThrMet Thr Ser Val Asn Ser 2gaa gcc agc act ggt gca gga ggg ggg ggc agt aat tct gtc aaa 672 Ala Glu Ala Ser Thr Gly Ala Gly Gly Gly Gly Ser Asn Ser Val Lys 222tg tgg agt gag ggg gcc act ttt agt gct aac tct gta act tgt 72et Trp Ser Glu Gly Ala Thr Phe Ser Ala Asn Ser Val Thr Cys 225 234tt tcc aga cag ttt tta att cca tat gac cca gag cac cat tat 768 Thr Phe Ser Arg Gln Phe Leu Ile Pro Tyr Asp Pro Glu His His Tyr 245 25ag gtg ttt tct ccc gca gcg agtagc tgc cac aat gcc agt gga aag 8Val Phe Ser Pro Ala Ala Ser Ser Cys His Asn Ala Ser Gly Lys 267ca aag gtt tgc acc atc agt ccc ata atg gga tac tca acc cca 864 Glu Ala Lys Val Cys Thr Ile Ser Pro Ile Met Gly Tyr Ser Thr Pro 275 28gg aga tat tta gat ttt aat gct tta aat tta ttt ttt tca cct tta 9Arg Tyr Leu Asp Phe Asn Ala Leu Asn Leu Phe Phe Ser Pro Leu 29ttt cag cac tta att gaa aat tat gga agt ata gct cct gat gct 96he Gln His Leu Ile Glu Asn TyrGly Ser Ile Ala Pro Asp Ala 33tta act gta acc ata tca gaa att gct gtt aag gat gtt aca gac aaa u Thr Val Thr Ile Ser Glu Ile Ala Val Lys Asp Val Thr Asp Lys 325 33ct gga ggg ggg gta cag gtt act gac agc act aca ggg cgc cta tgcr Gly Gly Gly Val Gln Val Thr Asp Ser Thr Thr Gly Arg Leu Cys 345ta gta gac cat gaa tac aag tac cca tat gtg tta ggg caa ggt t Leu Val Asp His Glu Tyr Lys Tyr Pro Tyr Val Leu Gly Gln Gly 355 36ag gat act tta gcc cca gaactt cct att tgg gta tac ttt ccc cct n Asp Thr Leu Ala Pro Glu Leu Pro Ile Trp Val Tyr Phe Pro Pro 378at gct tac tta aca gta gga gat gtt aac aca caa gga att tct n Tyr Ala Tyr Leu Thr Val Gly Asp Val Asn Thr Gln Gly Ile Ser 38539gac agc aaa aaa tta gca agt gaa gaa tca gca ttt tat gtt ttg y Asp Ser Lys Lys Leu Ala Ser Glu Glu Ser Ala Phe Tyr Val Leu 44cac agt tct ttt cag ctt tta ggt aca gga ggt aca gca act atg u His Ser Ser Phe Gln LeuLeu Gly Thr Gly Gly Thr Ala Thr Met 423at aag ttt cct cca gtg ccc cca gaa aat tta gag ggc tgc agt r Tyr Lys Phe Pro Pro Val Pro Pro Glu Asn Leu Glu Gly Cys Ser 435 44aa cac ttt tat gaa atg tac aat ccc tta tac gga tcc cgc ttaggg n His Phe Tyr Glu Met Tyr Asn Pro Leu Tyr Gly Ser Arg Leu Gly 456ct gac aca tta gga ggt gac cca aaa ttt aga tct tta aca cat l Pro Asp Thr Leu Gly Gly Asp Pro Lys Phe Arg Ser Leu Thr His 465 478ac cat gca attcag ccc caa aac ttc atg cca ggg cca cta gta u Asp His Ala Ile Gln Pro Gln Asn Phe Met Pro Gly Pro Leu Val 485 49ac tca gtg tct aca aag gag gga gac agc tct aat act gga gct gga n Ser Val Ser Thr Lys Glu Gly Asp Ser Ser Asn Thr Gly AlaGly 55gcc tta aca ggc ctt agc aca ggt acc tct caa aac act aga ata s Ala Leu Thr Gly Leu Ser Thr Gly Thr Ser Gln Asn Thr Arg Ile 5525 tcc tta cgc cct ggg cca gtg tct cag cca tac cac cac tgg gac aca r Leu Arg Pro Gly ProVal Ser Gln Pro Tyr His His Trp Asp Thr 534aa tat gtc aca gga ata aat gcc att tct cat ggt cag acc act p Lys Tyr Val Thr Gly Ile Asn Ala Ile Ser His Gly Gln Thr Thr 545 556gt aac gct gaa gac aaa gag tat cag caa gga gtgggt aga ttt r Gly Asn Ala Glu Asp Lys Glu Tyr Gln Gln Gly Val Gly Arg Phe 565 57ca aat gaa aaa gaa cag cta aaa cag tta cag ggt tta aac atg cac o Asn Glu Lys Glu Gln Leu Lys Gln Leu Gln Gly Leu Asn Met His 589ac ttt cccaat aaa gga acc cag caa tat aca gat caa att gag r Tyr Phe Pro Asn Lys Gly Thr Gln Gln Tyr Thr Asp Gln Ile Glu 595 6cgc ccc cta atg gtg ggt tct gta tgg aac aga aga gcc ctt cac tat g Pro Leu Met Val Gly Ser Val Trp Asn Arg Arg Ala LeuHis Tyr 662gc cag ctg tgg agt aaa att cca aat tta gat gac agt ttt aaa u Ser Gln Leu Trp Ser Lys Ile Pro Asn Leu Asp Asp Ser Phe Lys 625 634ag ttt gca gcc tta gga gga tgg ggt ttg cat cag cca cct cct r Gln Phe AlaAla Leu Gly Gly Trp Gly Leu His Gln Pro Pro Pro 645 65aa ata ttt tta aaa ata tta cca caa agt ggg cca att gga ggt att 2 Ile Phe Leu Lys Ile Leu Pro Gln Ser Gly Pro Ile Gly Gly Ile 667ca atg gga att act acc tta gtt cag tat gccgtg gga att atg 2 Ser Met Gly Ile Thr Thr Leu Val Gln Tyr Ala Val Gly Ile Met 675 68ca gta act atg aca ttt aaa ttg ggg ccc cgt aaa gct acg gga cgg 2 Val Thr Met Thr Phe Lys Leu Gly Pro Arg Lys Ala Thr Gly Arg 69aat cctcaa cct gga gta tat ccc ccg cac gca gca ggt cat tta 2 Asn Pro Gln Pro Gly Val Tyr Pro Pro His Ala Ala Gly His Leu 77cca tat gta cta tat gac ccc aca gct aca gat gca aaa caa cac cac 22Tyr Val Leu Tyr Asp Pro Thr Ala Thr Asp AlaLys Gln His His 725 73ga cat gga tat gaa aag cct gaa gaa ttg tgg aca gcc aaa agc cgt 2256 Arg His Gly Tyr Glu Lys Pro Glu Glu Leu Trp Thr Ala Lys Ser Arg 745ac cca ttg taa 227is Pro Leu 755 4 756 PRT Adeno-associated virusmisc_feature (7AAV chimeric capsid coding sequence 4 Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Thr Leu Ser Gly Ile Arg Gln Trp Trp Lys Leu Lys Pro Gly Pro Pro Pro Pro 2 Lys Pro Ala Glu Arg His Lys Asp Asp SerArg Gly Leu Val Leu Pro 35 4y Tyr Lys Tyr Leu Gly Pro Phe Asn Gly Leu Asp Lys Gly Glu Pro 5 Val Asn Glu Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 7 Arg Gln Leu Asp Ser Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 9p Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Gly Leu Val Glu Glu Pro Val Lys Thr Ala Pro Gly Lys Lys Arg Val Glu His Ser ProVal Glu Pro Asp Ser Ser Ser Gly Thr Gly Lys Ala Gly Gln Gln Pro Ala Arg Lys Arg Leu Asn Phe Gly Gln Thr Asp Ala Asp Ser Val Pro Asp Pro Gln Pro Leu Gly Gln Pro Pro Ala Pro Ser Gly Leu Gly Thr Asn Thr MetThr Ser Val Asn Ser 2Glu Ala Ser Thr Gly Ala Gly Gly Gly Gly Ser Asn Ser Val Lys 222et Trp Ser Glu Gly Ala Thr Phe Ser Ala Asn Ser Val Thr Cys 225 234he Ser Arg Gln Phe Leu Ile Pro Tyr Asp Pro Glu His His Tyr245 25ys Val Phe Ser Pro Ala Ala Ser Ser Cys His Asn Ala Ser Gly Lys 267la Lys Val Cys Thr Ile Ser Pro Ile Met Gly Tyr Ser Thr Pro 275 28rp Arg Tyr Leu Asp Phe Asn Ala Leu Asn Leu Phe Phe Ser Pro Leu 29Phe GlnHis Leu Ile Glu Asn Tyr Gly Ser Ile Ala Pro Asp Ala 33Leu Thr Val Thr Ile Ser Glu Ile Ala Val Lys Asp Val Thr Asp Lys 325 33hr Gly Gly Gly Val Gln Val Thr Asp Ser Thr Thr Gly Arg Leu Cys 345eu Val Asp His Glu Tyr LysTyr Pro Tyr Val Leu Gly Gln Gly 355 36ln Asp Thr Leu Ala Pro Glu Leu Pro Ile Trp Val Tyr Phe Pro Pro 378yr Ala Tyr Leu Thr Val Gly Asp Val Asn Thr Gln Gly Ile Ser 385 39Asp Ser Lys Lys Leu Ala Ser Glu Glu Ser Ala PheTyr Val Leu 44His Ser Ser Phe Gln Leu Leu Gly Thr Gly Gly Thr Ala Thr Met 423yr Lys Phe Pro Pro Val Pro Pro Glu Asn Leu Glu Gly Cys Ser 435 44ln His Phe Tyr Glu Met Tyr Asn Pro Leu Tyr Gly Ser Arg Leu Gly 456ro Asp Thr Leu Gly Gly Asp Pro Lys Phe Arg Ser Leu Thr His 465 478sp His Ala Ile Gln Pro Gln Asn Phe Met Pro Gly Pro Leu Val 485 49sn Ser Val Ser Thr Lys Glu Gly Asp Ser Ser Asn Thr Gly Ala Gly 55Ala Leu Thr GlyLeu Ser Thr Gly Thr Ser Gln Asn Thr Arg Ile 5525 Ser Leu Arg Pro Gly Pro Val Ser Gln Pro Tyr His His Trp Asp Thr 534ys Tyr Val Thr Gly Ile Asn Ala Ile Ser His Gly Gln Thr Thr 545 556ly Asn Ala Glu Asp Lys Glu Tyr GlnGln Gly Val Gly Arg Phe 565 57ro Asn Glu Lys Glu Gln Leu Lys Gln Leu Gln Gly Leu Asn Met His 589yr Phe Pro Asn Lys Gly Thr Gln Gln Tyr Thr Asp Gln Ile Glu 595 6Arg Pro Leu Met Val Gly Ser Val Trp Asn Arg Arg Ala Leu His Tyr662er Gln Leu Trp Ser Lys Ile Pro Asn Leu Asp Asp Ser Phe Lys 625 634ln Phe Ala Ala Leu Gly Gly Trp Gly Leu His Gln Pro Pro Pro 645 65ln Ile Phe Leu Lys Ile Leu Pro Gln Ser Gly Pro Ile Gly Gly Ile 667erMet Gly Ile Thr Thr Leu Val Gln Tyr Ala Val Gly Ile Met 675 68hr Val Thr Met Thr Phe Lys Leu Gly Pro Arg Lys Ala Thr Gly Arg 69Asn Pro Gln Pro Gly Val Tyr Pro Pro His Ala Ala Gly His Leu 77Pro Tyr Val Leu Tyr Asp ProThr Ala Thr Asp Ala Lys Gln His His 725 73rg His Gly Tyr Glu Lys Pro Glu Glu Leu Trp Thr Ala Lys Ser Arg 745is Pro Leu 755 5 8 Adeno-associated virus 5 aattcccatc atcaataata taccttattt tggattgaag ccaatatgat aatgaggggg 6tttgt gacgtggcgc ggggcgtggg aacggggcgg gtgacgtagt agtctctaga ctgtatt agaggtcacg tgagtgtttt gcgacatttt gcgacaccat gtggtcacgc gtattta agcccgagtg agcacgcagg gtctccattt tgaagcggga ggtttgaacg 24ccgcc atgccggggt tttacgagat tgtgattaaggtccccagcg accttgacgg 3ctgccc ggcatttctg acagctttgt gaactgggtg gccgagaagg aatgggagtt 36cagat tctgacatgg atctgaatct gattgagcag gcacccctga ccgtggccga 42tgcag cgcgactttc tgacggaatg gcgccgtgtg agtaaggccc cggaggccct 48ttgtgcaatttgaga agggagagag ctacttccac atgcacgtgc tcgtggaaac 54gggtg aaatccatgg ttttgggacg tttcctgagt cagattcgcg aaaaactgat 6agaatt taccgcggga tcgagccgac tttgccaaac tggttcgcgg tcacaaagac 66atggc gccggaggcg ggaacaaggt ggtggatgag tgctacatccccaattactt 72ccaaa acccagcctg agctccagtg ggcgtggact aatatggaac agtatttaag 78gtttg aatctcacgg agcgtaaacg gttggtggcg cagcatctga cgcacgtgtc 84cgcag gagcagaaca aagagaatca gaatcccaat tctgatgcgc cggtgatcag 9aaaact tcagccaggtacatggagct ggtcgggtgg ctcgtggaca aggggattac 96agaag cagtggatcc aggaggacca ggcctcatac atctccttca atgcggcctc actcgcgg tcccaaatca aggctgcctt ggacaatgcg ggaaagatta tgagcctgac aaaccgcc cccgactacc tggtgggcca gcagcccgtg gaggacatttccagcaatcg tttataaa attttggaac taaacgggta cgatccccaa tatgcggctt ccgtctttct gatgggcc acgaaaaagt tcggcaagag gaacaccatc tggctgtttg ggcctgcaac ccgggaag accaacatcg cggaggccat agcccacact gtgcccttct acgggtgcgt actggacc aatgagaactttcccttcaa cgactgtgtc gacaagatgg tgatctggtg aggagggg aagatgaccg ccaaggtcgt ggagtcggcc aaagccattc tcggaggaag aggtgcgc gtggaccaga aatgcaagtc ctcggcccag atagacccga ctcccgtgat tcacctcc aacaccaaca tgtgcgccgt gattgacggg aactcaacgaccttcgaaca agcagccg ttgcaagacc ggatgttcaa atttgaactc acccgccgtc tggatcatga ttgggaag gtcaccaagc aggaagtcaa agactttttc cggtgggcaa aggatcacgt ttgaggtg gagcatgaat tctacgtcaa aaagggtgga gccaagaaaa gacccgcccc gtgacgca gatataagtgagcccaaacg ggtgcgcgag tcagttgcgc agccatcgac cagacgcg gaagcttcga tcaactacgc agacaggtac caaaacaaat gttctcgtca tgggcatg aatctgatgc tgtttccctg cagacaatgc gagagaatga atcagaattc atatctgc ttcactcacg gacagaaaga ctgtttagag tgctttcccgtgtcagaatc aacccgtt tctgtcgtca aaaaggcgta tcagaaactg tgctacattc atcatatcat 2aaaggtg ccagacgctt gcactgcctg cgatctggtc aatgtggatt tggatgactg 2ctttgaa caataaatga tttaaatcag gtatggctgc cgatggttat cttccagatt 2tcgagga cactctctctgaaggaataa

gacagtggtg gaagctcaaa cctggcccac 222ccaaa gcccgcagag cggcataagg acgacagcag gggtcttgtg cttcctgggt 228tacct cggacccttc aacggactcg acaagggaga gccggtcaac gaggcagacg 234gccct cgagcacgac aaagcctacg accggcagct cgacagcgga gacaacccgt24caagta caaccacgcc gacgcggagt ttcaggagcg ccttaaagaa gatacgtctt 246ggcaa cctcggacga gcagtcttcc aggcgaaaaa gagggttctt gaacctctgg 252gttga ggaacctgtt aagacggctc cgggaaaaaa gaggccggta gagcactctc 258gagcc agactcctcc tcgggaaccggaaaggcggg ccagcagcct gcaagaaaaa 264aattt tggtcagact ggagacgcag actcagtacc tgacccccag cctctcggac 27accagc agccccctct ggtctgggaa ctaatacgat ggctacaggc agtggcgcac 276gcaga caataacgag ggcgccgacg gagtgggtaa ttcctccgga aattggcatt 282tccac atggatgggc gacagagtca tcaccaccag cacccgaacc tgggccctgc 288tacaa caaccacctc tacaaacaaa tttccagcca atcaggagcc tcgaacgaca 294tactt tggctacagc accccttggg ggtattttga cttcaacaga ttccactgcc 3tttcacc acgtgactgg caaagactcatcaacaacaa ctggggattc cgacccaaga 3tcaactt caagctcttt aacattcaag tcaaagaggt cacgcagaat gacggtacga 3cgattgc caataacctt accagcacgg ttcaggtgtt tactgactcg gagtaccagc 3cgtacgt gctcgggtcg gcgcaccaag gctgtctccc gccgtttcca gcggacgtct 324gtccc tcagtatgga tacctcaccc tgaacaacgg aagtcaagcg gtgggacgct 33ctttta ctgcctggag tacttccctt cgcagatgct aaggactgga aataacttcc 336agcta taccttcgag gatgtacctt ttcacagcag ctacgctcac agccagagtt 342cgctt gatgaatcct cttattgatcagtatctgta ctacctgaac agaacgcaag 348acctc tggaacaacc aaccaatcac ggctgctttt tagccaggct gggcctcagt 354tcttt gcaggccaga aattggctac ctgggccctg ctaccggcaa cagagacttt 36gactgc taacgacaac aacaacagta actttccttg gacagcggcc agcaaatatc 366aatgg ccgcgactcg ctggtgaatc caggaccagc tatggccagt cacaaggacg 372gaaaa atttttccct atgcacggca atctaatatt tggcaaagaa gggacaacgg 378aacgc agaattagat aatgtaatga ttacggatga agaagagatt cgtaccacca 384gtggc aacagagcag tatggaactgtggcaaataa cttgcagagc tcaaatacag 39cacgac tggaactgtc aatcatcagg gggccttacc tggcatggtg tggcaagatc 396gtgta ccttcaagga cctatctggg caaagattcc tcacacggat ggacactttc 4cttctcc tctgatggga ggctttggac tgaaacatcc gcctcctcaa atcatgatca 4atactcc ggtacctgcg aatccttcga ccaccttcag tgcggcaaag tttgcttcct 4tcacaca gtactccacg ggacaggtca gcgtggagat cgagtgggag ctgcagaagg 42cagcaa acgctggaat cccgaaattc agtacacttc caactacaac aagtctgtta 426ggact taccgtggat actaatggcgtgtattcaga gcctcgcccc attggcacca 432ctgac tcgtaatctg taattgcttg ttaatcaata aaccgtttaa ttcgtttcag 438ctttg gtctctgcgt atttctttct tatctagttt ccatgctcta gactactacg 444cgccc cgttcccacg ccccgcgcca cgtcacaaac tccaccccct cattatcata 45cttcaa tccaaaataa ggtatattat tgatgatgca tcgctggcgt aatagcgaag 456cgcac cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa tggaattcca 462ttgag cgtcaaaatg taggtatttc catgagcgtt tttcctgttg caatggctgg 468atatt gttctggata ttaccagcaaggccgatagt ttgagttctt ctactcaggc 474atgtt attactaatc aaagaagtat tgcgacaacg gttaatttgc gtgatggaca 48ctttta ctcggtggcc tcactgatta taaaaacact tctcaggatt ctggcgtacc 486tgtct aaaatccctt taatcggcct cctgtttagc tcccgctctg attctaacga 492gcacg ttatacgtgc tcgtcaaagc aaccatagta cgcgccctgt agcggcgcat 498gcggc gggtgtggtg gttacgcgca gcgtgaccgc tacacttgcc agcgccctag 5ccgctcc tttcgctttc ttcccttcct ttctcgccac gttcgccggc tttccccgtc 5ctctaaa tcgggggctc cctttagggttccgatttag tgctttacgg cacctcgacc 5aaaaact tgattagggt gatggttcac gtagtgggcc atcgccctga tagacggttt 522ccttt gacgttggag tccacgttct ttaatagtgg actcttgttc caaactggaa 528ctcaa ccctatctcg gtctattctt ttgatttata agggattttg ccgatttcgg 534tggtt aaaaaatgag ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat 54gtttac aatttaaata tttgcttata caatcttcct gtttttgggg cttttctgat 546accgg ggtacatatg attgacatgc tagttttacg attaccgttc atcgattctc 552tgctc cagactctca ggcaatgacctgatagcctt tgtagagacc tctcaaaaat 558ccctc tccggcatga atttatcagc tagaacggtt gaatatcata ttgatggtga 564ctgtc tccggccttt ctcacccgtt tgaatcttta cctacacatt actcaggcat 57tttaaa atatatgagg gttctaaaaa tttttatcct tgcgttgaaa taaaggcttc 576caaaa gtattacagg gtcataatgt ttttggtaca accgatttag ctttatgctc 582cttta ttgcttaatt ttgctaattc tttgccttgc ctgtatgatt tattggatgt 588ttcct gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatat 594actct cagtacaatc tgctctgatgccgcatagtt aagccagccc cgacacccgc 6cacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 6tgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 6gacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 6cttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 624taaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 63atattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 636gcggc attttgcctt cctgtttttgctcacccaga aacgctggtg aaagtaaaag 642gaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 648cttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 654tgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 66ctattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 666atgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 672ttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 678gatca tgtaactcgc cttgatcgttgggaaccgga gctgaatgaa gccataccaa 684gagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 69cgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 696gcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 7gagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca gatggtaagc 7cccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 7agatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 72atatat actttagatt gatttaaaacttcattttta atttaaaagg atctaggtga 726ctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 732gaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 738tgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 744ccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 75tctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 756gctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 762ttgga ctcaagacga tagttaccggataaggcgca gcggtcgggc tgaacggggg 768tgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 774ctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 78cagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 786agtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 792gggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 798tggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct gtggataacc 8ttaccgc ctttgagtga gctgataccgctcgccgcag ccgaacgacc gagcgcagcg 8cagtgag cgaggaagcg gaagagcgcc caatacgcaa accgcctctc cccgcgcgtt 8cgattca ttaatgcag 87 DNA Artificial sequence Synthetic oligonucleotide 6 aattcgccgg cgatatc DNA Artificial sequence Syntheticoligonucleotide 7 tcgagatatc gccggc DNA Artificial sequence Synthetic oligonucleotide 8 ggcgatatcg cc DNA Artificial sequence Synthetic oligonucleotide 9 gctagcggcg gacaccatca ccaccaccat caccacggcg gaagcgct 48 NA Artificialsequence Synthetic oligonucleotide cttccg ccgtggtgat ggtggtggtg atggtgtccg ccgctagc 48 NA Artificial sequence Synthetic oligonucleotide tagcgg cggacaccat caccaccacc atcaccacgg cggaagcgct t 5 DNA Artificial sequence Syntheticoligonucleotide gcttcc gccgtggtga tggtggtggt gatggtgtcc gccgctagcg t 5 DNA Artificial sequence Synthetic oligonucleotide tccgga gggcaccacc atcaccacca ccatcacgga ggcgccagcg a 5 DNA Artificial sequence Synthetic oligonucleotidetggcgc ctccgtgatg gtggtggtga tggtggtgcc ctccggaacc c 5 DNA Artificial sequence Synthetic oligonucleotide gatccg gcggcggctc cagacccccc ggcttcagcc ccttcagatc cggcggcgcc 6 DNA Artificial sequence Synthetic oligonucleotide ccgccg gatctgaagg ggctgaagcc ggggggtctg gagccgccgc cggatccggc 6 DNA Artificial sequence Synthetic oligonucleotide ttcatg tgactgcggg ggaagacccc ctggcttcag cccattcaga ggtggctgct 6ggcg 69 NA Artificial sequence Syntheticoligonucleotide acagaa gcagccacct ctgaatgggc tgaagccagg gggtcttccc ccgcagtcac 6cctc 69 NA Artificial sequence Synthetic oligonucleotide tcatgt gactgcgggg gaagaccccc tggcttcagc ccattcagag gtggctgctt 6gcgg 69 2AArtificial sequence Synthetic oligonucleotide 2acaga agcagccacc tctgaatggg ctgaagccag ggggtcttcc cccgcagtca 6acct 69 2A Artificial sequence Synthetic oligonucleotide 2ctgcg actgcagggg cgattgtttc tgcggc 36 22 36 DNA Artificialsequence Synthetic oligonucleotide 22 gccgcagaaa caatcgcccc tgcagtcgca ggatcc 36 23 36 DNA Artificial sequence Synthetic oligonucleotide 23 gatcctcgga ctgcaggggc gattgtttct gcggcg 36 24 36 DNA Artificial sequence Synthetic oligonucleotide 24 cgccgcagaaacaatcgccc ctgcagtcgc aggatc 36 25 36 DNA Artificial sequence Synthetic oligonucleotide 25 aggatcctgc gactgcaggg gcgattgttt ctgcgg 36 26 36 DNA Artificial sequence Synthetic oligonucleotide 26 ccgcagaaac aatcgcccct gcagtcgcag gatcct 36 27 63 DNAArtificial sequence Synthetic oligonucleotide 27 aggttcatgt gactgcgggg gaaagaagaa gaagaagaag aagggcggct gcttctgtgg 63 28 63 DNA Artificial sequence Synthetic oligonucleotide 28 ccgccacaga agcagccgcc cttcttcttc ttcttcttct ttcccccgca gtcacatgaa 63 29 25 DNA Artificial sequence Synthetic oligonucleotide 29 tgccgagcca tcgacgtcag acgcg 25 3A Artificial sequence Synthetic oligonucleotide 3tgtta acacacaagg cgttcttcca 3 DNA Artificial sequence Synthetic oligonucleotide 3tgtta acatctgcgg tagctgcttg 3 DNA Artificial sequence Synthetic oligonucleotide 32 cagagagtta acagacaagc agctaccgc 29 33 3rtificial sequence Synthetic oligonucleotide 33 gtctgttaac tctctggagg ttggtagata 3 DNA Artificial sequenceSynthetic oligonucleotide 34 acaaatgtta acattgaaaa ggtcatgatt 3 DNA Artificial sequence Synthetic oligonucleotide 35 ttcaatgtta acatttgttt tctctgagcc 3 DNA Artificial sequence Synthetic oligonucleotide 36 ggacgatatc gaaaagtttt ttcctcag 2837 28 DNA Artificial sequence Synthetic oligonucleotide 37 acttttcgat atcgtccttg tggcttgc 28 38 3rtificial sequence Synthetic oligonucleotide 38 tctctggtta acccgggccc ggccatggca 3 DNA Artificial sequence Synthetic oligonucleotide 39gcccgggtta accagagagt ctctgccatt 3 DNA Artificial sequence Synthetic oligonucleotide 4agcca tcgacgtcag acgcg 25 4A Artificial sequence Synthetic oligonucleotide 4tgcat caaagttcaa ctgaaacgaa t 3 DNA Artificial sequenceSynthetic oligonucleotide 42 gatacttaag atctagtgga accaccacgc actcaaaggc tt 42 43 42 DNA Artificial sequence Synthetic oligonucleotide 43 ctagcttaag catgcataca ggtactggtc gatgagagga tt 42 44 25 DNA Artificial sequence Synthetic oligonucleotide 44tgccgagcca tcgacgtcag acgcg 25 45 3rtificial sequence Synthetic oligonucleotide 45 catgatgcat caaagttcaa ctgaaacgaa t 3 DNA Artificial sequence Synthetic oligonucleotide 46 cgagctcttc gatggctaca ggcagtggcg cac 33 47 36 DNA Artificialsequence Synthetic oligonucleotide 47 agcgctcttc ccatcgtatt agttcccaga ccagag 36 48 33 DNA Artificial sequence Synthetic oligonucleotide 48 cgagctcttc gacggctccg ggaaaaaaga ggc 33 49 36 DNA Artificial sequence Synthetic oligonucleotide 49 agcgctcttcccgtcttaac aggttcctca accagg 36 5A Artificial sequence Synthetic oligonucleotide 5tcttc gatgcgtgca gcagctggag gagctg 36 5A Artificial sequence Synthetic oligonucleotide 5tcttc gcatctcact gtcatcagac gagtcg 36 52 33 DNAArtificial sequence Synthetic oligonucleotide 52 cgagctcttc gacggctcct ggaaagaaga gac 33 53 36 DNA Artificial sequence Synthetic oligonucleotide 53 agcgctcttc ccgtctcacc cgcttgctca accaga 36 54 36 DNA Artificial sequence Synthetic oligonucleotide 54agttactctt ccatgacttc agttaattct gcagaa 36 55 36 DNA Artificial sequence Synthetic oligonucleotide 55 agttactctt ctttacaatg ggtgcacacg gctttt 36 56 36 DNA Artificial sequence Synthetic oligonucleotide 56 agttactctt cttaatcgtg gacttaccgt ggatac 36 57 36DNA Artificial sequence Synthetic oligonucleotide 57 agttactctt cccatcgtat tagttcccag accaga 36 58 29 DNA Artificial sequence Synthetic oligonucleotide 58 aagcgccgcg gccgctgctt atgtacgca 29 59 27 DNA Artificial sequence Synthetic oligonucleotide 59gacgcggaag cttcggtgga ctacgcg 27

* * * * *

US Patent: 
7172893

Virus vectors and methods of making and administering the same

We are your best, most user-friendly source for searching patents and patent attorneys on the Internet.
 
<- Previous Patent (Nucleic acid molecul...)   |   Next Patent (Reductase gene and u...)->